http://2014hs.igem.org/wiki/index.php?title=Special:Contributions/Piff&feed=atom&limit=50&target=Piff&year=&month=2014hs.igem.org - User contributions [en]2024-03-29T14:46:30ZFrom 2014hs.igem.orgMediaWiki 1.16.5http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_resultsTeam:CIDEB-UANL Mexico/labwork results2014-06-21T03:59:09Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_labwork}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1" /><br />
<title>Untitled Document</title><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Results</h2><br />
<br />
<div class="wrapper"><br />
<center><div class="container2"><br />
<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Construction" class="button2">Biobricks construction</a><br />
<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Experiments" class="button2">Experiments</a><br />
</div></center><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<br />
<p><h2><font size="6"><b><a name="Construction"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Construction" target="_blank">Biobricks construction</a></b></font>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>Here are the results of how the team got the modules of the project</p><br />
<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Minipreps" class="button2">Minipreps</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Digestions" class="button2">Digestions</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Purifications" class="button2">Purification</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Ligations" class="button2">Ligations</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Characterization" class="button2">Characterization</a></p><br />
<br />
<p><h2><b><a name="Minipreps"></a>Minipreps</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>The first step for building the four modules in a bio-brick format, with the vector pSB1C3 is to isolate the plasmid DNA from the bacteria through a mini prep.</p><br />
<p>The next electrophoresis geles (<b>Image 1</b>) shows that the extraction of the DNA was performed correctly.<br />
At the beginning, it was planned to put the four modules in vectors with different antibiotic resistance (such as pSB1C3, pSB1T3, pSB1A3 and pSB1K3) in a single <i>E. coli</i>, but the team decided to first, insert all of the genes in pSB1C3 so they could be sent to the parts registry.</p><br />
<center><p><img width=90% src="https://static.igem.org/mediawiki/2014hs/2/2e/Geles_miniprep_of_all_genes_cideps.jpg" align=center hspace=12></p></center><br />
<center><br />
<p><font size="3"><b>Image 1.</b> Electrophoresis geles showing the plasmid DNA gotten from mini preps of the bacteria transformed with pUC57-NhaS, pUC57-BSMT1 opt., pUC57-AIDA, pUC57-L2, pSB1C3-RFP, pSB1K3-RFP and pSB1A3-RFP.</font></p><br />
</center><br />
<br><br />
<br />
<p><b><h2><a name=Digestions></a>Digestions</b>-<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>The next step of obtaining the DNA is get only the needed fragment for the project, this would be accomplished through a digestion with the enzymes of the biobrick format: EcoRI and PstI (In the case of pSB1C3, nhaS and BSMT1 opt.). But in the case of the union module, there is a fusion protein, it means that the digestion of AIDA and L2 (parts of the fusion protein) is with other enzymes, the first with PstI and BglII, and the second with EcoRI and BamHI.</p><br />
<p>In the digestion made in order to get the plasmid pSB1C3 and the gene NhaS (<b>Image 2.</b> right gel) both were differentiated from their respective insert (RFP) and plasmid (pUC57) by its length. The plasmid stays in the upper part of the gel while the insert stays below it.</p><br />
<p>The same happened with the digestion of BSMT1 opt., AIDA and L2 (<b>Image 2.</b> left gel) the genes were differentiated by its length.</p><br />
<center><p><img width=80% src="https://static.igem.org/mediawiki/2014hs/a/ad/Important_Digestions_CIDEB_.jpg" align=center hspace=12></p><br />
<p><font size="3"><b>Image 2.</b>In the left gel: Gel of digestion of pSB1C3 (left black square) and NhaS (right black square). In the right gel: Gel of digestion of pSB1C3 (upper left square), AIDA, L2 and BMST1 opt. (In that order, the tree black squares of the right).</font></p></center><br />
<br><br />
<br />
<p><h2><b><a name="Purifications"></a>Purification</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p> There is not need of make all the purification process of the fragments gotten in the digestion, easily the ligation can be done. But to make sure that only the pieces that were wanted to ligate, were together, it was done a purification. Then to confirm that there were only the fragments such as pSB1C3, BSTM1 opt. L2 and AIDA, it was made an electrophoresis gel:</p><br />
<center><p><img width=50% src="https://static.igem.org/mediawiki/2014hs/8/82/Purification_of_all_genes_less_NhaS.jpg"align=center hspace=12></p></center><br />
<center><p><b>Image 3.</b> Electrophoresis geles of digestion after purification process after. The "M" before the first well of the gel, stands for Mark</p></center><br />
<br><br />
<br />
<p><h2><b><a name="Ligations"></a>Ligations</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>After the purification of the digestions was made, the fragments were ligated with their respective gene-plasmid. Then bacteria were transformed with those ligations and inoculated in a Petri dish obtaining the next result:</p><br />
<p><b><a name="Ligation"></a>Ligation of NhaS and pSB1C3 <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank"><font color="red">[Capture Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></p><br />
<p>In the first transformation of the ligation of NhaS and pSB1C3 grew red (expressing RFP) and white bacteria. The Petri dish was not cover by aluminum after its inoculation. </p><br />
<center><p><img width=80% src="https://static.igem.org/mediawiki/2014hs/4/43/Ligation1cideb2014.png"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 4. </b>NhaS first ligation with pSB1C3. Result of the transformation of the ligation between NhaS and pSB1C3.</font></p></center><br />
<p>There was a second transformation of the same ligation, also it was inoculated in a Petri dish getting <b>Image 5.</b> as result. There were also present red and white bacteria. The Petri dish was not cover by aluminum after its inoculation.</p><br />
<center><p><img width=80% src="https://static.igem.org/mediawiki/2014hs/4/4b/NhaS_%2B_pSB1C3_Ligation_.jpg"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 5.</b>NhaS first ligation with pSB1C3. Result of the transformation of the ligation between NhaS and pSB1C3. </font></p></center><br />
<br><br />
<p><b><a name="Ligation2"></a>Result of ligation BSMT1 (optimized) and pSB1C3 <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><font color="red">[Aroma Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></p><br />
<p>The main gene of the aroma module, BSMT1 opt. was ligated with pSB1C3, and then transformed in bacteria in order to be inoculated. In the resulting inoculation there were only white colonies of bacteria.<br />
<center><p><img width=50% src="https://static.igem.org/mediawiki/2014hs/7/7c/Aroma_%2B_pSB1C3.jpg"<br />
align=center hspace=12></p></center><br />
<center><p><font size="3"><b>Image 6.</b>Colonies obtained from the transformation of the ligation BSMT1 opt and pSB1C3. </font></p></center><br />
<br><br />
<p><h2><b><a name="Characterization"></a>Characterization</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p><b>Capture module characterization</b></p><br />
<p>Once NhaS was in the pSB1C3 plasmid, it was needed to prove it, through a characterization; also there was the question of why were there in the ligation red and white bacteria, if all had the plasmid to chloramphenicol resistance (reason they lived). Which of the two types really had NhaS?. To know with which enzyme make the digestion, it was made a digital digestion of the plasmid and the insert getting the next result:</p><br />
<center><p><img width=80% src="https://static.igem.org/mediawiki/2014hs/a/a2/Virtual_digestion_of_NhaS_in_pSB1C3.jpg"<br />
align=center hspace=12></p><br />
<p><b>Image 7.</b> Virtual digestion of NhaS (yellow) +RFP (red) +pSB1C3 (purple) by the enzyme Arsl (blue), showing that its restriction site is repeated two times, one in NhaS and other in pSB1C3. </p></center><br />
<br><br />
<p>The problem was that the enzyme that cuts NhaS and pSB1C3 was not available to the team, and it would take a long time to get it. To solve this problem, it was sent the DNA to be sequenced and then prove that the ligation actually occurred, and NhaS was inside pSB1C3. It was used a primer that is from 5' to 3' in the complementary chain:</p><br />
<p><pre><br />
5´ATTACCGCCTTTGAGTGAGC 3'<br />
</p></pre><br />
The result of the sequencing of the mini prep of the bacteria transformed with NhaS in pSB1C3 that showed the RFP production was the next (in 3' to 5' direction): <br />
<p><pre><br />
3' AAAGTGTCCACCCCGTACGACCGAGCGGAGCGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTAATC<br />
TTTTCGGCTTAAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAG<br />
TATATAAACGCAGAAAGGCCCACCCGAAGGTGAGCCAGTGTGACTCTAGTAGAGAGCGTTCACCGACAAACAAC<br />
AGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCTCTAGTAGCGATCTAC<br />
ACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACGACCTTCAGCACGTTCGTACTGTTCAACGATGGTG<br />
TAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTTTT<br />
AGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCAC<br />
CTTTCAGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACC<br />
GGACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTC<br />
CTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACA<br />
GTTTCAGGTAGTCCGGGATGTCAGCCGGGTGTTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGAACA<br />
GGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTTCAGTTTAGCGGTCTCGGGTACCTTCGAACGG<br />
ACGACCTTCACCTTCACCCTTCAATTTTCAAACTCGTGACCGTAAACGGAACCTTTCCATACAACTTTGAAAAC<br />
GCATGAAACTCATTTGAATAACGTCTTCCGGAAGAAAGCCCAATCTAAGTATTTTCTCCCTCTTTTCTCATATA<br />
AATGTGATGAATATTTGATCTATCCGCCCTCCAACAACTTTCCCACAACAATCATGTATCGAAATTCCTGTTAT<br />
ACGACACTATAAAGATGGTATAAAAAGCCCGTGGAGGGGGCGTGACCA 5'</pre></p><br />
<br />
<br><br />
<p>And this is the sequence obtained from the miniPrep of the white (non-RFP) transformed bacteria with NhaS:</p><br />
<p><pre><br />
3' TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACC<br />
TGCATAACGCGAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGA<br />
CTGCAGCGGCCGCTACTAGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTA<br />
CCTTCAGCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGT<br />
TTTGTAAGCACCCGGCAGCTGAACCGGTTTTTTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCAC<br />
CGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAA<br />
GCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTT<br />
GTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAA<br />
CACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCCGGGTGTTTAACGTAA<br />
GCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTT<br />
CAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTTA<br />
ACGGAACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTC<br />
GCTTACAAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTT<br />
TGCCATGCAGATTCCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGT<br />
AA 5'<br />
</pre></p><br />
<br><br />
<p><b>Aroma module characterization</b></p><br />
<p>To characterize the aroma module, the process of sequencing was made too</p><br />
<p><pre><br />
3' TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACC<br />
TGCATAACGCGAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGA<br />
CTGCAGCGGCCGCTACTAGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTA<br />
CCTTCAGCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGT<br />
TTTGTAAGCACCCGGCAGCTGAACCGGTTTTTTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCAC<br />
CGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAA<br />
GCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTT<br />
GTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAA<br />
CACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCCGGGTGTTTAACGTAA<br />
GCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTT<br />
CAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTTA<br />
ACGGAACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTC<br />
GCTTACAAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTT<br />
TGCCATGCAGATTCCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGT<br />
AA 5'<br />
</pre><p><br />
<br><br />
<p><h2><font size="6"><b><a name="Experiments"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Experiments" target="_blank">Experiments</a></b></font>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>It is needed to characterize and prove the modules, here are the results of the experiments made in order to accomplish it.</p><br />
<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#UV" class="button2">Capture</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#AromaRe1" class="button2">Aroma</a></p><br />
<br />
<p><h2><b><a name="UV"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#UVExp" target="_blank">UV Experimentation </a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p>During 2 hours the four Petri dishes were exposed to UV irradiation. None of them showed any change. </p><br />
<br />
<center><p><img width=90% src="https://static.igem.org/mediawiki/2014hs/7/75/First_UV_irradiation_Experiment.jpg"<br />
align=center hspace=12></p><br />
<p><font size="2"><b>Image 8.</b>Petri Dish inoculated with NhaS in pSB1C3 exposed to UV irradiation at 302 nm. Before, no time being exposed (left) and after 2 hours of being exposed (right). </font></p></center><br />
<br />
<br />
<p><b><a name="RepetitionUV"></a>Repetition UV Experimentation </b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></p><br />
<br />
<p>Two Petri dishes inoculated by streak: One with NhaS Red and the other with NhaS White. Both exposed during 30 minutes to UV irradiation at 302 nm and none of them showed any change. </p><br />
<p>With no time exposed to UV irradiation: <br />
</p><br />
<br />
<center><p><img width=90% src="https://static.igem.org/mediawiki/2014hs/1/18/Before_NhaS_Video.jpg"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 9.</b>Nhas in pSB1C3 before being exposed to UV irradiation. </font></p></center><br />
<br />
<p>After 30 minutes: <br />
</p><br />
<br />
