http://2014hs.igem.org/wiki/index.php?title=Team:CIDEB-UANL_Mexico/labwork_results&feed=atom&action=historyTeam:CIDEB-UANL Mexico/labwork results - Revision history2024-03-28T10:17:35ZRevision history for this page on the wikiMediaWiki 1.16.5http://2014hs.igem.org/wiki/index.php?title=Team:CIDEB-UANL_Mexico/labwork_results&diff=27904&oldid=prevPiff at 03:59, 21 June 20142014-06-21T03:59:09Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 03:59, 21 June 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 551:</td>
<td colspan="2" class="diff-lineno">Line 551:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><b>Experiment # 3</b></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><b>Experiment # 3</b></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><center><p><https://2014hs.igem.org/File:Igemcideb2014imagenexperimento3.JPG"/></p></center></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment, the team had the chance to test the effectiveness of the NhaS-producing bacteria. The results of the experiments were measured in the amount of bacteria colonies on the petri dish. In some cases the amount of bacteria were uncountable, because they were spread all over the petri dish, forming a thin film. So it was measured an average size bacteria colony and it was compare with the size of the petri dish. So it was assume that a completely full petri dish has an approximately number of 2500 bacterial colonies. There were 3 different types of bacteria. The ones with NhaS that did not had RFP, the ones with Nhas and RFP, and the bacteria that were used as control (no RFP or NhaS). Each one of these were introduced into a different salt percentage solution. The percentage on which the bacteria were tested are 15%, 10%, 5%, 2.5% 1% of salt on the solution. Also another variable for the experiment was the amount of bacteria concentration within the solution. These concentrations are shown in ratios which are 1:10, 1:100 and 1:1000 of a solution with bacteria on the solution. The experiment were executed twice so it means that there are two results for each type of bacteria on a given concentration on a given salt percentage solution. &nbsp; <br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment, the team had the chance to test the effectiveness of the NhaS-producing bacteria. The results of the experiments were measured in the amount of bacteria colonies on the petri dish. In some cases the amount of bacteria were uncountable, because they were spread all over the petri dish, forming a thin film. So it was measured an average size bacteria colony and it was compare with the size of the petri dish. So it was assume that a completely full petri dish has an approximately number of 2500 bacterial colonies. There were 3 different types of bacteria. The ones with NhaS that did not had RFP, the ones with Nhas and RFP, and the bacteria that were used as control (no RFP or NhaS). Each one of these were introduced into a different salt percentage solution. The percentage on which the bacteria were tested are 15%, 10%, 5%, 2.5% 1% of salt on the solution. Also another variable for the experiment was the amount of bacteria concentration within the solution. These concentrations are shown in ratios which are 1:10, 1:100 and 1:1000 of a solution with bacteria on the solution. The experiment were executed twice so it means that there are two results for each type of bacteria on a given concentration on a given salt percentage solution. &nbsp; <br /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> The bacteria&rsquo;s resistance to salinity was expressed in the amount of colonies grown in a medium with a certain level of salinity due to the certain tolerance to salt given by the NhaS gene. After the experiment, the data obtained was plotted into tables for further processing and analysis.</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> The bacteria&rsquo;s resistance to salinity was expressed in the amount of colonies grown in a medium with a certain level of salinity due to the certain tolerance to salt given by the NhaS gene. After the experiment, the data obtained was plotted into tables for further processing and analysis.</p></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><center><table width=80%></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><tr></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><td></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></td></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><td style="padding-left:px;"><img width=400 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph1.jpg"/></td></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><td style="padding-left:px;"><img width=370 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph2.jpg"/></td></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><td style="padding-left:px;"><img width=370 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph3.jpg"/></td></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></tr></table></center></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><center><table width=80%></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><tr></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><td></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></td></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><td style="padding-left:px;"><img width=400 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph4.jpg"/></td></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><td style="padding-left:px;"><img width=370 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph5.jpg"/></td></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><td style="padding-left:px;"><img width=370 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph6.jpg"/></td></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></tr></table></center></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><center><table width=80%></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><tr></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><td></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></td></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><td style="padding-left:px;"><img width=400 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph7.jpg"/></td></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><td style="padding-left:px;"><img width=370 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph8.jpg"/></td></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><td style="padding-left:px;"><img width=370 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph9.jpg"/></td></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></tr></table></center></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>You can download the raw data from this experiment in <a href="https://static.igem.org/mediawiki/2014hs/9/97/Rawdatacideb2014.xls">here</a>. </div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>You can download the raw data from this experiment in <a href="https://static.igem.org/mediawiki/2014hs/9/97/Rawdatacideb2014.xls">here</a>. </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td></tr>
</table>Piffhttp://2014hs.igem.org/wiki/index.php?title=Team:CIDEB-UANL_Mexico/labwork_results&diff=27706&oldid=prevJlhdza96 at 03:43, 21 June 20142014-06-21T03:43:11Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 03:43, 21 June 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 551:</td>
