http://2014hs.igem.org/wiki/index.php?title=Team:Shenzhen_SFLS/Notebook&feed=atom&action=history
Team:Shenzhen SFLS/Notebook - Revision history
2024-03-29T06:17:45Z
Revision history for this page on the wiki
MediaWiki 1.16.5
http://2014hs.igem.org/wiki/index.php?title=Team:Shenzhen_SFLS/Notebook&diff=27945&oldid=prev
AdrianaL at 04:02, 21 June 2014
2014-06-21T04:02:01Z
<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 04:02, 21 June 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 73:</td>
<td colspan="2" class="diff-lineno">Line 73:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></table></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></table></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><h3>Plasmid</h3></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><img src="https://static.igem.org/mediawiki/2014hs/0/01/Too-late.png"/></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><h3>Enzyme</h3></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><h3>Enzyme</h3></div></td></tr>
</table>
AdrianaL
http://2014hs.igem.org/wiki/index.php?title=Team:Shenzhen_SFLS/Notebook&diff=27906&oldid=prev
AdrianaL: Created page with "{{Template:2014_Shenzhen_SFLS_Inject}} <html> <main id="main"> <!-- PJAX Content Start --> <div class="container"> <h1>Notebook</h1> <h2>Material</h2> <h3>Bacteria strains</h3>..."
2014-06-21T03:59:11Z
<p>Created page with "{{Template:2014_Shenzhen_SFLS_Inject}} <html> <main id="main"> <!-- PJAX Content Start --> <div class="container"> <h1>Notebook</h1> <h2>Material</h2> <h3>Bacteria strains</h3>..."</p>
<p><b>New page</b></p><div>{{Template:2014_Shenzhen_SFLS_Inject}}<br />
<html><br />
<main id="main"><br />
<!-- PJAX Content Start --><br />
<div class="container"><br />
<h1>Notebook</h1><br />
<br />
<h2>Material</h2><br />
<br />
<h3>Bacteria strains</h3><br />
<br />
<table><br />
<thead><br />
<tr><br />
<th>Strain name </th><br />
<th> Risk group</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td>E.coli strain DH5α </td><br />
<td> 1</td><br />
</tr><br />
<tr><br />
<td>E.coli strain Mg1655 </td><br />
<td> 1</td><br />
</tr><br />
<tr><br />
<td>E.coli strain BL21 </td><br />
<td> 1</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<br />
<h3>Primer</h3><br />
<br />
<table><br />
<thead><br />
<tr><br />
<th>Name </th><br />
<th> Sequence </th><br />
<th> Length</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td>LGT F </td><br />
<td> ctggaattcatcgatcgttctagagaggccgccgcaaaagaa </td><br />
<td> 42</td><br />
</tr><br />
<tr><br />
<td>LGT R </td><br />
<td> ggactgcagattattatactagtattaagctctagtggaaacctgt </td><br />
<td> 46</td><br />
</tr><br />
<tr><br />
<td>SH3 F </td><br />
<td> cgctggctggtttagttttagcgtttagcgcaagcgcagctgaggccgccgcaaaagaa </td><br />
<td> 59</td><br />
</tr><br />
<tr><br />
<td>SH3 F2 </td><br />
<td> ctggaattcgcggccgcttctagatgaaaaagatttggctggcgctggctggtttagt </td><br />
<td> 58</td><br />
</tr><br />
<tr><br />
<td>SH3 R </td><br />
<td> ggactgcagcggccgctactagtatacttctccacgtaagggac </td><br />
<td> 44</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<br />
<h3>Enzyme</h3><br />
<br />
<table><br />
<thead><br />
<tr><br />
<th>name </th><br />
<th> manufacturer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td>QuickCut™ EcoRI </td><br />
<td> Takara</td><br />
</tr><br />
<tr><br />
<td>QuickCut™ SpeI </td><br />
<td> Takara</td><br />