<center><p><img width=90% src="https://static.igem.org/mediawiki/2014hs/a/a6/After_NhaS_Video_.jpg"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 10.</b>Nhas in pSB1C3 before being exposed to UV irradiation. </font></p></center><br />
<br />
<br />
<br />
<p><h2><b><a name="Salt1"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Viability" target="_blank">Viability test of the NhaS gene containing bacteria in salt</a> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank"><font color="red">[Capture Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p><b> Experiment #1</b></p><br />
<br />
<p>Bacteria transformed with the capture plasmid were inoculated in Petri dishes with different concentrations of salt</p><br />
<br />
<center><p><img width=90% src="https://static.igem.org/mediawiki/2014hs/e/e2/Rojas_NhaS_experiment_1.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="3"><b>Image 11. </b>All the 18 Petri dishes inoculated with NhaS Red in pSB1C3 of all the 9 used concentrations.</font></p></center><br />
<br><br />
<br />
<center><p><img width=90% src="https://static.igem.org/mediawiki/2014hs/2/28/Blancas_NhaS_experimen_1.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="3"><b>Image 12. </b>All the 18 Petri dishes inoculated with NhaS White in pSB1C3 of all the 9 used concentrations.</font></p></center><br />
<br><br />
<br />
<center><p><img width=90% src="https://static.igem.org/mediawiki/2014hs/1/12/Control_Expriment_1_NhaS_.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="3"><b>Image 13. </b>All the 18 Petri dishes inoculated with the Control bacteria of all the 9 used concentrations.</font></p></center><br />
<p>All the bacteria containing the NhaS in pSB1C3 (Red and White) survived to a 10% concentration of salt.</p> <br />
<p>None of the control group lived in any concentration of salt.</p><br />
<br><br />
<br />
<center><p><img width=90% src="https://static.igem.org/mediawiki/2014hs/2/28/Experiment_1_Maximum_concentration_of_salt..jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="3"><b>Image 14. </b>Nine Petri dishes with the maximum concentration of salt (10%) used in this experiment. From up to bottom: NhaS Red in pSB1C3, NhaS White in pSB1C3 and the Control bacteria.</font></p></center> <br />
<br><br />
<br />
<p>The first time the experiment #1 was performed, transformed bacteria with the capture plasmid were inoculated in Petri dishes with different concentrations of salt, but this time the mayor concentration is higher (15%) </p><br />
<p><br />
All of the transformed bacteria with NhaS in pSB1C3 (Red and White) lived in the 15% saline medium. </p><br />
<p><br />
All the control bacteria exposed to any concentration of salt died.</p><p><br />
All the control bacteria inoculated only in LB medium (without salt) lived. <br />
</p><br />
<br />
<center><p><img width=90% src="https://static.igem.org/mediawiki/2014hs/7/75/Max_concentration_od_salt_experiment_2_.jpg"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 15. </b>In the upper left part NhaS Red in pSB1C3 at 15% of salt. In the upper right part NhaS Whit in pSB1C3 at 15% of salt. In the lower left part the Control bacteria at 15% of salt. In the lower right part the Control bacteria with only LB medium (without salt) </font></p></center> <br />
<br><br />
<br />
<p><b><a name="Salt2"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Viability" target="_blank">Experiment #2</a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p>In the experiment #1, it was tested the hypothesis in which the NhaS transformed bacteria (red and white) survived to a saline environment with LB agar. Then it order to know if it would survive only in a saline medium, it was designed a second experiment where the bacteria was inoculated in erlenmeyer flasks with only salty water at different concentrations (1%, 2.5% 5%, 10% and 15%). None of all the inoculated erlenmeyer flasks was murky, it means that all of the bacteria was dead.</p><br />
<br><br />
<center><p><img width=90% src="https://static.igem.org/mediawiki/2014hs/0/0d/Experiment_3_all_flasks.jpg"<br />
align=center hspace=12></p><br />
<p><b>Image 16.</b> Erlenmeyer flasks inoculated with NhaS transformed red bacteria of all concentrations. From left to right: 15%, 10%, 5%, 2.3% and 1%.</p></center><br />
<br><br />
<p><b>Experiment # 3</b></p><br />
<p>In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed. </p><br />
<br />
<center><p><https://2014hs.igem.org/File:Igemcideb2014imagenexperimento3.JPG"/></p></center><br />
<br />
<p>In the experiment, the team had the chance to test the effectiveness of the NhaS-producing bacteria. The results of the experiments were measured in the amount of bacteria colonies on the petri dish. In some cases the amount of bacteria were uncountable, because they were spread all over the petri dish, forming a thin film. So it was measured an average size bacteria colony and it was compare with the size of the petri dish. So it was assume that a completely full petri dish has an approximately number of 2500 bacterial colonies. There were 3 different types of bacteria. The ones with NhaS that did not had RFP, the ones with Nhas and RFP, and the bacteria that were used as control (no RFP or NhaS). Each one of these were introduced into a different salt percentage solution. The percentage on which the bacteria were tested are 15%, 10%, 5%, 2.5% 1% of salt on the solution. Also another variable for the experiment was the amount of bacteria concentration within the solution. These concentrations are shown in ratios which are 1:10, 1:100 and 1:1000 of a solution with bacteria on the solution. The experiment were executed twice so it means that there are two results for each type of bacteria on a given concentration on a given salt percentage solution. &nbsp; <br /><br />
The bacteria&rsquo;s resistance to salinity was expressed in the amount of colonies grown in a medium with a certain level of salinity due to the certain tolerance to salt given by the NhaS gene. After the experiment, the data obtained was plotted into tables for further processing and analysis.</p><br />
<center><table width=80%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:px;"><img width=400 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph1.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph2.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph3.jpg"/></td><br />
<br />
</tr></table></center><br />
<br />
<center><table width=80%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:px;"><img width=400 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph4.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph5.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph6.jpg"/></td><br />
<br />
</tr></table></center><br />
<br />
<center><table width=80%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:px;"><img width=400 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph7.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph8.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://2014hs.igem.org/File:Igemcideb2014graph9.jpg"/></td><br />
<br />
</tr></table></center><br />
<br />
<br />
<br />
<br />
<br />
<br />
<p>You can download the raw data from this experiment in <a href="https://static.igem.org/mediawiki/2014hs/9/97/Rawdatacideb2014.xls">here</a>. <br />
<br><br />
<p><h2><b><a name="AromaRe1"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#AromaExp" target="_blank"> Aroma Qualitative Experiments</a> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><font color="red">[Aroma Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p><b>Experiment 1 - Test tubes</b></p><br />
<br />
<p> AQUI S; </p><br />
<br />
<p><b>Experiment 2 - Petri dishes</b></p><br />
<p>Random people were chosen to smell our bacteria, four people per each concentration. The experiment was performed with three different concentrations of salicylic acid, which were of 10 mM, 20 mM, and 30 mM. All of the samples contained salicylic acid. There was a controlled group grown bellow and above the 32 ºC and a group with transformed bacteria with the Aroma module, also grown bellow and above the 32 ºC; per each concentration. </p><br />
<p>Those are the words that people used to repeat, or synonyms of what the said, because all the opinions were described in a different way. </p><br />
<br />
<center><table style="background-color:#FFFFFF" width="80%" cellpadding="2"><br />
<tr style='background-color:#3C3C3C'><br />
<td></td><br />
<td><font color="#FFFFFF"><b>Controlled Group Below 32 ºC</b></font></td><br />
<td><font color="#FFFFFF"><b>Group Below 32 ºC</b></font></td><br />
<td><font color="#FFFFFF"><b>Controlled Group Above 32 ºC</b></font></td><br />
<td><font color="#FFFFFF"><b>Group Above 32 ºC</b></font></td><br />
</tr><br />
<tr><br />
<td style='background-color:#3C3C3C'><font color="#FFFFFF"><b>10 mM</b></font></td><br />
<td>Corn</td><br />
<td>Rotten food but with a fresh scent</td><br />
<td>Rotten food</td><br />
<td>Ointment or a very Fresh Scent</td><br />
</tr><br />
<tr><br />
<td style='background-color:#3C3C3C'><font color="#FFFFFF"><b>20 mM</b></font></td><br />
<td>Rotten food</td><br />
<td>A little bit fresh</td><br />
<td>Rotten food</td><br />
<td>Household product. (Fresh)</td><br />
</tr><br />
<tr><br />
<td style='background-color:#3C3C3C'><font color="#FFFFFF"><b>30 mM</b></font></td><br />
<td>Rotten food</td><br />
<td>Rotten food</td><br />
<td>Rotten food</td><br />
<td>Rotten food</td><br />
</tr><br />
</table></center><br />
<br><br />
<br />
<br />
<center><p><img width=90% src="https://static.igem.org/mediawiki/2014hs/b/bf/People_smelling_aroma_bacteria.jpg"<br />
align=center hspace=12></p><br />
<p><font size="2"><b>Image 12. </b>People smelling the different Petri dishes previously inoculated with the bacteria transformed with the aroma module in order to describe the odor they perceive. </font></p></center> <br />
<br />
<p><b>Qualitative Aroma experimentation in petri dishes</b></p> <br />
<center><iframe width="640" height="390" src="//www.youtube.com/embed/IeMDPOI8kXk" frameborder="0" allowfullscreen></iframe></center><br />
<br />
<div style="text-align: left;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_discussions#AromaInt"><font size="2" color="blue">Go to Results Interpretations</font></a></p></div><br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_abstractTeam:CIDEB-UANL Mexico/project abstract2014-06-21T03:26:39Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1" /><br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style>body{margin:0;width:100%;padding:0;background:#2056ac;font-family:'Oxygen',sans-serif;font-size:12pt;background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif)}h1,h2,h3{margin:0;padding-bottom:5px;color:#404040}p,ol,ul{margin-top:0}ol,ul{padding:0;list-style:none}p{line-height:1.60em;padding- right:3em}a{color:#2056ac}a:hover{text-decoration:none}.container{margin:0 auto;width:1200px}.container-text{margin:0 auto;width:75%;padding:0;font-family:'Oxygen',sans-serif;font-size:12pt;text-align:justify}.wrapper{overflow:hidden;padding:0 0 1em 0;background:#FFF}#wrapper1{background:#FFF}#wrapper2{overflow:hidden;background:#f3f3f3;padding:5em 0;text-align:center}#wrapper3{overflow:hidden;padding:0;background:#FFF}#banner{padding-top:2em}#welcome{overflow:hidden;width:1000px;padding:0 100px 0 100px;text-align:center}#welcome .content{padding:0 8em}.title{margin-bottom:1em}.title h2{font-size:2em}.title .byline{font-size:1.1em;color:#6F6F6F#}#three-column{overflow:hidden;margin-top:5em;padding-top:1em;border-top:1px solid rgba(0,0,0,0.2);text-align:center}#three-column h2{margin:1em 0;font-size:1.5em;font-weight:700}#three-column .icon{position:relative;display:block;margin:0 auto .80em auto;background:0;line-height:150px;font-size:4em;width:150px;height:100px;border-radius:100px;border:6px solid #67128f;text-align:center;color:#FFF}#three-column #tbox1,#three-column #tbox2,#three-column #tbox3{float:left;width:320px;padding:30px 40px 50px 40px}#three-column .title{text-align:center}#three-column .title h2{font-size:1.60em}#three-column .title .byline{padding-top:.50em;font-size:.90em;color:#858585}#three-column .arrow-down{border-top-color:#292929}ul.tools{margin:0;padding:0;list-style:none}ul.tools li{display:inline-block;padding:0 .2em;font-size:4em}ul.tools li span{display:none;margin:0;padding:0}ul.tools li a{color:#FFF}ul.tools li a:before{display:inline-block;background:#1abc9c;width:120px;height:120px;border-radius:50%;line-height:120px;text-align:center;color:#fff}.button{display:inline-block;margin-top:2em;padding:.8em 2em;background:#64abd1;line-height:1.8em;letter-spacing:1px;text-decoration:none;font-size:1em;color:#FFF}.button:before{display:inline-block;background:#8dcb89;margin-right:1em;width:40px;height:40px;line-height:40px;border-radius:20px;text-align:center;color:#272925}#portfolio{overflow:hidden;padding-top:5em;border-top:1px solid rgba(0,0,0,0.2)}#portfolio .box{text-align:center;color:rgba(0,0,0,0.5)}#portfolio h3{display:block;padding-bottom:1em;font-size:1em;color:rgba(0,0,0,0.6)}#portfolio .title{text-align:center}#portfolio .title h2{color:rgba(0,0,0,0.8)}.column1,.column2,.column3,.column4{width:282px}.column1,.column2,.column3{float:left;margin-right:24px}.column4{float:right}</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Abstract</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<p align="justify"><p>iGEM CIDEB 2014’s project consists on a biological filter in which sodium ions are taken out of saltwater. To achieve this objective, the project reunited 4 different genes, each one giving <i>E. coli</i> a certain ability to perform a specific task.</p><br />
<p>This year’s project consists of two devices: the first and main one is in charge of the removal of sodium ions. This device uses an aroma to report its effectivity. The second one is responsible of giving resistance to the bacteria to outstand conditions that would normally kill it, and also giving <i>E.coli</i> the ability to bind to silica or glass surfaces.</p><br />
<p>Even though the project was originally composed by this two devices, for experimental purposes it was divided into four different modules. These modules are named after their function, and the name of the project “E.CARU” is an acronym of each one of them.</p><br />