<td colspan="2" class="diff-lineno">Line 551:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><b>Experiment # 3</b></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><b>Experiment # 3</b></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del style="color: red; font-weight: bold; text-decoration: none;"></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del style="color: red; font-weight: bold; text-decoration: none;"><center><p><img width=90% src="https://2014hs.igem.org/File:Igemcideb2014imagenexperimento3.jpg></p></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del style="color: red; font-weight: bold; text-decoration: none;"><p><b>Image 17.</b> The petri dishes inoculated with NhaS transformed red bacteria, white bacteria and control group </p></center></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del style="color: red; font-weight: bold; text-decoration: none;"></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment, the team had the chance to test the effectiveness of the NhaS-producing bacteria. The results of the experiments were measured in the amount of bacteria colonies on the petri dish. In some cases the amount of bacteria were uncountable, because they were spread all over the petri dish, forming a thin film. So it was measured an average size bacteria colony and it was compare with the size of the petri dish. So it was assume that a completely full petri dish has an approximately number of 2500 bacterial colonies. There were 3 different types of bacteria. The ones with NhaS that did not had RFP, the ones with Nhas and RFP, and the bacteria that were used as control (no RFP or NhaS). Each one of these were introduced into a different salt percentage solution. The percentage on which the bacteria were tested are 15%, 10%, 5%, 2.5% 1% of salt on the solution. Also another variable for the experiment was the amount of bacteria concentration within the solution. These concentrations are shown in ratios which are 1:10, 1:100 and 1:1000 of a solution with bacteria on the solution. The experiment were executed twice so it means that there are two results for each type of bacteria on a given concentration on a given salt percentage solution. &nbsp; <br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment, the team had the chance to test the effectiveness of the NhaS-producing bacteria. The results of the experiments were measured in the amount of bacteria colonies on the petri dish. In some cases the amount of bacteria were uncountable, because they were spread all over the petri dish, forming a thin film. So it was measured an average size bacteria colony and it was compare with the size of the petri dish. So it was assume that a completely full petri dish has an approximately number of 2500 bacterial colonies. There were 3 different types of bacteria. The ones with NhaS that did not had RFP, the ones with Nhas and RFP, and the bacteria that were used as control (no RFP or NhaS). Each one of these were introduced into a different salt percentage solution. The percentage on which the bacteria were tested are 15%, 10%, 5%, 2.5% 1% of salt on the solution. Also another variable for the experiment was the amount of bacteria concentration within the solution. These concentrations are shown in ratios which are 1:10, 1:100 and 1:1000 of a solution with bacteria on the solution. The experiment were executed twice so it means that there are two results for each type of bacteria on a given concentration on a given salt percentage solution. &nbsp; <br /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> The bacteria&rsquo;s resistance to salinity was expressed in the amount of colonies grown in a medium with a certain level of salinity due to the certain tolerance to salt given by the NhaS gene. After the experiment, the data obtained was plotted into tables for further processing and analysis.</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> The bacteria&rsquo;s resistance to salinity was expressed in the amount of colonies grown in a medium with a certain level of salinity due to the certain tolerance to salt given by the NhaS gene. After the experiment, the data obtained was plotted into tables for further processing and analysis.</p></div></td></tr>
</table>Jlhdza96http://2014hs.igem.org/wiki/index.php?title=Team:CIDEB-UANL_Mexico/labwork_results&diff=27616&oldid=prevJlhdza96 at 03:35, 21 June 20142014-06-21T03:35:18Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 03:35, 21 June 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 552:</td>
<td colspan="2" class="diff-lineno">Line 552:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><center><p><img width=90% src="https://2014hs.igem.org/File:Igemcideb2014imagenexperimento3.jpg<del class="diffchange diffchange-inline">"</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><center><p><img width=90% src="https://2014hs.igem.org/File:Igemcideb2014imagenexperimento3.jpg<ins class="diffchange diffchange-inline">></p></ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">align=center hspace=12</del>></p></center></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline"><p><b>Image 17.</b</ins>> <ins class="diffchange diffchange-inline">The petri dishes inoculated with NhaS transformed red bacteria, white bacteria and control group </ins></p></center></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><p>In the <del class="diffchange diffchange-inline">previously made </del>experiment, the team had the chance to test the effectiveness of the NhaS <del class="diffchange diffchange-inline"> </del>producing bacteria. The results of the experiments were measured in the amount of bacteria colonies on the petri dish. In some cases the amount of bacteria were uncountable, because they were spread <del class="diffchange diffchange-inline">throw </del>all the petri dish. So it was <del class="diffchange diffchange-inline"> measure </del>an average size bacteria colony and it was compare with the size of the petri dish. So it was assume that a <del class="diffchange diffchange-inline">petri dish </del>completely full has an <del class="diffchange diffchange-inline"> </del>approximately number of 2500 <del class="diffchange diffchange-inline">bacteria </del>colonies. There were 3 different types of bacteria. The ones with NhaS that <del class="diffchange diffchange-inline">do </del>not had RFP, the ones with Nhas and <del class="diffchange diffchange-inline">that has </del>RFP and the bacteria that were used as control (no RFP or NhaS). Each one of <del class="diffchange diffchange-inline">this </del>were introduced into a different salt percentage solution. The percentage on which the bacteria were tested are 15%, 10%, 5%, 2.5% 1% of salt on the solution. Also another variable for the experiment was the amount of bacteria concentration within the solution. These concentrations are shown in ratios which are 1:10, 1:100 and 1:1000 of a solution with bacteria on the solution. The experiment were executed twice so it means that there are two results for each type of bacteria on a given concentration on a given salt percentage solution. &nbsp; <br /></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><p>In the experiment, the team had the chance to test the effectiveness of the NhaS<ins class="diffchange diffchange-inline">-</ins>producing bacteria. The results of the experiments were measured in the amount of bacteria colonies on the petri dish. In some cases the amount of bacteria were uncountable, because they were spread all <ins class="diffchange diffchange-inline">over </ins>the petri dish<ins class="diffchange diffchange-inline">, forming a thin film</ins>. So it was <ins class="diffchange diffchange-inline">measured </ins>an average size bacteria colony and it was compare with the size of the petri dish. So it was assume that a completely full <ins class="diffchange diffchange-inline"> petri dish </ins>has an approximately number of 2500 <ins class="diffchange diffchange-inline">bacterial </ins>colonies. There were 3 different types of bacteria. The ones with