</tr><br />
<tr><br />
<td>QuickCut™ PstI </td><br />
<td> Takara</td><br />
</tr><br />
<tr><br />
<td>QuickCut™ XbaI </td><br />
<td> Takara</td><br />
</tr><br />
<tr><br />
<td>T4 DNA Ligase </td><br />
<td> Takara</td><br />
</tr><br />
<tr><br />
<td>rTag PCR enzyme </td><br />
<td> Takara</td><br />
</tr><br />
<tr><br />
<td>Q5® High-Fidelity 2X Master Mix </td><br />
<td> New England Biolab</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<br />
<h3>Marker</h3><br />
<br />
<table><br />
<thead><br />
<tr><br />
<th>name </th><br />
<th> manufacturer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td>200bp DNA ladder marker </td><br />
<td> Takara</td><br />
</tr><br />
<tr><br />
<td>BlueRAY Prestained Protein Ladder </td><br />
<td> Jet Biofil</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<br />
<h3>Kit</h3><br />
<br />
<table><br />
<thead><br />
<tr><br />
<th>name </th><br />
<th> manufacturer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td>TIANprep Mini Plasmid Kit DP103 </td><br />
<td> Tiangen</td><br />
</tr><br />
<tr><br />
<td>TIANgel Midi Purification Kit DP209 </td><br />
<td> Tiangen</td><br />
</tr><br />
<tr><br />
<td>Aflatoxin B1 Elisa kit </td><br />
<td> Reagen</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<br />
<h3>Buffer</h3><br />
<br />
<table><br />
<thead><br />
<tr><br />
<th>name </th><br />
<th> manufacturer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td>10X QuickCut Green buffer </td><br />
<td> Takara</td><br />
</tr><br />
<tr><br />
<td>10X QuickCut buffer </td><br />
<td> Takara</td><br />
</tr><br />
<tr><br />
<td>10X T4 DNA ligase buffer </td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>dNTP Mixture </td><br />
<td> Takara</td><br />
</tr><br />
<tr><br />
<td>10X PCR buffer </td><br />
<td> Takara</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<br />
<h3>Competent Cell</h3><br />
<br />
<table><br />
<thead><br />
<tr><br />
<th>name </th><br />
<th> manufacturer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td>DH5α competent cell </td><br />
<td> Tiangen</td><br />
</tr><br />
<tr><br />
<td>BL21 competent cell </td><br />
<td> Tiangen</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<br />
<h2>Protocol</h2><br />
<br />
<h3>Transformation</h3><br />
<br />
<ol><br />
<li>Remove 30-50 μl competent cell into a clean 1.5 ml micro-centrifuge tube</li><br />
<li>Add 100ng plasmids or ligation products to the competence</li><br />
<li>Let stand on ice for 30 minutes</li><br />
<li>Heat shock for 90 seconds at 42°C</li><br />
<li>Let stand on ice for 5 minutes</li><br />
<li>Add 500 μl LB into the micro-centrifuge tube and incubate at 37°C for 45minutes</li><br />
<li>Centrifuge for 3 minutes at 3000rpm and leave 100 μl supernatant</li><br />
<li>Blow the bacteria up and add the bacteria into the corresponding plate</li><br />
<li>Incubate at 37°C overnight</li><br />
</ol><br />
<br />
<br />
<h3>Plasmids Purification</h3><br />
<br />
<ol><br />
<li>Remove 2ml overnight cultures bacteria into a micro-centrifuge tube, centrifuge for 1 minutes at 12000rpm and discard the supernatant (repeat it for one time)</li><br />
<li>Cell lysis<br />
<br />
<ol><br />
<li>Add 250 μl Buffer P1</li><br />
<li>Add 250 μl Buffer P2 and gently flip top to bottom for 6~7 times</li><br />
<li>Add 350 μl Buffer P3 and gently flip top to bottom for 6~7 times<br />