<p>The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank">Capture</a> module uses a completely new gene in iGEM that encodes for a protein that introduces sodium ions into the bacteria. The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank">Aroma</a> module is in charge of producing a mint-like odor in order to report the functionality of the Capture module. The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance" target="_blank">Resistance </a> module allows <i>E. coli</i> to withstand the salinity of the environment in which it is required to work, and finally, the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union" target="_blank"> Union</a> module causes the bacteria to join to silica or glass surfaces, giving it the ability to act as a biofilter.<br />
</p><br />
</div><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Problem</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<table width=100%><br />
<tr><br />
<td><br />
<p>Water has been always known as a source of life, but nowadays there is not enough usable fresh water available in the world. The lack of fresh water around the world is an issue that presents a dangerous problem to our future. Only a small portion of Earth’s water is actually usable. Ninety-seven percent of the world's water is too salty for consumption or agricultural use. Furthermore, much of the fresh water is held in ice caps or other unattainable sources. This leaves approximately one percent of the global water as liquid and fresh; ninety-eight percent of which is groundwater (Bouwer, 2002).</p><br />
<p>Different methods have been developed to solve these problems. One of them is desalination; converting sea water (rich in salts) into usable water, but this method is very expensive due to the great use of electrical energy, and the extraction process produces dangerous wastes to the environment (Cotruvo, 2010).</p><br />
</td><br />
<td style="padding-left:12px"><br />
<img width=265 height=243 src="https://static.igem.org/mediawiki/2014hs/archive/c/c9/20140609211415%21Logo.png"/><br />
</td><br />
</tr><br />
</table><br />
<p>For this reason, the project is focused on developing a biological machine capable of performing desalination, reducing costs and avoiding dangerous wastes during the process. For making this possible, <i>E. coli</i> needed to capture Na+ ions in saline environments and to be removed from the water after performing its task.</p><br />
</div><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Overview</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<p>Before&nbsp;<em>E. coli</em>&nbsp;could be able to remove Na<sup>+</sup> ions from water, it needed to aquire a resistance to adverse conditions, in particular excess salt. This could be possible through a protein called &ldquo;IrrE&rdquo;, which makes&nbsp;<em>E. coli</em>&nbsp;resistant to saline environments as well as UV rays and temperature changes.<br /><br />
The protein NhaS (a new part), was used to give <em>E. coli</em> the ability to bind and capture Na+ ions. Also, the optimized version of the reporter &ldquo;BSMT1&rdquo;, a protein able to react with salicylic acid and release a Wintergreen odor, was used to know if nhaS was expressed.<br /><br />
The final task that&nbsp;<em>E. coli</em>&nbsp;should perform was to bind its membrane to silica pearls, in order to be able to be removed from the water after taking out Na<sup>+</sup> ions. In order to do this, a fusion protein named L2+AIDA was used. L2 gives&nbsp;<em>E. coli</em>&nbsp;the ability to bind silica, and AIDA acts as a tag for making L2 a membrane protein. With this ability&nbsp;<em>E. coli</em>&nbsp;could be removed from water through a bio-filter, made up of silica.<br /><br />
The complete circuit is shown in&nbsp;<strong>figure 1</strong>. BSMT1 opt acts as a reporter for nhaS which is regulated by UV (to have a control over the NhaS expression), and IrrE with L2+AIDA are continuously produced.</p><br />
<p align="justify">&nbsp;</p><br />
<center><br />
<p><img width=552 height=313 src="https://static.igem.org/mediawiki/2014hs/6/6a/Correct_circuit_cideb.png" align=center hspace=12 alt="IMG_0317"></p><br />
<p><b>Figure 1.</b> Diagram representing our proposed circuit</p><br />
</center><br />
<p>But we realized <i>E. coli</i> could have a genetic overload because the circuit was too big (approximately 5000 bp). Also the time we had to finish it was not enough, as well as most of the proteins we wanted to produce were putative or untested. So for a better understanding and for determine if each piece works we divided the project into four modules: capture, union, aroma and resistance, but the project is the result of their correlation. In fact our <i>E. coli</i> was named E. CARU (each letter by each module). </p><br />
<center><br />
<table width=60%><br />
<tr><br />
<td><br />
<p><b>E</b>scherichia coli</p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank"><b>C</b>apture</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><b>A</b>roma</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance" target="_blank"><b>R</b>esistance </a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union" target="_blank"><b>U</b>nion</a></p><br />
</td><br />
<td style="padding-left:12px"><img width=286 height=285 src="https://static.igem.org/mediawiki/2014hs/3/30/Image006cideb2014.png"/><br />
</td><br />
</tr><br />
</table><br />
</center><br />
<p><b><h2>Project Zoom In</h2></b></p><br />
<center><iframe width="854" height="510" src="//www.youtube.com/embed/dflyBM3WNxE" frameborder="0" allowfullscreen></iframe></center> <br />
<p><b><h2>Bibliography/References</h2></b></p><br />
<font size="2"><br />
<p>● Bouwer, H. (2002). Integrated Water Management for the 21st Century: Problems and Solutions. Journal of irrigation and drainage engineering, 193-200.</p><br />
<p>● Joseph Cotruvo, N. V. (2010). Desalination Technology: Health and Environmental Impacts. U.S: Taylor and Francis Group.</p><br><br />
<div style="text-align:right"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_abstract#"><font color="blue">Return to the Top</font></a></p></div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/achievementsTeam:CIDEB-UANL Mexico/achievements2014-06-21T03:16:48Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_achievements}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Achievements</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Achievements</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<table width=100%><br />
<tr><br />
<td><br />
<p>During the project, iGEM CIDEB 2014 acquired the following achievements:</p><br />
<br />
<p><h2><b>Dry Lab <img width=15 height=20 src="https://static.igem.org/mediawiki/2014hs/c/cf/Check1.png"/></h2></b></p><br />
<br />
<br />
<p><b><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Cloned BioBricks in <i>E. coli</i> and <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Characterization">characterized</a> them:</b></p><br />
<blockquote><br />
<p>-> <a href="http://parts.igem.org/Part:BBa_K1255003" target="_blank">BBa_K1255003</a> which gives our bacteria the ability to produce an odor.</p><br />
<p>-> <a href="http://parts.igem.org/Part:BBa_K1255002" target="_blank">BBa_K1255002</a> which gives our bacteria the ability capture Na ions.</p><br />
</blockquote><br />
<br />
<br />
<br />
<br />
<p><b><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Characterized a part from another team:</b></p><br />
<blockquote><br />
<p>●From <a href="https://2006.igem.org/wiki/index.php/MIT_2006" target="_blank">MIT 2006</a>:</p><br />
<p>-> <a href="http://parts.igem.org/Part:BBa_J45004" target="_blank">BSMT1 (BBa_J45004)</a> which gives our bacteria the ability to produce an odor. </p> <br />
<p>●From <a href="https://2008.igem.org/Team:TUDelft" target="_blank">Tu Delft 2008</a>:</p><br />
<p>-> RNA Thermomether: <a href="http://parts.igem.org/Part:BBa_K115017" target="_blank">BBa_K115017</a> which gives our Aroma module the ability to be regulated by temperature. </p> <br />
<p>●From <a href="https://2007.igem.org/wiki/index.php/Colombia-Israel_(ORT_Ebin_High_School)" target="_blank">Colombia-Israel 2007</a>:</p><br />
<p>-> UV Promoter: <a href="http://parts.igem.org/Part:BBa_I765001" target="_blank">BBa_I765001</a> which lets our Capture module the ability to be regulated by UV light. </p><br />
</blockquote><br />
<br />
<p><b><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Created a completely new part in the registry.</b></p><br />
<blockquote><br />
<p>-> nhaS gene, which gives our bacteria the ability to bind to Sodium ions: <a href="http://parts.igem.org/Part:BBa_K1255000" target="_blank">BBa_K1255000</a></p><br />
</blockquote><br />
<br />
<p><b><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Finished a construction of the project from another team.</b></p><br />
<blockquote><br />
<p>->From the <a href="https://2012.igem.org/Team:UANL_Mty-Mexico" target="_blank">UANL 2012</a> team:</p><br />
<p>- AIDA-I Signal peptide: <a href="http://parts.igem.org/Part:BBa_K888005" target="_blank">BBa_K888005</a></p><br />
<p>- L2 protein of adhesion to silica: <a href="http://parts.igem.org/Part:BBa_K888000" target="_blank">BBa_K888000</a></p><br />
<p>- AIDA-I Translocator domain: <a href="http://parts.igem.org/Part:BBa_K888001" target="_blank">BBa_K888001</a></p><br />
</blockquote><br />
<p><b><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Used an already existent part from the registry.</b></p><br />
<blockquote><br />
<p> -> Which gives our bacteria the resistance to a saline environment: <a href="http://parts.igem.org/Part:BBa_K729001" target="_blank">IrrE (BBa_K729001)</a> from <a href="https://2012.igem.org/Team:University_College_London" target="_blank">UCL 2012</a>.</p><br />
</blockquote><br />
<br />
<br><p><h2><b>Lab Work <img width=15 height=20 src="https://static.igem.org/mediawiki/2014hs/c/cf/Check1.png"/></b></h2></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Obtained the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results" target="_blank">experimental results</a> that were needed for the correct function of an important part of our project. </p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> We had a control over our experiments, being regulated by heat (<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank">Aroma module</a>) and UV light (<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank">Capture module</a>).</p><br />
<br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> All the lab work was performed following the correct <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods" target="_blank">methods</a> and the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysis" target="_blank">safety</a> protocols.</p><br />
<br />
<br><p><h2><b>Math Model <img width=15 height=20 src="https://static.igem.org/mediawiki/2014hs/c/cf/Check1.png"/></b></h2></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Mathematically modeled all the four modules of our project:</p><br />
<blockquote><br />
<p> -> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_capture" target="_blank">Capture</a></p><br />
<p> -> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_aroma" target="_blank">Aroma</a></p><br />
<p> -> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_resistance" target="_blank">Resistance</a></p><br />
<p> -> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_union" target="_blank">Union</a></p><br />
</blockquote><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Graphs were done with the correct information from the model.</p><br />
<br />
<br><p><h2><b>Human Practices <img width=15 height=20 src="https://static.igem.org/mediawiki/2014hs/c/cf/Check1.png"/></b></h2></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Achieved that all students from our high school knew what iGEM is and the explanation of this year’s project. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_explosion" target="_blank">Explosion</a> & <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_dnaweek" target="_blank">DNA Week</a></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Gave a presentation to 40 foreign teachers in which it was explained what iGEM is and our project. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav" target="_blank">CINVESTAV</a></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Organized a 4k race for students and general public to promote: health, science and iGEM’s work. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_race" target="_blank">Race 4 Science</a></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Collaborated with the HS teams UCL Academy and GenetiX Tec CCM. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations" target="_blank"> Collaborations</a></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Collaborated with the College team Evry. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations" target="_blank">Collaborations</a></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Created a videogame to recreate the main function of our project. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_videogame" target="_blank">Videogame</a></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Participated in an event with all the iGEM teams from the state. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_enlacecientifico" target="_blank">Enlace Científico</a></p><br />
<br />
<br><p><h2><b>Safety <img width=15 height=20 src="https://static.igem.org/mediawiki/2014hs/c/cf/Check1.png"/></b></h2></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Performed a complete Risk Analysis from our project. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysis" target="_blank">Risk Analysis</a></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Designed a contention method for our bacteria. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysis" target="_blank">Risk Analysis</a></p><br />
</td></tr></table><br />