NhaS that <ins class="diffchange diffchange-inline">did </ins>not had RFP, the ones with Nhas and RFP<ins class="diffchange diffchange-inline">, </ins>and the bacteria that were used as control (no RFP or NhaS). Each one of <ins class="diffchange diffchange-inline">these </ins>were introduced into a different salt percentage solution. The percentage on which the bacteria were tested are 15%, 10%, 5%, 2.5% 1% of salt on the solution. Also another variable for the experiment was the amount of bacteria concentration within the solution. These concentrations are shown in ratios which are 1:10, 1:100 and 1:1000 of a solution with bacteria on the solution. The experiment were executed twice so it means that there are two results for each type of bacteria on a given concentration on a given salt percentage solution. &nbsp; <br /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> The bacteria&rsquo;s resistance to salinity was expressed in the amount of colonies grown in a medium with a certain level of salinity due to the certain tolerance to salt given by the NhaS gene. After the experiment, the data obtained was plotted into tables for further processing and analysis.</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> The bacteria&rsquo;s resistance to salinity was expressed in the amount of colonies grown in a medium with a certain level of salinity due to the certain tolerance to salt given by the NhaS gene. After the experiment, the data obtained was plotted into tables for further processing and analysis.</p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>You can download the raw data from this experiment in <a href="https://static.igem.org/mediawiki/2014hs/9/97/Rawdatacideb2014.xls">here</a>. </div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>You can download the raw data from this experiment in <a href="https://static.igem.org/mediawiki/2014hs/9/97/Rawdatacideb2014.xls">here</a>. </div></td></tr>
</table>Jlhdza96http://2014hs.igem.org/wiki/index.php?title=Team:CIDEB-UANL_Mexico/labwork_results&diff=27541&oldid=prevJlhdza96 at 03:28, 21 June 20142014-06-21T03:28:40Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 03:28, 21 June 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 552:</td>
<td colspan="2" class="diff-lineno">Line 552:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><center><p><img width=90% src="https://2014hs.igem.org/File:Igemcideb2014imagenexperimento3.<del class="diffchange diffchange-inline">JPG</del>"</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><center><p><img width=90% src="https://2014hs.igem.org/File:Igemcideb2014imagenexperimento3.<ins class="diffchange diffchange-inline">jpg</ins>"</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>align=center hspace=12></p></center></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>align=center hspace=12></p></center></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
</table>Jlhdza96http://2014hs.igem.org/wiki/index.php?title=Team:CIDEB-UANL_Mexico/labwork_results&diff=27505&oldid=prevJlhdza96 at 03:26, 21 June 20142014-06-21T03:26:14Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 03:26, 21 June 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 553:</td>
<td colspan="2" class="diff-lineno">Line 553:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><center><p><img width=90% src="https://2014hs.igem.org/File:Igemcideb2014imagenexperimento3.JPG"</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><center><p><img width=90% src="https://2014hs.igem.org/File:Igemcideb2014imagenexperimento3.JPG"</div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>align=center hspace=12></p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>align=center hspace=12></p<ins class="diffchange diffchange-inline">></center</ins>></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del style="color: red; font-weight: bold; text-decoration: none;"><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the previously made experiment, the team had the chance to test the effectiveness of the NhaS producing bacteria. The results of the experiments were measured in the amount of bacteria colonies on the petri dish. In some cases the amount of bacteria were uncountable, because they were spread throw all the petri dish. So it was measure an average size bacteria colony and it was compare with the size of the petri dish. So it was assume that a petri dish completely full has an approximately number of 2500 bacteria colonies. There were 3 different types of bacteria. The ones with NhaS that do not had RFP, the ones with Nhas and that has RFP and the bacteria that were used as control (no RFP or NhaS). Each one of this were introduced into a different salt percentage solution. The percentage on which the bacteria were tested are 15%, 10%, 5%, 2.5% 1% of salt on the solution. Also another variable for the experiment was the amount of bacteria concentration within the solution. These concentrations are shown in ratios which are 1:10, 1:100 and 1:1000 of a solution with bacteria on the solution. The experiment were executed twice so it means that there are two results for each type of bacteria on a given concentration on a given salt percentage solution. &nbsp; <br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the previously made experiment, the team had the chance to test the effectiveness of the NhaS producing bacteria. The results of the experiments were measured in the amount of bacteria colonies on the petri dish. In some cases the amount of bacteria were uncountable, because they were spread throw all the petri dish. So it was measure an average size bacteria colony and it was compare with the size of the petri dish. So it was assume that a petri dish completely full has an approximately number of 2500 bacteria colonies. There were 3 different types of bacteria. The ones with NhaS that do not had RFP, the ones with Nhas and that has RFP and the bacteria that were used as control (no RFP or NhaS). Each one of this were introduced into a different salt percentage solution. The percentage on which the bacteria were tested are 15%, 10%, 5%, 2.5% 1% of salt on the solution. Also another variable for the experiment was the amount of bacteria concentration within the solution. These concentrations are shown in ratios which are 1:10, 1:100 and 1:1000 of a solution with bacteria on the solution. The experiment were executed twice so it means that there are two results for each type of bacteria on a given concentration on a given salt percentage solution. &nbsp; <br /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> The bacteria&rsquo;s resistance to salinity was expressed in the amount of colonies grown in a medium with a certain level of salinity due to the certain tolerance to salt given by the NhaS gene. After the experiment, the data obtained was plotted into tables for further processing and analysis.</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> The bacteria&rsquo;s resistance to salinity was expressed in the amount of colonies grown in a medium with a certain level of salinity due to the certain tolerance to salt given by the NhaS gene. After the experiment, the data obtained was plotted into tables for further processing and analysis.</p></div></td></tr>
</table>Jlhdza96http://2014hs.igem.org/wiki/index.php?title=Team:CIDEB-UANL_Mexico/labwork_results&diff=27443&oldid=prevJlhdza96 at 03:21, 21 June 20142014-06-21T03:21:37Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 03:21, 21 June 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 551:</td>