Centrifuge for 10 minutes at 13000rpm</li><br />
</ol><br />
</li><br />
<li>Wash silica membrane of the spin column with 500 μl Buffer BL , centrifuge for 1 minutes at 12000rpm and and discard the waste liquid</li><br />
<li>Remove the supernatant (from 3) to the spin column and let stand for 2 minutes</li><br />
<li>Centrifuge for 1 minutes at 12000rpm and discard the waste liquid</li><br />
<li>Add 600 μl Buffer PW , centrifuge for 1 minutes at 12000rpm and discard the waste liquid</li><br />
<li>Add 600 μl Buffer PW , centrifuge for 1 minutes at 12000rpm and discard the waste liquid</li><br />
<li>Centrifuge for 3 minutes at 13000rpm and discard the waste liquid</li><br />
<li>Put the column into a clean 1.5 ml micro-centrifuge tube and dry silica membrane for 10 minutes</li><br />
<li>Add 50 μl ddH2O (heated up to 55°C) and Add to the center of the column</li><br />
<li>Centrifuge for 1 minutes at 12000rpm to collect eluted DNA</li><br />
</ol><br />
<br />
<br />
<h3>Restriction Enzyme Digestions</h3><br />
<br />
<ol><br />
<li><p>Calculate the following requirement for enzymes reaction</p><br />
<br />
<table><br />
<thead><br />
<tr><br />
<th>name </th><br />
<th> amount</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td>10x Quickcut Buffer </td><br />
<td> 5μl</td><br />
</tr><br />
<tr><br />
<td>DNA solution </td><br />
<td> 1μg DNA</td><br />
</tr><br />
<tr><br />
<td>Enzyme(EcoRI or XbaI or SpeI or PstI) </td><br />
<td> 1μl per kind</td><br />
</tr><br />
<tr><br />
<td>ddH2O </td><br />
<td> Add to 50μl</td><br />
</tr><br />
</tbody><br />
</table><br />
</li><br />
<li><p>Incubate at 37°C for 40 minutes</p></li><br />
<li>Analyze by gel electrophoresis</li><br />
</ol><br />
<br />
<br />
<h3>Agarose Gel Electrophoresis</h3><br />
<br />
<ol><br />
<li>Confect a mixture in concentration of 1.5 ng agarose per 100 ml 1xTAE</li><br />
<li>Boil up the mixture until the agarose completely dissolved</li><br />
<li>Cool down to 50°C to 60°C</li><br />
<li>Pour it into a flat-bed tray and insert a comb</li><br />
<li>Put into the running buffer (1x TAE buffer)</li><br />
<li>Load the DNA mixture with loading buffer into the pockets</li><br />
<li>Electrophoreses for 35 minutes at 120V</li><br />
</ol><br />
<br />
<br />
<h3>Gel Extraction Of DNA Fragments</h3><br />
<br />
<ol><br />
<li>Get the gel parts containing the needed DNA fragement size from the agarose gel with a scalpel</li><br />
<li>Centrifuge for 30 seconds at 12000rpm</li><br />
<li>According to the volume of the gel and add Buffer PN of the same volume</li><br />
<li>Incubate at 55°C until the gel slices completely dissolved</li><br />
<li>Wash silica membrane of the spin column with 500 μl Buffer BL , centrifuge for 1 minutes at 12000rpm and and discard the waste liquid</li><br />
<li>Remove the liquid (from 4) to the spin column</li><br />
<li>Centrifuge for 1 minutes at 12000rpm and discard the waste liquid</li><br />
<li>Add 600 μl Buffer PW , centrifuge for 1 minutes at 12000rpm and discard the waste liquid</li><br />
<li>Add 600 μl Buffer PW , centrifuge for 1 minutes at 12000rpm and discard the waste liquid</li><br />
<li>Centrifuge for 3 minutes at 13000rpm and discard the waste liquid</li><br />
<li>Put the column into a clean 1.5 ml micro-centrifuge tube and dry silica membrane for 10 minutes</li><br />
<li>Add 25 μl ddH2O (heated up to 55°C) and Add to the center of the column</li><br />