<br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/achievements#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_abstractTeam:CIDEB-UANL Mexico/project abstract2014-06-21T03:10:11Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1" /><br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style>body{margin:0;width:100%;padding:0;background:#2056ac;font-family:'Oxygen',sans-serif;font-size:12pt;background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif)}h1,h2,h3{margin:0;padding-bottom:5px;color:#404040}p,ol,ul{margin-top:0}ol,ul{padding:0;list-style:none}p{line-height:1.60em;padding- right:3em}a{color:#2056ac}a:hover{text-decoration:none}.container{margin:0 auto;width:1200px}.container-text{margin:0 auto;width:75%;padding:0;font-family:'Oxygen',sans-serif;font-size:12pt;text-align:justify}.wrapper{overflow:hidden;padding:0 0 1em 0;background:#FFF}#wrapper1{background:#FFF}#wrapper2{overflow:hidden;background:#f3f3f3;padding:5em 0;text-align:center}#wrapper3{overflow:hidden;padding:0;background:#FFF}#banner{padding-top:2em}#welcome{overflow:hidden;width:1000px;padding:0 100px 0 100px;text-align:center}#welcome .content{padding:0 8em}.title{margin-bottom:1em}.title h2{font-size:2em}.title .byline{font-size:1.1em;color:#6F6F6F#}#three-column{overflow:hidden;margin-top:5em;padding-top:1em;border-top:1px solid rgba(0,0,0,0.2);text-align:center}#three-column h2{margin:1em 0;font-size:1.5em;font-weight:700}#three-column .icon{position:relative;display:block;margin:0 auto .80em auto;background:0;line-height:150px;font-size:4em;width:150px;height:100px;border-radius:100px;border:6px solid #67128f;text-align:center;color:#FFF}#three-column #tbox1,#three-column #tbox2,#three-column #tbox3{float:left;width:320px;padding:30px 40px 50px 40px}#three-column .title{text-align:center}#three-column .title h2{font-size:1.60em}#three-column .title .byline{padding-top:.50em;font-size:.90em;color:#858585}#three-column .arrow-down{border-top-color:#292929}ul.tools{margin:0;padding:0;list-style:none}ul.tools li{display:inline-block;padding:0 .2em;font-size:4em}ul.tools li span{display:none;margin:0;padding:0}ul.tools li a{color:#FFF}ul.tools li a:before{display:inline-block;background:#1abc9c;width:120px;height:120px;border-radius:50%;line-height:120px;text-align:center;color:#fff}.button{display:inline-block;margin-top:2em;padding:.8em 2em;background:#64abd1;line-height:1.8em;letter-spacing:1px;text-decoration:none;font-size:1em;color:#FFF}.button:before{display:inline-block;background:#8dcb89;margin-right:1em;width:40px;height:40px;line-height:40px;border-radius:20px;text-align:center;color:#272925}#portfolio{overflow:hidden;padding-top:5em;border-top:1px solid rgba(0,0,0,0.2)}#portfolio .box{text-align:center;color:rgba(0,0,0,0.5)}#portfolio h3{display:block;padding-bottom:1em;font-size:1em;color:rgba(0,0,0,0.6)}#portfolio .title{text-align:center}#portfolio .title h2{color:rgba(0,0,0,0.8)}.column1,.column2,.column3,.column4{width:282px}.column1,.column2,.column3{float:left;margin-right:24px}.column4{float:right}</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Abstract</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<p align="justify"><p>iGEM CIDEB 2014’s project consists on a biological filter in which sodium ions are taken out of saltwater. To achieve this objective, the project reunited 4 different genes, each one giving <i>E. coli</i> a certain ability to perform a specific task.</p><br />
<p>This year’s project consists of two devices: the first and main one is in charge of the removal of sodium ions. This device uses an aroma to report its effectivity. The second one is responsible of giving resistance to the bacteria to outstand conditions that would normally kill it, and also giving <i>E.coli</i> the ability to bind to silica or glass surfaces.</p><br />
<p>Even though the project was originally composed by this two devices, for experimental purposes it was divided into four different modules. These modules are named after their function, and the name of the project “E.CARU” is an acronym of each one of them.</p><br />
<p>The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank">Capture</a> module uses a completely new gene in iGEM that encodes for a protein that introduces sodium ions into the bacteria. The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank">Aroma</a> module is in charge of producing a mint-like odor in order to report the functionality of the Capture module. The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance" target="_blank">Resistance </a> module allows <i>E. coli</i> to withstand the salinity of the environment in which it is required to work, and finally, the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union" target="_blank"> Union</a> module causes the bacteria to join to silica or glass surfaces, giving it the ability to act as a biofilter.<br />
</p><br />
</div><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Problem</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<table width=100%><br />
<tr><br />
<td><br />
<p>Water has been always known as a source of life, but nowadays there is not enough usable fresh water available in the world. The global lack of fresh water is an issue that presents a dangerous problem to our future. Only a small portion of our planet's water is actually usable. Ninety-seven percent of the world's water is too salty for consumption or agricultural use. Furthermore, much of the rest is held in ice caps or other unattainable sources. This leaves approximately one percent of the global water as liquid and fresh; ninety-eight percent of which is groundwater (Bouwer, 2002).</p><br />
<p>For solving this problem different methods have been developed. One of them is desalination, converting sea water (rich in salts) into usable water, but this method is very expensive due to the great use of electrical energy and the extraction process produces dangerous wastes to the environment (Cotruvo, 2010).</p><br />
</td><br />
<td style="padding-left:12px"><br />
<img width=265 height=243 src="https://static.igem.org/mediawiki/2014hs/archive/c/c9/20140609211415%21Logo.png"/><br />
</td><br />
</tr><br />
</table><br />
<p>For that reason our project is focused on developing a biological machine capable of performing desalination, reducing costs and avoiding dangerous wastes during the process. For making this possible, <em>E. coli</em> needed to capture Na<SUP>+</SUP> ions in saline environments to be removed from water after performing its task.</p><br />
</div><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Overview</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<p>Before&nbsp;<em>E. coli</em>&nbsp;could be able to remove Na<sup>+</sup> ions from water, it needed to aquire a resistance to adverse conditions, in particular excess salt. This could be possible through a protein called &ldquo;IrrE&rdquo;, which makes&nbsp;<em>E. coli</em>&nbsp;resistant to saline environments as well as UV rays and temperature changes.<br /><br />
The protein NhaS (a new part), was used to give <em>E. coli</em> the ability to bind and capture Na+ ions. Also, the optimized version of the reporter &ldquo;BSMT1&rdquo;, a protein able to react with salicylic acid and release a Wintergreen odor, was used to know if nhaS was expressed.<br /><br />
The final task that&nbsp;<em>E. coli</em>&nbsp;should perform was to bind its membrane to silica pearls, in order to be able to be removed from the water after sequestering Na<sup>+</sup> ions. In order to do this, a fusion protein named L2+AIDA was used. L2 gives&nbsp;<em>E. coli</em>&nbsp;the ability to bind silica, and AIDA acts as a tag for making L2 a membrane protein. With this ability&nbsp;<em>E. coli</em>&nbsp;could be removed from water through a bio-filter, made up of silica.<br /><br />
The complete circuit is shown in&nbsp;<strong>figure 1</strong>. BSMT1 opt acts as a reporter for nhaS which is regulated by UV (to have a control over the NhaS expression), and IrrE with L2+AIDA are continuously produced.</p><br />
<p align="justify">&nbsp;</p><br />
<center><br />
<p><img width=552 height=313 src="https://static.igem.org/mediawiki/2014hs/6/6a/Correct_circuit_cideb.png" align=center hspace=12 alt="IMG_0317"></p><br />
<p><b>Figure 1.</b> Diagram representing our proposed circuit</p><br />
</center><br />
<p>But we realized <i>E. coli</i> could have a genetic overload because the circuit was too big (approximately 5000 bp). Also the time we had to finish it was not enough, as well as most of the proteins we wanted to produce were putative or untested. So for a better understanding and for determine if each piece works we divided the project into four modules: capture, union, aroma and resistance, but the project is the result of their correlation. In fact our <i>E. coli</i> was named E. CARU (each letter by each module). </p><br />
<center><br />
<table width=60%><br />
<tr><br />
<td><br />
<p><b>E</b>scherichia coli</p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank"><b>C</b>apture</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><b>A</b>roma</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance" target="_blank"><b>R</b>esistance </a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union" target="_blank"><b>U</b>nion</a></p><br />
</td><br />
<td style="padding-left:12px"><img width=286 height=285 src="https://static.igem.org/mediawiki/2014hs/3/30/Image006cideb2014.png"/><br />
</td><br />
</tr><br />
</table><br />
</center><br />
<p><b><h2>Project Zoom In</h2></b></p><br />
<center><iframe width="854" height="510" src="//www.youtube.com/embed/dflyBM3WNxE" frameborder="0" allowfullscreen></iframe></center> <br />
<p><b><h2>Bibliography/References</h2></b></p><br />
<font size="2"><br />
<p>● Bouwer, H. (2002). Integrated Water Management for the 21st Century: Problems and Solutions. Journal of irrigation and drainage engineering, 193-200.</p><br />
<p>● Joseph Cotruvo, N. V. (2010). Desalination Technology: Health and Environmental Impacts. U.S: Taylor and Francis Group.</p><br><br />
<div style="text-align:right"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_abstract#"><font color="blue">Return to the Top</font></a></p></div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methodsTeam:CIDEB-UANL Mexico/labwork methods2014-06-20T19:32:39Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_labwork}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Methods</h2><br />
<br />
<div class="wrapper"><br />
<center><div class="container2"><br />
<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Construction" class="button2">Construction Plan and Protocols</a><br />
<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Experiments" class="button2">Experiments</a><br />
</div></center><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><h2> <b><a name="Construction"></a> <font size="6">Construction plan and Protocols </font></b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#"><font size="2">Return to the Top</font></a></h2></p><br />
<p>How do we plan to get the construction of our modules? Here is shown all the construction plan that we followed with all the aspects that we considered.</p> <br />
<p><a href="https://static.igem.org/mediawiki/2014hs/b/b8/LaboratoryProtocolsCIDEB.pdf">Protocols and Construction Plan PDF</a></p><br />
<br />
<br />
<center><object data='https://static.igem.org/mediawiki/2014hs/b/b8/LaboratoryProtocolsCIDEB.pdf#zoom=20&scrollbar=1' <br />
type='application/pdf' <br />
width='100%' <br />
height='750'><br />
<br />
<p>It appears your Web browser is not configured to display PDF files. <br />
No worries, just <a href='https://static.igem.org/mediawiki/2014hs/b/b8/LaboratoryProtocolsCIDEB.pdf'>click here to download the PDF file.</a></p><br />
<br />
</object></center><br />
<br><br />
<p><h2> <b><a name="Experiments"></a><font size="6">Experiments</font> </b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#"><font size="2">Return to the Top</font></a></h2></p> <br />
<p>In this section, the experiments performed in order to test the effectivness of the predicted models for our proyect, will be described. </p><br />
<p>The tested parts are the following:: </p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Capture" class="button2"> Capture Module</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#AromaExp" class="button2">Aroma Module</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#UnionExp" class="button2">Union Module</a></p><br />
<br />
<p><h2><b><a name="Capture"></a>Capture Module </b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#"><font size="2">Return to the Top</font></a></h2></p><br />
<br />
<p><a name="UVExp"></a><b>UV Experimentation</b></p><br />
<br />
<p>This experiment was designed in order to test the UV promoter's efectivness.</p><br />
<br />
<p><b>Procedure:</b></p><br />
<br />
<p><b>1.</b> 2 Petri dishes were inoculated according to the &quot;streak method&quot; with transformed bacteria from a cultured petri dish, containing the NhaS and the RFP genes in their plasmids. (These colonies looked red due to the RFP) </p><br />
<p><b>2.</b> The first step was repeated, this time with the transformed bacteria cultures containing the NhaS gene only, without the RFP gene. (These colonies looked white due to the absence of the RFP) </p><br />
<p><b>3.</b> The bacteria was grown for one day in the incubator at 37°C</p><br />
<p><b>4.</b> The four petri dishes were exposed to UV radiation (302nm) during a 2 hour period </p><br />
<p><b>5.</b> Pictures were taken of the bacteria cultures at 10 minute intervals for the 2 hour period </p><br />
<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#UV">Go to results</a></p><br />
<br />
<br><br />
<p><a name="Viability"></a><h2><b>Viability test of the NhaS gene containing bacteria in salt</b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#"><font size="2">Return to the Top</font></a></h2><br />
<p>In theory, the NhaS gene gives the bacteria a certain resistance to salt, but the exact percentage of increase in the resistance is unknown. Four experiments were designed in order to test:</p><br />
<ul><br />
<li> The viability of the NhaS transformed bacteria to survive in a salty environment</li><br />
<li>The maximum ammount of salt in the medium which can be withstanded by the transformed bacteria</li><br />
<li>Which of the two kinds of bacteria (red and white) gotten in the ligation, has the nhaS gene.</li><br />
</ul><br />
<p>In the ligation process of the NhaS gene, two different kinds of plasmids were obtained due to a possible mutation. The ones containing the RFP producing gene, and the ones that did not. Because it was uncertain the presence of the NhaS gene in the non-RFP producing bacteria these experiments were designed and performed in order to determine which one of the groups contain the NhaS gene. </p><br />
<p>&nbsp;</p><br />
<p><b>Experiment #1</b></p><br />
<br />
<p>Materials: </p><br />
<p><b>● </b>NaCl concentration of 1%</p><br />
<p><b>● </b>NaCl concentration of 2.5%</p><br />
<p><b>● </b>NaCl concentration of 5%</p><br />
<p><b>● </b>NaCl concentration of 10%</p><br />
<p><b>● </b>NaCl concentration of 15%</p><br />
<p><b>● </b>18 erlenmeyer flasks</p><br />
<p><b>● </b>A micropipette of 1000 micro liters </p><br />
<p><b>● </b>Micropipette peaks </p><br />
<p><b>● </b>Bacteria with NhaS gene and reporter expression (red bacteria or RB)</p><br />
<p><b>● </b>Bacteria with NhaS gene and no reporter expression (with batceria) </p><br />
<p><b>● </b>Bacteria with no NhaS gene and no reporter presented (with bacteria without the gene)</p><br />
<p><b>● </b>33 petri dishes </p><br />
<br><br />