<td colspan="2" class="diff-lineno">Line 551:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><b>Experiment # 3</b></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><b>Experiment # 3</b></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><center><p><img width=90% src="https://2014hs.igem.org/File:Igemcideb2014imagenexperimento3.JPG"</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;">align=center hspace=12></p></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></div></td></tr>
</table>Jlhdza96http://2014hs.igem.org/wiki/index.php?title=Team:CIDEB-UANL_Mexico/labwork_results&diff=27308&oldid=prevJlhdza96 at 03:09, 21 June 20142014-06-21T03:09:52Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 03:09, 21 June 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 551:</td>
<td colspan="2" class="diff-lineno">Line 551:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><b>Experiment # 3</b></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><b>Experiment # 3</b></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><p>In the previously made experiment, the team had the chance to test the effectiveness of the NhaS producing bacteria. The results of the experiments were measured in the amount of bacteria colonies on the petri dish. In some cases the amount of bacteria were uncountable, because they were spread throw all the petri dish. So it was measure an average size bacteria colony and it was compare with the size of the petri dish. So it was assume that a petri dish completely full has an approximately number of 2500 bacteria colonies. There were 3 different types of bacteria. The ones with NhaS that do not had RFP, the ones with Nhas and that has RFP and the bacteria that were used as control (no RFP or NhaS). Each one of this were introduced into a different salt percentage solution. The percentage on which the bacteria were tested are 15%, 10%, 5%, 2.5% 1% of salt on the solution. Also another variable for the experiment was the amount of bacteria concentration within the solution. These concentrations are shown in ratios which are 1:10, 1:100 and 1:1000 of a solution with bacteria on the solution. The experiment were executed twice so it means that there are two results for each type of bacteria on a given concentration on a given salt percentage solution. &nbsp; <br /></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"> The bacteria&rsquo;s resistance to salinity was expressed in the amount of colonies grown in a medium with a certain level of salinity due to the certain tolerance to salt given by the NhaS gene. After the experiment, the data obtained was plotted into tables for further processing and analysis.</p></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>You can download the raw data from this experiment in <a href="https://static.igem.org/mediawiki/2014hs/9/97/Rawdatacideb2014.xls">here</a>. </div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>You can download the raw data from this experiment in <a href="https://static.igem.org/mediawiki/2014hs/9/97/Rawdatacideb2014.xls">here</a>. </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td></tr>
</table>Jlhdza96http://2014hs.igem.org/wiki/index.php?title=Team:CIDEB-UANL_Mexico/labwork_results&diff=27123&oldid=prevDiegoValadez at 02:54, 21 June 20142014-06-21T02:54:51Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 02:54, 21 June 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 551:</td>
<td colspan="2" class="diff-lineno">Line 551:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><b>Experiment # 3</b></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><b>Experiment # 3</b></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><p>You can download the raw data from this experiment in <a href="https://static.igem.org/mediawiki/2014hs/9/97/Rawdatacideb2014.xls">here</a>. </ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><h2><b><a name="AromaRe1"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#AromaExp" target="_blank"> Aroma Qualitative Experiments</a> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><font color="red">[Aroma Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><h2><b><a name="AromaRe1"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#AromaExp" target="_blank"> Aroma Qualitative Experiments</a> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><font color="red">[Aroma Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p></div></td></tr>
</table>DiegoValadezhttp://2014hs.igem.org/wiki/index.php?title=Team:CIDEB-UANL_Mexico/labwork_results&diff=26861&oldid=prevDiegoValadez at 02:30, 21 June 20142014-06-21T02:30:57Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 02:30, 21 June 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 409:</td>
<td colspan="2" class="diff-lineno">Line 409:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>The result of the sequencing of the mini prep of the bacteria transformed with NhaS in pSB1C3 that showed the RFP production was the next (in 3' to 5' direction): </div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>The result of the sequencing of the mini prep of the bacteria transformed with NhaS in pSB1C3 that showed the RFP production was the next (in 3' to 5' direction): </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><pre></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><pre></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>3' <del class="diffchange diffchange-inline">AAAGTGTCCACCCCGTACGACCGAGCGGAGCGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTAATCTTTTCGGC</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>3' <ins class="diffchange diffchange-inline">AAAGTGTCCACCCCGTACGACCGAGCGGAGCGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTAATC</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">TTAAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTATATAAACGCAGAAA</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">TTTTCGGCTTAAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAG</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">GGCCCACCCGAAGGTGAGCCAGTGTGACTCTAGTAGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTT</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">TATATAAACGCAGAAAGGCCCACCCGAAGGTGAGCCAGTGTGACTCTAGTAGAGAGCGTTCACCGACAAACAAC</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">TCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCTCTAGTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTG</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">AGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCTCTAGTAGCGATCTAC</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">GAGTGACGACCTTCAGCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGG</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">ACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACGACCTTCAGCACGTTCGTACTGTTCAACGATGGTG</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">TTTTGTAAGCACCCGGCAGCTGAACCGGTTTTTTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTT</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">TAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTTTT</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">CAGTTTCAGACGCATTTTGATTTCACCTTTCAGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATG</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">AGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCAC</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">GTTTTTTTCTGCATAACCGGACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCA</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">CTTTCAGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACC</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">GGGAGGAGTCCTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGA</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">GGACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTC</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">CAGTTTCAGGTAGTCCGGGATGTCAGCCGGGTGTTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGAACAGGATGT</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">CTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACA</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">CCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTTCAGTTTAGCGGTCTCGGGTACCTTCGAACGGACGACCTTCACCTT</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">GTTTCAGGTAGTCCGGGATGTCAGCCGGGTGTTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGAACA</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">CACCCTTCAATTTTCAAACTCGTGACCGTAAACGGAACCTTTCCATACAACTTTGAAAACGCATGAAACTCATTTGAATAAC</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">GGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTTCAGTTTAGCGGTCTCGGGTACCTTCGAACGG</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">GTCTTCCGGAAGAAAGCCCAATCTAAGTATTTTCTCCCTCTTTTCTCATATAAATGTGATGAATATTTGATCTATCCGCCCT</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">ACGACCTTCACCTTCACCCTTCAATTTTCAAACTCGTGACCGTAAACGGAACCTTTCCATACAACTTTGAAAAC</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">CCAACAACTTTCCCACAACAATCATGTATCGAAATTCCTGTTATACGACACTATAAAGATGGTATAAAAAGCCCGTGGAGGG</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">GCATGAAACTCATTTGAATAACGTCTTCCGGAAGAAAGCCCAATCTAAGTATTTTCTCCCTCTTTTCTCATATA</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">GGCGTGACCA </del>5'</pre></p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">AATGTGATGAATATTTGATCTATCCGCCCTCCAACAACTTTCCCACAACAATCATGTATCGAAATTCCTGTTAT</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">ACGACACTATAAAGATGGTATAAAAAGCCCGTGGAGGGGGCGTGACCA </ins>5'</pre></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>And this is the sequence obtained from the miniPrep of the white (non-RFP) transformed bacteria with NhaS:</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>And this is the sequence obtained from the miniPrep of the white (non-RFP) transformed bacteria with NhaS:</p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><pre></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><pre></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>3' <del class="diffchange diffchange-inline">TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACCTGCATAAC</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>3' <ins class="diffchange diffchange-inline">TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACC</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">GCGAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTAC</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">TGCATAACGCGAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGA</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">TAGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTACCTTCAGCACGTTCGTACTGTTCA</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">CTGCAGCGGCCGCTACTAGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTA</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">ACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTTT</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">CCTTCAGCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGT</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">TAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAG</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">TTTGTAAGCACCCGGCAGCTGAACCGGTTTTTTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCAC</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">AGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGACGGG</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">CGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAA</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">AAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACACCAC</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">GCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTT</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">CGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCCGGGTG</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">GTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAA</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">TTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACT</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">CACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCCGGGTGTTTAACGTAA</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">TTCAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTTAACGGAA</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">GCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTT</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">CCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTCGCTTACAAATACCG</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">CAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTTA</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">TTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTTTGCCATGCAGATTCCGATGATT</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">ACGGAACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTC</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">CGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGTAA </del>5'</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">GCTTACAAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTT</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">TGCCATGCAGATTCCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGT</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">AA </ins>5'</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></pre></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></pre></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 446:</td>
<td colspan="2" class="diff-lineno">Line 449:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>To characterize the aroma module, the process of sequencing was made too</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>To characterize the aroma module, the process of sequencing was made too</p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><pre></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><pre></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>3' <del class="diffchange diffchange-inline">TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACCTGCATAAC</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>3' <ins class="diffchange diffchange-inline">TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACC</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">GCGAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTAC</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">TGCATAACGCGAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGA</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">TAGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTACCTTCAGCACGTTCGTACTGTTCA</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">CTGCAGCGGCCGCTACTAGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTA</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">ACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTTT</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">CCTTCAGCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGT</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">TAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAG</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">TTTGTAAGCACCCGGCAGCTGAACCGGTTTTTTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCAC</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">AGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGACGGG</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">CGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAA</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">AAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACACCAC</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">GCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTT</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">CGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCCGGGTG</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">GTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAA</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">TTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACT</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">CACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCCGGGTGTTTAACGTAA</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">TTCAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTTAACGGAA</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">GCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTT</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">CCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTCGCTTACAAATACCG</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">CAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTTA</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">TTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTTTGCCATGCAGATTCCGATGATT</del></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">ACGGAACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTC</ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">CGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGTAA </del>5'</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">GCTTACAAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTT</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">TGCCATGCAGATTCCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGT</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">AA </ins>5'</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></pre><p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></pre><p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td></tr>
</table>DiegoValadezhttp://2014hs.igem.org/wiki/index.php?title=Team:CIDEB-UANL_Mexico/labwork_results&diff=26763&oldid=prevJlhdza96 at 02:22, 21 June 20142014-06-21T02:22:47Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 02:22, 21 June 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 2:</td>
<td colspan="2" class="diff-lineno">Line 2:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>{{:Team:CIDEB-UANL_Mexico/menu_labwork}}</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>{{:Team:CIDEB-UANL_Mexico/menu_labwork}}</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><html xmlns="http://www.w3.org/1999/xhtml"></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><html xmlns="http://www.w3.org/1999/xhtml"></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><head></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1" /></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><title>Untitled Document</title></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><head></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><head></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><meta http-equiv="Content-Type" content="text/html; charset=utf-8" /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><meta http-equiv="Content-Type" content="text/html; charset=utf-8" /></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 352:</td>
<td colspan="2" class="diff-lineno">Line 355:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><h2><b><a name="Minipreps"></a>Minipreps</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><h2><b><a name="Minipreps"></a>Minipreps</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><p>The first step <del class="diffchange diffchange-inline">to build up </del>the four modules in bio-brick format with the vector pSB1C3 is to isolate the plasmid DNA from the bacteria through a mini prep.</p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><p>The first step <ins class="diffchange diffchange-inline">for building </ins>the four modules in <ins class="diffchange diffchange-inline">a </ins>bio-brick format<ins class="diffchange diffchange-inline">, </ins>with the vector pSB1C3 is to isolate the plasmid DNA from the bacteria through a mini prep.</p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>The next electrophoresis geles (<b>Image 1</b>) shows that the extraction of the DNA was performed correctly.</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>The next electrophoresis geles (<b>Image 1</b>) shows that the extraction of the DNA was performed correctly.</div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">As in </del>the beginning it was planned to put the four modules in vectors with different antibiotic resistance (such as pSB1C3, pSB1T3, pSB1A3 and pSB1K3) in a single <i>E. <del class="diffchange diffchange-inline">col</del></i>, but the team decided to first insert all of the genes in pSB1C3 so they could be sent to the parts registry.</p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">At </ins>the beginning<ins class="diffchange diffchange-inline">, </ins>it was planned to put the four modules in vectors with different antibiotic resistance (such as pSB1C3, pSB1T3, pSB1A3 and pSB1K3) in a single <i>E. <ins class="diffchange diffchange-inline">coli</ins></i>, but the team decided to first<ins class="diffchange diffchange-inline">, </ins>insert all of the genes in pSB1C3 so they could be sent to the parts registry.</p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><center><p><img width=90% src="https://static.igem.org/mediawiki/2014hs/2/2e/Geles_miniprep_of_all_genes_cideps.jpg" align=center hspace=12></p></center></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><center><p><img width=90% src="https://static.igem.org/mediawiki/2014hs/2/2e/Geles_miniprep_of_all_genes_cideps.jpg" align=center hspace=12></p></center></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><center><p><font size="3"><b>Image 1.</b> Electrophoresis geles showing the plasmid DNA gotten from mini preps of bacteria transformed with pUC57-NhaS, pUC57-BSMT1 opt., pUC57-AIDA, pUC57-L2, pSB1C3-RFP, pSB1K3-RFP and pSB1A3-RFP.</font></p></center></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><center></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline"> </ins><p><font size="3"><b>Image 1.</b> Electrophoresis geles showing the plasmid DNA gotten from mini preps of <ins class="diffchange diffchange-inline">the </ins>bacteria transformed with pUC57-NhaS, pUC57-BSMT1 opt., pUC57-AIDA, pUC57-L2, pSB1C3-RFP, pSB1K3-RFP and pSB1A3-RFP.</font></p></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div></center></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 369:</td>