<li>Centrifuge for 1 minutes at 12000rpm to collect eluted DNA</li><br />
</ol><br />
<br />
<br />
<h3>Ligation</h3><br />
<br />
<ol><br />
<li><p>Calculate the following requirement for enzymes reaction</p><br />
<br />
<table><br />
<thead><br />
<tr><br />
<th>name </th><br />
<th> amount</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td>10x T4 Buffer </td><br />
<td> 2μl</td><br />
</tr><br />
<tr><br />
<td>large fragments </td><br />
<td> 30ng DNA</td><br />
</tr><br />
<tr><br />
<td>small fragments </td><br />
<td> 60ng DNA</td><br />
</tr><br />
<tr><br />
<td>T4 ligase </td><br />
<td> 1μl</td><br />
</tr><br />
<tr><br />
<td>ddH2O </td><br />
<td> Add to 20μl</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<br />
<p> The reaction solution was adjusted according to annealing conditions.</p></li><br />
<li>Incubate at 16°C for 1 hour</li><br />
</ol><br />
<br />
<br />
<h3>Colony PCR</h3><br />
<br />
<p>Colonies were picked with pipet tips and dipped into the PCR mixture.</p><br />
<br />
<table><br />
<thead><br />
<tr><br />
<th>ingredient </th><br />
<th> amount</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td>Overnight Culture </td><br />
<td> Top of a pipet tip 30ng DNA</td><br />
</tr><br />
<tr><br />
<td>10x PCR buffer </td><br />
<td> 2.0μl</td><br />
</tr><br />
<tr><br />
<td>Forward primer (10µM) </td><br />
<td> 0.4μl</td><br />
</tr><br />
<tr><br />
<td>Reverse primer (10µM) </td><br />
<td> 0.4μl</td><br />
</tr><br />
<tr><br />
<td>dNTPs mixture </td><br />
<td> 2.0μl</td><br />
</tr><br />
<tr><br />
<td>Polymerase </td><br />
<td> 0.2μl</td><br />
</tr><br />
<tr><br />
<td>ddH2O </td><br />
<td> Add to 20μl</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<br />
<h3>Storage:</h3><br />
<br />
<table><br />
<thead><br />
<tr><br />
<th>name </th><br />
<th> temperature [°C]</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td>plasmids and engineered bacteria </td><br />
<td> -20</td><br />
</tr><br />
<tr><br />
<td>competent cell </td><br />
<td> -80</td><br />
</tr><br />
<tr><br />
<td>plates with bacteria </td><br />
<td> 4</td><br />
</tr><br />
<tr><br />
<td>other chemicals </td><br />
<td> As the protocol recommends</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<br />
<h2>Schedule</h2><br />
<br />
<ul><br />
<li><p>Week1 making mistakes and improving the project</p></li><br />
<li><p>Week2 making mistakes and improving the project</p></li><br />
<li><p>Week3 making mistakes</p></li><br />
<li><p>Week4 take a break</p></li><br />
<li><p>Week5 gene synthesising</p></li><br />
<li><p>Week6 constructing the device</p></li><br />
<li><p>Week7 constructing the device</p></li><br />
<li><p>Week8 constructing the device</p></li><br />
<li><p>Week9 making mistakes</p></li><br />
<li><p>Week10 making mistakes</p></li><br />
<li><p>Week11 constucting the device</p></li><br />
<li><p>Week12 doing western blot</p></li><br />
<li><p>Week13 doing western blot</p></li><br />
<li><p>Week14 Elisa</p></li><br />
<li><p>Week15 writing wiki</p></li><br />
<li><p>Week16 go to U.S and precentation</p></li><br />
</ul><br />
</div><br />
<script><br />
function entrance () {<br />
}<br />
</script><br />
<br />
<p id="metadata"><br />
{<br />
"title" : "Notebook | SFLS"<br />
}<br />
</p><br />
<!-- PJAX Content End --><br />
</main><br />
</html></div>
AdrianaL