<p><b>Procedure:</b> </p><br />
<p><br />
<b>1. </b>Five concentrations of NaCl in mQ water (1.0%, 2.5%, 5.0%, 10.0%, 15.0%) were prepared in separated flasks. </p><br />
<p><b><br />
2. </b>The three groups of bacteria (RFP+NhaS, NhaS and the contro) were separated in different test tubes. </p><br />
<p><b><br />
3. </b>In a petri dish with LB agar and Chloramphenicol, 1 milliliter of the 1.0% concentration of NaCl was introduced; this process was repeated in the three petri dishes and in a sterile environment 30 cm near the bunsen burner in order to avoid contamination.</p><br />
<p><b><br />
4. </b>In both both petri dishes, 200 microliters of NhaS transformed red bacteria were introduced, and distributed the content with a sterile glass inoculation spreader in a sterile environment. </p><br />
<p><b><br />
5. </b>The steps 3 and 4 were repeated four times, but with the other four concentrations (2.5%, 5.0%, 10.0%, 15.0%.). </p><br />
<p><b><br />
6. </b>The s teps 3 through 5 were repeated two more times, with a the remaining groups of bacteria.</p><br />
<p><b><br />
7. </b> Three petri dishes with LB agar were inoculated with the control bacteria, introducing 200 microliters of it and spreading it with a sterile glass inoculation spreader. </p><br />
<p><b><br />
8. </b>The 33 total petri dishes were cultivated at 37º C for 24 hours. </p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Salt1">Go to results</a></p><br />
<br />
<br><br />
<p><b>Experiment #2</b></p><br />
<p>Materials:</p><br />
<p><b>●</b>15 erlenmeyer flasks of 100 ml.</p><br />
<p><b>●</b>Cultive of NhaS red transformed bacteria.</p><br />
<p><b>●</b>Cultive of NhaS white transformed bacteria.</p><br />
<p><b>●</b>20 ml of each one of the next concentrations of NaCl:</p><br />
<p> 1.0%, 2.5%, 5.0%, 10.0%, 15.0%</p><br />
<br><br />
<p>Procedure: </p><br />
<p><b><br />
1. </b>In flasks of 100mL, different concentrations of NaCl in mQ water were preparated(1.0%, 2.5%, 5.0%, 10.0%, 15.0%), having a finale volume of 20mL, and were divided into 3 flasks of each concentration</p><br />
<p><b><br />
2. </b> 200 uL of NhaS transformed white bacteria solution was placed in the flasks with each of the five different concentrations in a sterile environment, no more than 30 cm away from a Bunsen burner, to avoid sample contamination. </p><br />
<p><b><br />
3. </b>The previous step was repeated with the other two groups of bacteria. At the end there will be 15 flasks. of bacteria (five of each type). </p><br />
<p><b>4. </b>The 15 flasks were incubated at 37 ºC during a day. </p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Salt2">Go to results</a></p><br />
<br><br />
<p><b>Experiment #3</b></p><br />
<p>Materials: </p><br />
<p><b>● </b>25ml NaCl 1% + 25 ml CLB + 50 ml Cm </p><br />
<p><b>● </b>25ml NaCl 2.5% + 25 ml CLB + 50 ml Cm </p><br />
<p><b>● </b>25ml NaCl 5% + 25 ml CLB + 50 ml Cm </p><br />
<p><b>● </b>25ml NaCl 10% + 25 ml CLB + 50 ml Cm </p><br />
<p><b>● </b>25ml NaCl 15% + 25 ml CLB + 50 ml Cm </p><br />
<p><b>● </b>18 erlenmeye flasks</p><br />
<p><b>● </b>1000 micro micropipette</p><br />
<p><b>● </b>Micropipette peaks </p><br />
<p><b>● </b>Bacteria with NhaS gene and reporter expression (red bacteria or RB)</p><br />
<p><b>● </b>Bacteria with NhaS gene and no reporter expression (with batceria) </p><br />
<p><b>● </b>Bacteria with no NhaS gene and no reporter presented (with bacteria without the gene)</p><br />
<p><b>● </b>90 petri dishes</p><br />
<p><b>● </b>45 test tubes</p><br />
<p><b>● </b>Peptoned water</p><br />
<br />
<br><br />
<p><b>Procedure:</b> </p><br />
<p><b><br />
1. </b>Three samples of each salt concentration are produced in order expose all bacteria to all salt concentration independently. These concentrations are made into Erlenmeyer flasks; this represents a total of 15 Erlenmeyer flasks used in the beginning of the process.</p><br />
<p><b><br />
2. </b> Three Erlenmeyer flasks were previously settled with the different bacteria. Each of these three Erlenmeyer flask contained a specific group of bacteria (red bacteria, white bacteria and controlled bacteria)</p><br />
<p><b><br />
3. </b>With the micropipette and it’s respective peaks, 200uL of red bacteria solution were added to all salt concentrations (Just in one flask of the three ones from Nacl1% mix to NaCl 15% mix); this process was repeated in the three petri dishes and in a sterile environment 30 cm near the bunsen burner in order to avoid contamination. </p><br />
<p><b>4. </b>The micropipette peak was changed and 200uL of white bacteria solution were added to all salt concentrations (Just in one flask of the three ones from Nacl1% mix to NaCl 15% mix); this process was repeated in the three petri dishes and in a sterile environment 30 cm near the bunsen burner in order to avoid contamination.</p><br />
<p><b>5. </b>Finally but not less important, with the micropipette and it’s respective peaks, 200uL of red bacteria solution were added to all salt concentrations (Just in one flask of the three ones from Nacl1% mix to NaCl 15% mix) ; this process was repeated in the three petri dishes and in a sterile environment 30 cm near the bunsen burner in order to avoid contamination.</p><br />
<p><b>6. </b>The Erlenmeyer were incubated for 12 hours.</p><br />
<p><b>7. </b>Poured, into 45 test tubes, 10 mL of peptoned water.</p><br />
<p><b>8. </b>The 45 test tubes are separated into 3 groups in order to specify 15 test tubes with peptoned water for each bacteria type.</p><br />
<p><b>9. </b>1000 uL (1ml) of a certain colony of bacteria (25ml NaCl #% (1, 2.5, 5, 10, 15) + 25 ml CLB + 50 ml Cm with 200ul bacterias (red bacteria, with bacteria and controlled bacteria)) are poured into one test tube with peptoned water making a solution 1:10.</p><br />
<p><b>10. </b>Two ml of 1:10 solution are collocated into two petri dishes. One ml for each one.</p><br />
<p><b>11. </b>Another ml of 1:10 solution is putted into another test tube with peptone water creating a new 1:100 solution.</p><br />
<p><b>12. </b>Two ml of 1:100 solution are collocated into two petri dishes. One ml for each one.</p><br />
<p><b>13. </b>Another ml of 1:100 solution is putted into another test tube with peptone water creating a new 1:1000 solution.</p><br />
<p><b>14. </b>Two ml of 1:1000 solution are collocated into two petri dishes. One ml for each one.</p><br />
<p><b>15. </b>Repeat from step 9 to step 12 using all concentration of all kind of bacteria.</p><br />
<br />
<br />
<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results">Go to results</a></p><br />
<br />
<br />
<p><a name="AromaExp"></a><h2><b>Aroma module - </b><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#"><font size="2">Return to the Top</font></a></h2></p><br />
<p><b>Qualitative experiments</b></p><br />
<br />
<br />
<p>In the project, one of the modules (the aroma module) consisted in the production of a scented ester in (Winter Green). In order for the gene to work how it was supposed to work, the bacteria must be in an environment with a temperature higher than 32º C. This is because the gene has a constitutive promoter, but an RNA thermoswitch. which permit the synthesis of the protein. The thing is that even if the gene is expressed, it did not had any smell. The reason is because Winter Green odor is produced when the BSTM1 protein comes in contact with salicylic acid. The first experiment was designed only to prove that the protein is being produced and that the Winter Green odor can be smelled.</p><br />
<br><br />
<p><b>Test tubes aroma experiment</p></b><br />
<p>Materials:</p><br />
<p><b>●</b>10 ml of BSMT1 opt. transformed cultive.</p><br />
<p><b>●</b>8 test tubes with 3 ml of LB medium and 3 uL of chloramphenicol.</p><br />
<p><b>●</b>A test tube inoculated with control bacteria (untransformed).</p><br />
<p><b>●</b>Salicylic acid at different concentrations (1mM, 2 mM, 3 mM and 4 mM).</p><br />
<br><br />
<p><b>Procedure:</b></p><br />
<p><b>First part</b></p><br />
<p><b>1.</b> 8 test tubes were inoculated with the BSMT1 opt. transformed bacteria.</p><br />
<p><b>2.</b> 3 ml of salicylic acid (relation 1:1) were added to 4 test tubes, each one with different concentrations: </p><br />
<p>1 mM of salicylic acid</p><br />
<p>2 mM of salicylic acid</p><br />
<p>3 mM of salicylic acid</p><br />
<p>4 mM of salicylic acid</p><br />
<p><b>3.</b> Incubate all test tubes at 37º C during a day</p><br />
<br><br />
<p><b>Second part</b></p><br />
<p><b>1.</b> In a rack were put: a test tube inoculated with the control bacteria, a test tube inoculated with BSTM1 opt. bacteria and salicylic acid, and a test tube inoculated with BSTM1 opt. bacteria but without salicylic acid.</p><br />
<p><b>2.</b> Random people was chosen and asked to smell the three test tubes and describe what the smelled.</p><br />
<br><br />
<p><b>Petri dishes aroma experiment</b></p><br />
<br><br />
<p>Then in order to know if the RNA thermoswitch is working and at which concentration of salicylic acid smells the strongest, the following experiment was performed.</p><br />
<p><strong>Procedure:</strong></p><br />
<p><b>First part:</b></p><br />
<p><b><br />
1. </b>12 Petri dishes with an LB medium and the Chloramphenicol antibiotic were prepared.</p><br />
<p><b><br />
2.</b>3 mL of a solution containing salicylic acid and mQ water was added to four Petri dishes, with the concentration of salicylic acid being of 10 mM. </p><br />
<p><br />
*The step noº 2, was repeated two more times changing the concentration of 10 mM of salicylic acid to 20 mM and 30 mM. </p><br />
<p><b><br />
3. </b>6 Petri dishes with LB medium were prepared. </p><br />
<p><b><br />
4. </b>3 mL of a solution containing salicylic acid and mQ water was added into 2 Petri dishes, with the concentration of salicylic acid being of 10 mM. </p><br />
<p><br />
*The step noº 4 was repeated two more times changing the concentration of 10 mM of salicylic acid to 20 mM and 30 mM. </p><br />
<p><b><br />
5. </b> 200 µL of bacteriawas added into all of the petri dishes. </p><br />
<p><b><br />
6. </b>2 Petri dishes containing Chloramphenicol from each of the three concentrations and 1 Petri dish without Chloramphenicol from each concentration were incubated at 29 ºC for one day. </p><br />
<p><b><br />
7. </b>2 Petri dishes containing Chloramphenicol from each of the three concentrations and 1 Petri dish without Chloramphenicol from each concentration were incubated at 35 ºC for one day. </p><br />
<p><br />
<b>Second part: </b></p><br />
</p><b>1. </b>Random people were chosen to smell the bacteria and a video was taken of their experience: </p><br />
<p><br />
- A group of bacteria with the aroma module at a temperature below 32 ºC. </p><p><br />
- A group of bacteria with the aroma module at a temperature above 32 ºC. </p><p><br />
- A controlled group of bacteria without the gene at a temperature below 32 ºC. </p><p><br />
- A controlled group of bacteria without the gene at a temperature above 32 ºC. </p><br />
<p><b><br />
2. </b>The people were asked to describe what they were smelling </p><br />
<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#AromaRe1">Go to results</a></p><br />
<br />
<p><a name="UnionExp"></a><h2><b>Union module - </b><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#"><font size="2">Return to the Top</font></a></h2></p><br />
<br />
<p>Even if the construction of the union module was not finished, there was a planned experiment in order to characterize the module. As the function of the union module is to give <i>E. coli</i> the ability of binding to silica pearls the experiment was designed with the expectative of get results of how many bacteria bind to the silica in certain time, and the relation between how many silica pearls are and how many bacteria binds to it.</p><br />
<br />
<p>Materials:</p><br />
<p><b>● </b>1000mL (1L) of bacteria with L2+AIDA (silica module) in pSB1C3 plasmid cultive.</p><br />
<p><b>● </b>500ml of control bacteria (untransformed).</p><br />
<p><b>● </b>75 corning tubes of 50 ml.</p></p><br />
<br><br />
<p><b>Procedure:</b></p><br />
<p><b>1.</b> Get the weight of each one of the 75 corning tubes</p><br />
<p><b>2.</b> In 50 corning tubes introduce 20 ml of bacteria transformed with L2+AIDA and in other 25 tubes, 20 ml of untransformed bacteria (control).</p><br />
<p><b>3.</b> Divide the corning tubes in groups (1, 2, 3, 4 and 5) of 5 control and 10 with L2+AIDA bacteria</p><br />
<p><b>4.</b> Centrifugate all groups at 5,000 rpm during 10 minutes. Throw the supernatan.</p><br />
<p><b>5.</b> Weight all the groups and subtract it to the previous weight (Step 1).</p><br />
<p><b>6.</b> Resuspend bacteria in 20 ml of LB medium.</p><br />
<p><b>7.</b> In each group, separate the corning tubes and add them the next grams of silica pearls:</p><br />
<p>0.5 g of silica pearls -> 2 test tubes inoculated with BSMT1 opt. bacteria and 1 test tube with control bacteria.</p><br />
<p>1 g of silica pearls -> 2 test tubes inoculated with BSMT1 opt. bacteria and 1 test tube with control bacteria.</p><br />
<p>2 g of silica pearls -> 2 test tubes inoculated with BSMT1 opt. bacteria and 1 test tube with control bacteria.</p><br />
<p>3 g of silica pearls -> 2 test tubes inoculated with BSMT1 opt. bacteria and 1 test tube with control bacteria.</p><br />
<p>4 g of silica pearls -> 2 test tubes inoculated with BSMT1 opt. bacteria and 1 test tube with control bacteria.</p><br />
<p><b>8.</b> Wait during the next time:</p><br />
<p>- Group 1 - 1 hr</p><br />
<p>- Group 2 - 3 hr</p><br />
<p>- Group 3 - 5 hr</p><br />
<p>- Group 4 - 12 hr</p><br />
<p>- Group 5 - 24 hr</p><br />
<p><b>9.</b> At their respective time separate the silica pearls of bacteria by decantation</p><br />
<p><b>10.</b> Centrifugate at 5,000 rpm during 10 minutes all the corning tubes. Throw the supernatant.</p><br />
<p><b>11.</b> Weight each of the corning tubes and subtract it to the initial weight (step 1).</p><br />
<p><b>12.</b> Compare both weights (Step 5 and step 11).</p><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_unionTeam:CIDEB-UANL Mexico/math union2014-06-20T19:05:44Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_math}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<!-- MathJax (LaTeX for the web) --><br />
<script type="text/x-mathjax-config"><br />
MathJax.Hub.Config({tex2jax: {inlineMath: [['$','$'], ['\\(','\\)']]}});<br />
MathJax.Hub.Config({<br />
TeX: { <br />
equationNumbers: { autoNumber: "AMS" }<br />
}<br />
});<br />
</script><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Union Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p>The union module is based on the use of a fusion protein composed by L2 and AIDA. L2+AIDA is a protein which is not affected by external factors during its transcription, as well as its translation, so the established parameters was used with the data obtained by the team:</p><br />
<br />
<br><br />
\begin{equation}<br />
\large \frac{d\left [ mRNA \right ]}{dt}= \alpha_{1}-d_{1}\left [ mRNA \right ]<br />
\end{equation}<br />
</p><br><br />
<br />
<p>The parameters for both, the translation and transcription rate from Singapore 2008 iGEM team, were used, as well as the speeds at which <i>E. coli</i> carries out the transcription and translation, assuming a transcription speed of <i>70nt/s</i> and a translation speed of <i>40aa/s</i>. These data were used in the equations below with the L2+AIDA gene length of <i>2620nt</i> and protein length of 856aa:<br><br />
<br />
<br><br />
\begin{equation}<br />
\large \alpha_{1} = \frac{transcription speed}{gene length (nt)}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2} = \frac{translation speed}{protein length (aa)}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{1} = \frac{(70)(60)}{2620} = 1.6 <br />
\end{equation}<br><br />
<br />
\begin{equation} <br />
\large \alpha_{2} = \frac{(40)(60)}{856} = 2.8<br />
\end{equation}<br><br />
<br />
<p>Then, the parameters for degradation rates for proteins and mRNAs from Beijing PKU 2009 iGEM team were used:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large d_{1} = \frac{1}{half-life(min)} + \frac{1}{30min}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large d_{2} = \frac{1}{half-life(min)} + \frac{1}{30min} <br />
\end{equation}<br><br />
<br />
<p>Since the protein was the fusion of two, a research was needed to find out the half-life each protein separately. The half-life of membrane proteins range between 2 to 20 hours in <i>E. coli</i> (Hare, 1991), and as AIDA-I is a membrane protein its half-life must be between that range, for the specific half-life of AIDA is not determined. To find the half-life of L2, based on previous research, it was assumed that it was 7.8 hours (Bergant, 2010). Bergant’s team made a test with a homologous protein, but found in the minor capsid of the Human Papillomavirus (HPV). Although the function of the L2 strand in HPV is viral and in <i>E. coli</i> is ribosomal, both share similar structures and sequences. Once it was decided to use the half-life from the homologous L2, it was used as the half-life for the fusion protein because it was between the range of AIDA-I and also because it was the lower half-life, assuming <i>E. coli</i> starts the degradation of L2, the whole protein would be degraded. </p><br />
<p>To determine the degradation rate of average mRNA, the information from Selinger’s team (2003) was used. They carried several experiments to find out the average mRNA half-life in <i>E. coli</i>. They used mRNAs about <i>1100nt</i>, concluding they have an average half-life of 5min. So with this, the average mRNA half-life of L2+AIDA was found to be 11.9min.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large HL = \frac{1100(nt)}{5 min}<br />
\end{equation}<br><br />
<br />
<br><br />
<p>With all these information, the degradation rates for both transcription and translation of L2+AIDA were found:<br />
<br><br />
<br><br />
\begin{equation}<br />
\large d_{1} = \frac{1}{11.9} + \frac{1}{30} = 0.11<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large d_{2} = \frac{1}{468} + \frac{1}{30} = 0.035<br />
\end{equation}<br />
</p><br><br />
<br />
<p>Simbiology was used for the simulation. The previous data from the equations were used to calculate the amount of proteins <i>E. coli</i> would produce at certain times. The results obtained are shown in the following graph:</p><br />
<br />
<br><center><p><img width=535 src="https://static.igem.org/mediawiki/2014hs/0/05/Aida_total.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<br><br />
<p>For translation there was another factor that was needed to be taken into consideration, the <b><i>“f<sub>post</sub>”</i></b>, which were the posttranslational variables affecting the production of the functional protein:<br><br />
<br />
\begin{equation}<br />
\large \frac{d[P]}{dt} = \alpha_{2} \cdot[mRNA] - d_{2}[P] - f_{post}<br />
\end{equation}<br />
</p><br><br />
<br />
<p>Since the fusion protein needs to be expressed in the membrane of <i>E. coli</i>, the average velocity at which <i>E. coli</i> exports its proteins to the membrane was needed. The process by which bacteria exports its proteins are divided into three phases: the “breathing” between translation and the second phase, which is movement of a protein to the membrane, and translocation (in this phase the protein attaches to the membrane of the bacteria (Peskin, 1991)). Using this information, it was determined that <i>E. coli</i> completes these phases in an average of 5 to 6 min, depending on the protein size (Driessen, 1990). The time used was 5.5min because L2+AIDA are not too small or too big in length <i>(2620nt)</i>.</p><br />
<br />
<p>According to Ikeda y Kuroda (2011), L2 carries out an unfolding process to become functional. It was found out that the 50S ribosomal proteins L2, L3, L14, L23, L24, and L32, as well as the 30S ribosomal proteins, S12 and S18, were native premolten globules in their free forms, but adopted rigid well-folded conformations during the formation of a functional ribosome. They exhibit several amounts of ordered secondary structures; the unfolding of a protein molecule results in an essential increase in its hydrodynamic volume. For instance, there is a well-documented 15–20% increase in the hydrodynamic radius of globular proteins upon their transformation into the molten globule state (Unversky, 2002). Also, the equation from Unversky to find the L2 unfolding rate in <i>E. coli</i> was used, with the results shown below:<br />
<br />
<br><br />
<br>\begin{equation}<br />
\large [H]boundary = \frac{[R]+1.51}{2.785}<br />
\end{equation}<br />
</p><br><br />
<br />
<p>This equation gives the estimation of the "boundary" mean hydrophobicity value, <b><i>“[H]boundary”</i></b>, below which a polypeptide chain with a given net charge <b><i>“[R]”</i></b> will most probably be unfolded. Thus, sequences of natively unfolded proteins may be characterized by a low sequence complexity and/or high net charge coupled with low mean hydrophobicity (the values are specified for globular proteins). According to Ikeda and Kuroda (2011) the net charge <b><i>“[R]”</i></b> of L2 is 10.9, so we substituted it in the equation below:</p><br />
<br />
<br><br />
\begin{equation}<br />
\large [H]boundary = \frac{10.9 + 1.51}{2.785} = 4.45<br />
\end{equation}<br />
</p><br><br />
<br />
<p>With the unfolding value and the rate of membrane transport in <i>E. coli</i> we could use it in Simbiology for modelling the functional L2+AIDA production. The results obtained were the following:</p><br />
<br />
<center><p><img width=490 src="https://static.igem.org/mediawiki/2014hs/9/99/Aida_y_l2.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<center><p><img width=540 src="https://static.igem.org/mediawiki/2014hs/1/16/Nonfunctional_irre.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br><br />
<br />
<p>Comparing both graphs (<b>Graph 1</b> and <b>Graph 2</b>) we realize that although <i>E. coli</i> needs to transport the L2+AIDA proteins to its membrane, the rate at which <i>E. coli</i> does it is slower than the production of the fusion protein, but something that was noticed (and was great) is that according to Simbiology, almost all the proteins, once they are inserted in the membrane, unfold correctly leaving less than 25 nonfunctional proteins.</p><br />
<br />
<br><p><b><h2>Bibliography/References</h2></b></p><br />
<br />
<font size="2"><br />
<p>● BERGANT, Martina N. M. (2010). Modification of Human Papillomavirus Minor Capsid Protein L2 by Sumoylation. <i>Journal of Virology</i>, 11585-11589.</p><br />
<p>● DRIESSEN, Arnold W. W. (1990). Proton transfer rate-limiting for translocation of precursor proteins by the Escherichia coli translocase. <i></i>Biochemistry, 2471-2475.</p><br />
<p>● HARE, James K. T. (1991). Mechanisms of plasma membrane protein degradation: Recycling proteins are degraded more rapidly than those confined to the cell surface. <i>PNAS</i>, 5902-5906.</p><br />
<p>● IKEDA, Takeshi A. K. (2011). Why does the silica-binding protein "Si-tag" bind strongly to silica surfaces? Implications of conformational adaptation of the intrinsically disordered polypeptide to soli surfaces. <i>Colloids and Surfaces</i>, 359-363.</p><br />
<p>● PESKIN, Charles S. S. (1991). What drives the translocation of proteins. <i>Biophysics</i>, 3770-3774.</p><br />
<p>● SELINGER, Douglas R. M. (2003). Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. <i>Genome Research</i>, 216-223.</p><br />
<p>● UVERSKY, V. (2002). Natively unfolded proteins: A point where biology waits for physics. <i>Protein Science</i>, 739-756.</p><br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_union#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_resultsTeam:CIDEB-UANL Mexico/labwork results2014-06-20T18:54:33Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_labwork}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Results</h2><br />
<br />
<div class="wrapper"><br />
<center><div class="container2"><br />
<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Construction" class="button2">Biobricks construction</a><br />
<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Experiments" class="button2">Experiments</a><br />
</div></center><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<br />
<p><h2><font size="6"><b><a name="Construction"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Construction" target="_blank">Biobricks construction</a></b></font>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>Here are the results of how the team got the modules of the project</p><br />
<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Minipreps" class="button2">Minipreps</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Digestions" class="button2">Digestions</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Purifications" class="button2">Purification</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Ligations" class="button2">Ligations</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Characterization" class="button2">Characterization</a></p><br />
<br />
<p><h2><b><a name="Minipreps"></a>Minipreps</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>The first step to build up the four modules in bio-brick format with the vector pSB1C3 is to isolate the plasmid DNA from the bacteria through a mini prep.</p><br />
<p>The next electrophoresis geles (<b>Image 1</b>) shows that the extraction of the DNA was performed correctly.<br />
As in the beginning it was planned to put the four modules in vectors with different antibiotic resistance (such as pSB1C3, pSB1T3, pSB1A3 and pSB1K3) in a single <i>E. col</i>, but the team decided to first insert all of the genes in pSB1C3 so they could be sent to the parts registry.</p><br />
<center><p><img width=1000 height=400 src="https://static.igem.org/mediawiki/2014hs/2/2e/Geles_miniprep_of_all_genes_cideps.jpg" align=center hspace=12></p></center><br />
<center><p><font size="3"><b>Image 1.</b> Electrophoresis geles showing the plasmid DNA gotten from mini preps of bacteria transformed with pUC57-NhaS, pUC57-BSMT1 opt., pUC57-AIDA, pUC57-L2, pSB1C3-RFP, pSB1K3-RFP and pSB1A3-RFP.</font></p></center><br />
<br><br />
<br />
<p><b><h2><a name=Digestions></a>Digestions</b>-<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>The next step of obtaining the DNA is get only the needed fragment for the project, this would be accomplished through a digestion with the enzymes of the biobrick format: EcoRI and PstI (In the case of pSB1C3, nhaS and BSMT1 opt.). But in the case of the union module, there is a fusion protein, it means that the digestion of AIDA and L2 (parts of the fusion protein) is with other enzymes, the first with PstI and BglII, and the second with EcoRI and BamHI.</p><br />
<p>In the digestion made in order to get the plasmid pSB1C3 and the gene NhaS (<b>Image 2.</b> right gel) both were differentiated from their respective insert (RFP) and plasmid (pUC57) by its length. The plasmid stays in the upper part of the gel while the insert stays below it.</p><br />
<p>The same happened with the digestion of BSMT1 opt., AIDA and L2 (<b>Image 2.</b> left gel) the genes were differentiated by its length.</p><br />
<center><p><img width=655 height=330 src="https://static.igem.org/mediawiki/2014hs/a/ad/Important_Digestions_CIDEB_.jpg" align=center hspace=12></p><br />
<p><font size="3"><b>Image 2.</b>In the left gel: Gel of digestion of pSB1C3 (left black square) and NhaS (right black square). In the right gel: Gel of digestion of pSB1C3 (upper left square), AIDA, L2 and BMST1 opt. (In that order, the tree black squares of the right).</font></p></center><br />
<br><br />
<br />
<p><h2><b><a name="Purifications"></a>Purification</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p> There is not need of make all the purification process of the fragments gotten in the digestion, easily the ligation can be done. But to make sure that only the pieces that were wanted to ligate, were together, it was done a purification. Then to confirm that there were only the fragments such as pSB1C3, BSTM1 opt. L2 and AIDA, it was made an electrophoresis gel:</p><br />
<center><p><img width=390 height=390 src="https://static.igem.org/mediawiki/2014hs/8/82/Purification_of_all_genes_less_NhaS.jpg"align=center hspace=12></center></p><br />
<center><p><b>Image 3.</b> Electrophoresis geles of digestion after purification process after. The "M" before the first well of the gel, stands for Mark</p></center><br />
<br><br />
<br />
<p><h2><b><a name="Ligations"></a>Ligations</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>After the purification of the digestions was made, the fragments were ligated with their respective gene-plasmid. Then bacteria were transformed with those ligations and inoculated in a Petri dish obtaining the next result:</p><br />
<p><b><a name="Ligation"></a>Ligation of NhaS and pSB1C3 <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank"><font color="red">[Capture Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></p><br />
<p>In the first transformation of the ligation of NhaS and pSB1C3 grew red (expressing RFP) and white bacteria. The Petri dish was not cover by aluminum after its inoculation. </p><br />