<td colspan="2" class="diff-lineno">Line 374:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><h2><b><a name="Purifications"></a>Purification</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><h2><b><a name="Purifications"></a>Purification</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p> There is not need of make all the purification process of the fragments gotten in the digestion, easily the ligation can be done. But to make sure that only the pieces that were wanted to ligate, were together, it was done a purification. Then to confirm that there were only the fragments such as pSB1C3, BSTM1 opt. L2 and AIDA, it was made an electrophoresis gel:</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p> There is not need of make all the purification process of the fragments gotten in the digestion, easily the ligation can be done. But to make sure that only the pieces that were wanted to ligate, were together, it was done a purification. Then to confirm that there were only the fragments such as pSB1C3, BSTM1 opt. L2 and AIDA, it was made an electrophoresis gel:</p></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><center><p><img width=50% src="https://static.igem.org/mediawiki/2014hs/8/82/Purification_of_all_genes_less_NhaS.jpg"align=center hspace=12></<del class="diffchange diffchange-inline">center</del>></<del class="diffchange diffchange-inline">p</del>></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><center><p><img width=50% src="https://static.igem.org/mediawiki/2014hs/8/82/Purification_of_all_genes_less_NhaS.jpg"align=center hspace=12></<ins class="diffchange diffchange-inline">p</ins>></<ins class="diffchange diffchange-inline">center</ins>></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><center><p><b>Image 3.</b> Electrophoresis geles of digestion after purification process after. The "M" before the first well of the gel, stands for Mark</p></center></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><center><p><b>Image 3.</b> Electrophoresis geles of digestion after purification process after. The "M" before the first well of the gel, stands for Mark</p></center></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 388:</td>
<td colspan="2" class="diff-lineno">Line 393:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>The main gene of the aroma module, BSMT1 opt. was ligated with pSB1C3, and then transformed in bacteria in order to be inoculated. In the resulting inoculation there were only white colonies of bacteria.</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>The main gene of the aroma module, BSMT1 opt. was ligated with pSB1C3, and then transformed in bacteria in order to be inoculated. In the resulting inoculation there were only white colonies of bacteria.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><center><p><img width=50% src="https://static.igem.org/mediawiki/2014hs/7/7c/Aroma_%2B_pSB1C3.jpg"</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><center><p><img width=50% src="https://static.igem.org/mediawiki/2014hs/7/7c/Aroma_%2B_pSB1C3.jpg"</div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>align=center hspace=12></<del class="diffchange diffchange-inline">center</del>></<del class="diffchange diffchange-inline">p</del>></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>align=center hspace=12></<ins class="diffchange diffchange-inline">p</ins>></<ins class="diffchange diffchange-inline">center</ins>></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><center><p><font size="3"><b>Image 6.</b>Colonies obtained from the transformation of the ligation BSMT1 opt and pSB1C3. </font></p></center></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><center><p><font size="3"><b>Image 6.</b>Colonies obtained from the transformation of the ligation BSMT1 opt and pSB1C3. </font></p></center></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><h2><b><a name="Characterization"></a>Characterization</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><h2><b><a name="Characterization"></a>Characterization</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><b>Capture module characterization</b></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><b>Capture module characterization</b></p></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><p>Once NhaS was in pSB1C3, it was needed to prove it through a characterization<del class="diffchange diffchange-inline">, </del>also there was the question of why in the ligation <del class="diffchange diffchange-inline">there were </del>red and white bacteria, if all had the plasmid to chloramphenicol resistance (reason they lived). Which of the two types really had NhaS?. To know with which enzyme make the digestion, it was made a digital digestion of the plasmid and the insert getting the next result:</p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><p>Once NhaS was in <ins class="diffchange diffchange-inline">the </ins>pSB1C3 <ins class="diffchange diffchange-inline">plasmid</ins>, it was needed to prove it<ins class="diffchange diffchange-inline">, </ins>through a characterization<ins class="diffchange diffchange-inline">; </ins>also there was the question of why <ins class="diffchange diffchange-inline">were there </ins>in the ligation <ins class="diffchange diffchange-inline"> </ins>red and white bacteria, if all had the plasmid to chloramphenicol resistance (reason they lived). Which of the two types really had NhaS?. To know with which enzyme make the digestion, it was made a digital digestion of the plasmid and the insert getting the next result:</p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><center><p><img width=80% src="https://static.igem.org/mediawiki/2014hs/a/a2/Virtual_digestion_of_NhaS_in_pSB1C3.jpg"</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><center><p><img width=80% src="https://static.igem.org/mediawiki/2014hs/a/a2/Virtual_digestion_of_NhaS_in_pSB1C3.jpg"</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>align=center hspace=12></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>align=center hspace=12></p></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><p><b>Image 7.</b> Virtual digestion of NhaS (yellow) +RFP (red) +pSB1C3 (purple) by the enzyme Arsl (blue), showing that its restriction site is repeated two times, one in NhaS and other in pSB1C3. </<del class="diffchange diffchange-inline">center</del>></<del class="diffchange diffchange-inline">p</del>></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><p><b>Image 7.</b> Virtual digestion of NhaS (yellow) +RFP (red) +pSB1C3 (purple) by the enzyme Arsl (blue), showing that its restriction site is repeated two times, one in NhaS and other in pSB1C3. </<ins class="diffchange diffchange-inline">p</ins>></<ins class="diffchange diffchange-inline">center</ins>></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>The problem was that the enzyme that cuts NhaS and pSB1C3 was not available to the team, and it would take a long time to get it. To solve this problem, it was sent the DNA to be sequenced and then prove that the ligation actually occurred, and NhaS was inside pSB1C3. It was used a primer that is from 5' to 3' in the complementary chain:</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>The problem was that the enzyme that cuts NhaS and pSB1C3 was not available to the team, and it would take a long time to get it. To solve this problem, it was sent the DNA to be sequenced and then prove that the ligation actually occurred, and NhaS was inside pSB1C3. It was used a primer that is from 5' to 3' in the complementary chain:</p></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 421:</td>
<td colspan="2" class="diff-lineno">Line 426:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><p>And this is the sequence obtained from the miniPrep of the white <del class="diffchange diffchange-inline">bacteria </del>transformed with NhaS:</p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><p>And this is the sequence obtained from the miniPrep of the white <ins class="diffchange diffchange-inline">(non-RFP) </ins>transformed <ins class="diffchange diffchange-inline">bacteria </ins>with NhaS:</p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><pre></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><pre></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>3' TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACCTGCATAAC</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>3' TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACCTGCATAAC</div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 518:</td>