<center><p><img width=420 height=260 src="https://static.igem.org/mediawiki/2014hs/4/43/Ligation1cideb2014.png"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 4. </b>NhaS first ligation with pSB1C3. Result of the transformation of the ligation between NhaS and pSB1C3.</font></p></center><br />
<p>There was a second transformation of the same ligation, also it was inoculated in a Petri dish getting <b>Image 5.</b> as result. There were also present red and white bacteria. The Petri dish was not cover by aluminum after its inoculation.</p><br />
<center><p><img width=420 height=260 src="https://static.igem.org/mediawiki/2014hs/4/4b/NhaS_%2B_pSB1C3_Ligation_.jpg"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 5.</b>NhaS first ligation with pSB1C3. Result of the transformation of the ligation between NhaS and pSB1C3. </font></p></center><br />
<br><br />
<p><b><a name="Ligation2"></a>Result of ligation BSMT1 (optimized) and pSB1C3 <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><font color="red">[Aroma Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></p><br />
<p>The main gene of the aroma module, BSMT1 opt. was ligated with pSB1C3, and then transformed in bacteria in order to be inoculated. In the resulting inoculation there were only white colonies of bacteria.<br />
<center><p><img width=380 src="https://static.igem.org/mediawiki/2014hs/7/7c/Aroma_%2B_pSB1C3.jpg"<br />
align=center hspace=12></center></p><br />
<center><p><font size="3"><b>Image 6.</b>Colonies obtained from the transformation of the ligation BSMT1 opt and pSB1C3. </font></p></center><br />
<br><br />
<p><h2><b><a name="Characterization"></a>Characterization</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p><b>Capture module characterization</b></p><br />
<p>Once NhaS was in pSB1C3, it was needed to prove it through a characterization, also there was the question of why in the ligation there were red and white bacteria, if all had the plasmid to chloramphenicol resistance (reason they lived). Which of the two types really had NhaS?. To know with which enzyme make the digestion, it was made a digital digestion of the plasmid and the insert getting the next result:</p><br />
<center><p><img width=470 height=330 src="https://static.igem.org/mediawiki/2014hs/a/a2/Virtual_digestion_of_NhaS_in_pSB1C3.jpg"<br />
align=center hspace=12></p><br />
<p><b>Image 7.</b> Virtual digestion of NhaS (yellow) +RFP (red) +pSB1C3 (purple) by the enzyme Arsl (blue), showing that its restriction site is repeated two times, one in NhaS and other in pSB1C3. </center></p><br />
<br><br />
<p>The problem was that the enzyme that cuts NhaS and pSB1C3 was not available to the team, and it would take a long time to get it. To solve this problem, it was sent the DNA to be sequenced and then prove that the ligation actually occurred, and NhaS was inside pSB1C3. It was used a primer that is from 5' to 3' in the complementary chain:</p><br />
<p><pre><br />
5´ATTACCGCCTTTGAGTGAGC 3'<br />
</p></pre><br />
The result of the sequencing of the mini prep of the bacteria transformed with NhaS in pSB1C3 that showed the RFP production was the next: <br />
<p><pre><br />
3' AAAGTGTCCACCCCGTACGACCGAGCGGAGCGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTAATCTTTTCGGCTTAAAGAAAAAGGGCAGGGTGGTGACA<br />
CCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTATATAAACGCAGAAAGGCCCACCCGAAGGTGAGCCAGTGTGACTCTAGTAGAGAGCGTTCACCGACAAA<br />
CAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCTCTAGTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGT<br />
GGAGTGACGACCTTCAGCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACC<br />
GGTTTTTTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGAGCACCGTCTTCCGGGTACA<br />
TACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTG<br />
CAGGGAGGAGTCCTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCCG<br />
GGTGTTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGAACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTTCAGTTTAGCGGTCTCGGGTA<br />
CCTTCGAACGGACGACCTTCACCTTCACCCTTCAATTTTCAAACTCGTGACCGTAAACGGAACCTTTCCATACAACTTTGAAAACGCATGAAACTCATTTGAATAACGTCT<br />
TCCGGAAGAAAGCCCAATCTAAGTATTTTCTCCCTCTTTTCTCATATAAATGTGATGAATATTTGATCTATCCGCCCTCCAACAACTTTCCCACAACAATCATGTATCGAAAT<br />
TCCTGTTATACGACACTATAAAGATGGTATAAAAAGCCCGTGGAGGGGGCGTGACCA 5'<br />
</pre></p><br />
<br><br />
<p>And this is the sequence obtained from the miniPrep of the white bacteria transformed with NhaS:</p><br />
<p><pre><br />
3' TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACCTGCATAACGC<br />
GAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACT<br />
AGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTACCTTCAGCACGTTCGTACTGTTCA<br />
ACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTT<br />
TTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTC<br />
AGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGAC<br />
GGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACA<br />
CCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCC<br />
GGGTGTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTG<br />
GTAACTTTCAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTT<br />
AACGGAACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTCGCTTAC<br />
AAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTTTGCCATGCAGATT<br />
CCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGTAA 5'<br />
</pre></p><br />
<br><br />
<p><b>Aroma module characterization</b></p><br />
<p>To characterize the aroma module, the process of sequencing was made too</p><br />
<p><pre><br />
3' TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACCTGCATAACGC<br />
GAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACT<br />
AGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTACCTTCAGCACGTTCGTACTGTTCA<br />
ACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTT<br />
TTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTC<br />
AGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGAC<br />
GGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACA<br />
CCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCC<br />
GGGTGTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTG<br />
GTAACTTTCAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTT<br />
AACGGAACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTCGCTTAC<br />
AAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTTTGCCATGCAGATT<br />
CCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGTAA 5'<br />
</pre><p><br />
<br><br />
<p><h2><font size="6"><b><a name="Experiments"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Experiments" target="_blank">Experiments</a></b></font>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>It is needed to characterize and prove the modules, here are the results of the experiments made in order to accomplish it.</p><br />
<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#UV" class="button2">Capture</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#AromaRe1" class="button2">Aroma</a></p><br />
<br />
<p><h2><b><a name="UV"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#UVExp" target="_blank">UV Experimentation </a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p>During 2 hours the four Petri dishes were exposed to UV irradiation. None of them showed any change. </p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/7/75/First_UV_irradiation_Experiment.jpg"<br />
align=center hspace=12></p><br />
<p><font size="2"><b>Image 8.</b>Petri Dish inoculated with NhaS in pSB1C3 exposed to UV irradiation at 302 nm. Before, no time being exposed (left) and after 2 hours of being exposed (right). </font></p></center><br />
<br />
<br />
<p><b><a name="RepetitionUV"></a>Repetition UV Experimentation </b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></p><br />
<br />
<p>Two Petri dishes inoculated by streak: One with NhaS Red and the other with NhaS White. Both exposed during 30 minutes to UV irradiation at 302 nm and none of them showed any change. </p><br />
<p>With no time exposed to UV irradiation: <br />
</p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/1/18/Before_NhaS_Video.jpg"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 9.</b>Nhas in pSB1C3 before being exposed to UV irradiation. </font></p></center><br />
<br />
<p>After 30 minutes: <br />
</p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/a/a6/After_NhaS_Video_.jpg"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 10.</b>Nhas in pSB1C3 before being exposed to UV irradiation. </font></p></center><br />
<br />
<br />
<br />
<p><h2><b><a name="Salt1"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Viability" target="_blank">Viability test of the NhaS gene containing bacteria in salt</a> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank"><font color="red">[Capture Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p><b> Experiment #1</b></p><br />
<br />
<p>Bacteria transformed with the capture plasmid were inoculated in Petri dishes with different concentrations of salt</p><br />
<br />
<center><p><img width=380 height=260 src="https://static.igem.org/mediawiki/2014hs/e/e2/Rojas_NhaS_experiment_1.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="3"><b>Image 11. </b>All the 18 Petri dishes inoculated with NhaS Red in pSB1C3 of all the 9 used concentrations.</font></p></center><br />
<br><br />
<br />
<center><p><img width=380 height=260 src="https://static.igem.org/mediawiki/2014hs/2/28/Blancas_NhaS_experimen_1.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="3"><b>Image 12. </b>All the 18 Petri dishes inoculated with NhaS White in pSB1C3 of all the 9 used concentrations.</font></p></center><br />
<br><br />
<br />
<center><p><img width=380 height=260 src="https://static.igem.org/mediawiki/2014hs/1/12/Control_Expriment_1_NhaS_.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="3"><b>Image 13. </b>All the 18 Petri dishes inoculated with the Control bacteria of all the 9 used concentrations.</font></p></center><br />
<p>All the bacteria containing the NhaS in pSB1C3 (Red and White) survived to a 10% concentration of salt.</p> <br />
<p>None of the control group lived in any concentration of salt.</p><br />
<br><br />
<br />
<center><p><img width=262 height=403 src="https://static.igem.org/mediawiki/2014hs/2/28/Experiment_1_Maximum_concentration_of_salt..jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="3"><b>Image 14. </b>Nine Petri dishes with the maximum concentration of salt (10%) used in this experiment. From up to bottom: NhaS Red in pSB1C3, NhaS White in pSB1C3 and the Control bacteria.</font></p></center> <br />
<br><br />
<br />
<p>The first time the experiment one was performed, bacteria transformed with the capture plasmid were inoculated in Petri dishes with different concentrations of salt, but this time the mayor concentration is higher (15%) </p><p><br />
All the bacteria transformed with NhaS in pSB1C3 (Red and White) lived in the 15% saline medium. </p><p><br />
All the control bacteria exposed to any concentration of salt died.</p><p><br />
All the control bacteria inoculated only in LB medium (without salt) lived. <br />
</p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/7/75/Max_concentration_od_salt_experiment_2_.jpg"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 15. </b>In the upper left part NhaS Red in pSB1C3 at 15% of salt. In the upper right part NhaS Whit in pSB1C3 at 15% of salt. In the lower left part the Control bacteria at 15% of salt. In the lower right part the Control bacteria with only LB medium (without salt) </font></p></center> <br />
<br><br />
<br />
<p><b><a name="Salt2"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Viability" target="_blank">Experiment #2</a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p>In the experiment #1, it was proved that the NhaS transformed bacteria (red and white) survived to a saline environment with LB agar. Then it order to know if it would survive only in a saline medium, it was designed a second experiment where the bacteria was inoculated in erlenmeyer flasks with only salty water at different concentrations (1%, 2.5% 5%, 10% and 15%). None of all the inoculated erlenmeyer flasks was murky, it means that all of the bacteria was dead.</p><br />
<br><br />
<p><b>Experiment # 3</b></p><br />
<p>AQUI D: </p><br />
<br><br />
<p><h2><b><a name="AromaRe1"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#AromaExp" target="_blank"> Aroma Qualitative Experiments</a> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><font color="red">[Aroma Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p><b>Experiment 1 - Test tubes</b></p><br />
<br />
<p> AQUI S; </p><br />
<br />
<p><b>Experiment 2 - Petri dishes</b></p><br />
<p>Random people were chosen to smell our bacteria, four people per each concentration. The experiment was performed with three different concentrations of salicylic acid, which were of 10 mM, 20 mM, and 30 mM. All of the samples contained salicylic acid. There was a controlled group grown bellow and above the 32 ºC and a group with transformed bacteria with the Aroma module, also grown bellow and above the 32 ºC; per each concentration. </p><br />
<p>Those are the words that people used to repeat, or synonyms of what the said, because all the opinions were described in a different way. </p><br />
<br />
<center><table style="background-color:#FFFFFF" width="80%" cellpadding="2"><br />
<tr style='background-color:#3C3C3C'><br />
<td></td><br />
<td><font color="#FFFFFF"><b>Controlled Group Below 32 ºC</b></font></td><br />
<td><font color="#FFFFFF"><b>Group Below 32 ºC</b></font></td><br />
<td><font color="#FFFFFF"><b>Controlled Group Above 32 ºC</b></font></td><br />
<td><font color="#FFFFFF"><b>Group Above 32 ºC</b></font></td><br />
</tr><br />
<tr><br />
<td style='background-color:#3C3C3C'><font color="#FFFFFF"><b>10 mM</b></font></td><br />
<td>Corn</td><br />
<td>Rotten food but with a fresh scent</td><br />
<td>Rotten food</td><br />
<td>Ointment or a very Fresh Scent</td><br />
</tr><br />
<tr><br />
<td style='background-color:#3C3C3C'><font color="#FFFFFF"><b>20 mM</b></font></td><br />
<td>Rotten food</td><br />
<td>A little bit fresh</td><br />
<td>Rotten food</td><br />
<td>Household product. (Fresh)</td><br />
</tr><br />
<tr><br />
<td style='background-color:#3C3C3C'><font color="#FFFFFF"><b>30 mM</b></font></td><br />
<td>Rotten food</td><br />
<td>Rotten food</td><br />
<td>Rotten food</td><br />
<td>Rotten food</td><br />
</tr><br />
</table></center><br />
<br><br />
<br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/b/bf/People_smelling_aroma_bacteria.jpg"<br />
align=center hspace=12></p><br />