<td colspan="2" class="diff-lineno">Line 523:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><p>The first time the experiment <del class="diffchange diffchange-inline">one </del>was performed, <del class="diffchange diffchange-inline">bacteria </del>transformed with the capture plasmid were inoculated in Petri dishes with different concentrations of salt, but this time the mayor concentration is higher (15%) </p><p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><p>The first time the experiment <ins class="diffchange diffchange-inline">#1 </ins>was performed, transformed <ins class="diffchange diffchange-inline">bacteria </ins>with the capture plasmid were inoculated in Petri dishes with different concentrations of salt, but this time the mayor concentration is higher (15%) </p></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>All the <del class="diffchange diffchange-inline">bacteria </del>transformed with NhaS in pSB1C3 (Red and White) lived in the 15% saline medium. </p><p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><p></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>All <ins class="diffchange diffchange-inline">of </ins>the transformed <ins class="diffchange diffchange-inline">bacteria </ins>with NhaS in pSB1C3 (Red and White) lived in the 15% saline medium. </p></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>All the control bacteria exposed to any concentration of salt died.</p><p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>All the control bacteria exposed to any concentration of salt died.</p><p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>All the control bacteria inoculated only in LB medium (without salt) lived. </div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>All the control bacteria inoculated only in LB medium (without salt) lived. </div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 531:</td>
<td colspan="2" class="diff-lineno">Line 538:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><b><a name="Salt2"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Viability" target="_blank">Experiment #2</a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><b><a name="Salt2"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Viability" target="_blank">Experiment #2</a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><p>In the experiment #1, it was <del class="diffchange diffchange-inline">proved that </del>the NhaS transformed bacteria (red and white) survived to a saline environment with LB agar. Then it order to know if it would survive only in a saline medium, it was designed a second experiment where the bacteria was inoculated in erlenmeyer flasks with only salty water at different concentrations (1%, 2.5% 5%, 10% and 15%). None of all the inoculated erlenmeyer flasks was murky, it means that all of the bacteria was dead.</p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><p>In the experiment #1, it was <ins class="diffchange diffchange-inline">tested the hypothesis in which </ins>the NhaS transformed bacteria (red and white) survived to a saline environment with LB agar. Then it order to know if it would survive only in a saline medium, it was designed a second experiment where the bacteria was inoculated in erlenmeyer flasks with only salty water at different concentrations (1%, 2.5% 5%, 10% and 15%). None of all the inoculated erlenmeyer flasks was murky, it means that all of the bacteria was dead.</p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><center><p><img width=90% src="https://static.igem.org/mediawiki/2014hs/0/0d/Experiment_3_all_flasks.jpg"</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><center><p><img width=90% src="https://static.igem.org/mediawiki/2014hs/0/0d/Experiment_3_all_flasks.jpg"</div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 537:</td>
<td colspan="2" class="diff-lineno">Line 544:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><b>Image 16.</b> Erlenmeyer flasks inoculated with NhaS transformed red bacteria of all concentrations. From left to right: 15%, 10%, 5%, 2.3% and 1%.</p></center></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><b>Image 16.</b> Erlenmeyer flasks inoculated with NhaS transformed red bacteria of all concentrations. From left to right: 15%, 10%, 5%, 2.3% and 1%.</p></center></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><p<del class="diffchange diffchange-inline">><name="Salt3"></a</del>><b>Experiment # 3</b></p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><p><b>Experiment # 3</b></p></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><p><del class="diffchange diffchange-inline">AQUI JORGE :D </del></p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><p><ins class="diffchange diffchange-inline">In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </ins></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><h2><b><a name="AromaRe1"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#AromaExp" target="_blank"> Aroma Qualitative Experiments</a> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><font color="red">[Aroma Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><h2><b><a name="AromaRe1"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#AromaExp" target="_blank"> Aroma Qualitative Experiments</a> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><font color="red">[Aroma Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><p<del class="diffchange diffchange-inline">><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Aroma_test_tubes" target="_blank"</del>><b>Test tubes <del class="diffchange diffchange-inline">aroma experiment</del></b<del class="diffchange diffchange-inline">></a</del>> </p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><p><b><ins class="diffchange diffchange-inline">Experiment 1 - </ins>Test tubes</b></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p> AQUI S; </p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p> AQUI S; </p></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del style="color: red; font-weight: bold; text-decoration: none;"><br></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><p<del class="diffchange diffchange-inline">><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Aroma_petri_dishes" target="_blank"</del>><b>Petri dishes <del class="diffchange diffchange-inline">aroma experiment</del></b<del class="diffchange diffchange-inline">></a> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2</del>></p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><p><b><ins class="diffchange diffchange-inline">Experiment 2 - </ins>Petri dishes</b></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>Random people were chosen to smell our bacteria, four people per each concentration. The experiment was performed with three different concentrations of salicylic acid, which were of 10 mM, 20 mM, and 30 mM. All of the samples contained salicylic acid. There was a controlled group grown bellow and above the 32 ºC and a group with transformed bacteria with the Aroma module, also grown bellow and above the 32 ºC; per each concentration. </p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>Random people were chosen to smell our bacteria, four people per each concentration. The experiment was performed with three different concentrations of salicylic acid, which were of 10 mM, 20 mM, and 30 mM. All of the samples contained salicylic acid. There was a controlled group grown bellow and above the 32 ºC and a group with transformed bacteria with the Aroma module, also grown bellow and above the 32 ºC; per each concentration. </p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>Those are the words that people used to repeat, or synonyms of what the said, because all the opinions were described in a different way. </p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>Those are the words that people used to repeat, or synonyms of what the said, because all the opinions were described in a different way. </p></div></td></tr>
</table>Jlhdza96