<p><font size="2"><b>Image 12. </b>People smelling the different Petri dishes previously inoculated with the bacteria transformed with the aroma module in order to describe the odor they perceive. </font></p></center> <br />
<br />
<p><b>Qualitative Aroma experimentation in petri dishes</b></p> <br />
<center><iframe width="640" height="390" src="//www.youtube.com/embed/IeMDPOI8kXk" frameborder="0" allowfullscreen></iframe></center><br />
<br />
<div style="text-align: left;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_discussions#AromaInt"><font size="2" color="blue">Go to Results Interpretations</font></a></p></div><br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_resultsTeam:CIDEB-UANL Mexico/labwork results2014-06-20T18:50:10Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_labwork}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Results</h2><br />
<br />
<div class="wrapper"><br />
<center><div class="container2"><br />
<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Construction" class="button2">Biobricks construction</a><br />
<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Experiments" class="button2">Experiments</a><br />
</div></center><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<br />
<p><h2><font size="6"><b><a name="Construction"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Construction" target="_blank">Biobricks construction</a></b></font>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>Here are the results of how the team got the modules of the project</p><br />
<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Minipreps" class="button2">Minipreps</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Digestions" class="button2">Digestions</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Purifications" class="button2">Purification</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Ligations" class="button2">Ligations</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Characterization" class="button2">Characterization</a></p><br />
<br />
<p><h2><b><a name="Minipreps"></a>Minipreps</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>The first step to build up the four modules in bio-brick format with the vector pSB1C3 is to isolate the plasmid DNA from the bacteria through a mini prep.</p><br />
<p>The next electrophoresis geles (<b>Image 1</b>) shows that the extraction of the DNA was performed correctly.<br />
As in the beginning it was planned to put the four modules in vectors with different antibiotic resistance (such as pSB1C3, pSB1T3, pSB1A3 and pSB1K3) in a single <i>E. col</i>, but the team decided to first insert all of the genes in pSB1C3 so they could be sent to the parts registry.</p><br />
<center><p><img width=1000 height=400 src="https://static.igem.org/mediawiki/2014hs/2/2e/Geles_miniprep_of_all_genes_cideps.jpg" align=center hspace=12></p></center><br />
<center><p><font size="3"><b>Image 1.</b> Electrophoresis geles showing the plasmid DNA gotten from mini preps of bacteria transformed with pUC57-NhaS, pUC57-BSMT1 opt., pUC57-AIDA, pUC57-L2, pSB1C3-RFP, pSB1K3-RFP and pSB1A3-RFP.</font></p></center><br />
<br><br />
<br />
<p><b><h2><a name=Digestions></a>Digestions</b>-<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>The next step of obtaining the DNA is get only the needed fragment for the project, this would be accomplished through a digestion with the enzymes of the biobrick format: EcoRI and PstI (In the case of pSB1C3, nhaS and BSMT1 opt.). But in the case of the union module, there is a fusion protein, it means that the digestion of AIDA and L2 (parts of the fusion protein) is with other enzymes, the first with PstI and BglII, and the second with EcoRI and BamHI.</p><br />
<p>In the digestion made in order to get the plasmid pSB1C3 and the gene NhaS (<b>Image 2.</b> right gel) both were differentiated from their respective insert (RFP) and plasmid (pUC57) by its length. The plasmid stays in the upper part of the gel while the insert stays below it.</p><br />
<p>The same happened with the digestion of BSMT1 opt., AIDA and L2 (<b>Image 2.</b> left gel) the genes were differentiated by its length.</p><br />
<center><p><img width=655 height=330 src="https://static.igem.org/mediawiki/2014hs/a/ad/Important_Digestions_CIDEB_.jpg" align=center hspace=12></p><br />
<p><font size="3"><b>Image 2.</b>In the left gel: Gel of digestion of pSB1C3 (left black square) and NhaS (right black square). In the right gel: Gel of digestion of pSB1C3 (upper left square), AIDA, L2 and BMST1 opt. (In that order, the tree black squares of the right).</font></p></center><br />
<br><br />
<br />
<p><h2><b><a name="Purifications"></a>Purification</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p> There is not need of make all the purification process of the fragments gotten in the digestion, easily the ligation can be done. But to make sure that only the pieces that were wanted to ligate, were together, it was done a purification. Then to confirm that there were only the fragments such as pSB1C3, BSTM1 opt. L2 and AIDA, it was made an electrophoresis gel:</p><br />
<center><p><img width=390 height=390 src="https://static.igem.org/mediawiki/2014hs/8/82/Purification_of_all_genes_less_NhaS.jpg"align=center hspace=12></center></p><br />
<center><p><b>Image 3.</b> Electrophoresis geles of digestion after purification process after. The "M" before the first well of the gel, stands for Mark</p></center><br />
<br><br />
<br />
<p><h2><b><a name="Ligations"></a>Ligations</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>After the purification of the digestions was made, the fragments were ligated with their respective gene-plasmid. Then bacteria were transformed with those ligations and inoculated in a Petri dish obtaining the next result:</p><br />
<p><b><a name="Ligation"></a>Ligation of NhaS and pSB1C3 <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank"><font color="red">[Capture Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></p><br />
<p>In the first transformation of the ligation of NhaS and pSB1C3 grew red (expressing RFP) and white bacteria. The Petri dish was not cover by aluminum after its inoculation. </p><br />
<center><p><img width=420 height=260 src="https://static.igem.org/mediawiki/2014hs/4/43/Ligation1cideb2014.png"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 4. </b>NhaS first ligation with pSB1C3. Result of the transformation of the ligation between NhaS and pSB1C3.</font></p></center><br />
<p>There was a second transformation of the same ligation, also it was inoculated in a Petri dish getting <b>Image 5.</b> as result. There were also present red and white bacteria. The Petri dish was not cover by aluminum after its inoculation.</p><br />
<center><p><img width=420 height=260 src="https://static.igem.org/mediawiki/2014hs/4/4b/NhaS_%2B_pSB1C3_Ligation_.jpg"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 5.</b>NhaS first ligation with pSB1C3. Result of the transformation of the ligation between NhaS and pSB1C3. </font></p></center><br />
<br><br />
<p><b><a name="Ligation2"></a>Result of ligation BSMT1 (optimized) and pSB1C3 <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><font color="red">[Aroma Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></p><br />
<p>The main gene of the aroma module, BSMT1 opt. was ligated with pSB1C3, and then transformed in bacteria in order to be inoculated. In the resulting inoculation there were only white colonies of bacteria.<br />
<center><p><img width=380 src="https://static.igem.org/mediawiki/2014hs/7/7c/Aroma_%2B_pSB1C3.jpg"<br />
align=center hspace=12></center></p><br />
<center><p><font size="3"><b>Image 6.</b>Colonies obtained from the transformation of the ligation BSMT1 opt and pSB1C3. </font></p></center><br />
<br><br />
<p><h2><b><a name="Characterization"></a>Characterization</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p><b>Capture module characterization</b></p><br />
<p>Once NhaS was in pSB1C3, it was needed to prove it through a characterization, also there was the question of why in the ligation there were red and white bacteria, if all had the plasmid to chloramphenicol resistance (reason they lived). Which of the two types really had NhaS?. To know with which enzyme make the digestion, it was made a digital digestion of the plasmid and the insert getting the next result:</p><br />
<center><p><img width=470 height=330 src="https://static.igem.org/mediawiki/2014hs/a/a2/Virtual_digestion_of_NhaS_in_pSB1C3.jpg"<br />
align=center hspace=12></p><br />
<p><b>Image 7.</b> Virtual digestion of NhaS (yellow) +RFP (red) +pSB1C3 (purple) by the enzyme Arsl (blue), showing that its restriction site is repeated two times, one in NhaS and other in pSB1C3. </center></p><br />
<br><br />
<p>The problem was that the enzyme that cuts NhaS and pSB1C3 was not available to the team, and it would take a long time to get it. To solve this problem, it was sent the DNA to be sequenced and then prove that the ligation actually occurred, and NhaS was inside pSB1C3. It was used a primer that is from 5' to 3' in the complementary chain:</p><br />
<p><pre><br />
5´ATTACCGCCTTTGAGTGAGC 3'<br />
</p></pre><br />
The result of the sequencing of the mini prep of the bacteria transformed with NhaS in pSB1C3 that showed the RFP production was the next: <br />
<p><pre><br />
3' AAAGTGTCCACCCCGTACGACCGAGCGGAGCGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTAATCTTTTCGGCTTAAAGAAAAAGGGCAGGGTGGTGACA<br />
CCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTATATAAACGCAGAAAGGCCCACCCGAAGGTGAGCCAGTGTGACTCTAGTAGAGAGCGTTCACCGACAAA<br />
CAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCTCTAGTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGT<br />
GGAGTGACGACCTTCAGCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACC<br />
GGTTTTTTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGAGCACCGTCTTCCGGGTACA<br />
TACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTG<br />
CAGGGAGGAGTCCTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCCG<br />
GGTGTTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGAACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTTCAGTTTAGCGGTCTCGGGTA<br />
CCTTCGAACGGACGACCTTCACCTTCACCCTTCAATTTTCAAACTCGTGACCGTAAACGGAACCTTTCCATACAACTTTGAAAACGCATGAAACTCATTTGAATAACGTCT<br />
TCCGGAAGAAAGCCCAATCTAAGTATTTTCTCCCTCTTTTCTCATATAAATGTGATGAATATTTGATCTATCCGCCCTCCAACAACTTTCCCACAACAATCATGTATCGAAAT<br />
TCCTGTTATACGACACTATAAAGATGGTATAAAAAGCCCGTGGAGGGGGCGTGACCA 5'<br />
</pre></p><br />
<br><br />
<p>And this is the sequence obtained from the miniPrep of the white bacteria transformed with NhaS:</p><br />
<p><pre><br />
3' TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACCTGCATAACGC<br />
GAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACT<br />
AGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTACCTTCAGCACGTTCGTACTGTTCA<br />
ACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTT<br />
TTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTC<br />
AGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGAC<br />
GGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACA<br />
CCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCC<br />
GGGTGTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTG<br />
GTAACTTTCAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTT<br />
AACGGAACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTCGCTTAC<br />
AAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTTTGCCATGCAGATT<br />
CCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGTAA 5'<br />
</pre></p><br />
<br><br />
<p><b>Aroma module characterization</b></p><br />
<p>To characterize the aroma module, the process of sequencing was made too</p><br />
<p><pre><br />
3' TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACCTGCATAACGC<br />
GAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACT<br />
AGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTACCTTCAGCACGTTCGTACTGTTCA<br />
ACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTT<br />
TTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTC<br />
AGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGAC<br />
GGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACA<br />
CCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCC<br />
GGGTGTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTG<br />
GTAACTTTCAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTT<br />
AACGGAACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTCGCTTAC<br />
AAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTTTGCCATGCAGATT<br />
CCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGTAA 5'<br />
</pre><p><br />
<br><br />
<p><h2><font size="6"><b><a name="Experiments"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Experiments" target="_blank">Experiments</a></b></font>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>It is needed to characterize and prove the modules, here are the results of the experiments made in order to accomplish it.</p><br />
<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#UV" class="button2">Capture</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#AromaRe1" class="button2">Aroma</a></p><br />
<br />
<p><h2><b><a name="UV"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#UVExp" target="_blank">UV Experimentation </a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p>During 2 hours the four Petri dishes were exposed to UV irradiation. None of them showed any change. </p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/7/75/First_UV_irradiation_Experiment.jpg"<br />
align=center hspace=12></p><br />
<p><font size="2"><b>Image 8.</b>Petri Dish inoculated with NhaS in pSB1C3 exposed to UV irradiation at 302 nm. Before, no time being exposed (left) and after 2 hours of being exposed (right). </font></p></center><br />
<br />
<br />
<p><b><a name="RepetitionUV"></a>Repetition UV Experimentation </b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></p><br />
<br />
<p>Two Petri dishes inoculated by streak: One with NhaS Red and the other with NhaS White. Both exposed during 30 minutes to UV irradiation at 302 nm and none of them showed any change. </p><br />
<p>With no time exposed to UV irradiation: <br />
</p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/1/18/Before_NhaS_Video.jpg"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 9.</b>Nhas in pSB1C3 before being exposed to UV irradiation. </font></p></center><br />
<br />
<p>After 30 minutes: <br />
</p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/a/a6/After_NhaS_Video_.jpg"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 10.</b>Nhas in pSB1C3 before being exposed to UV irradiation. </font></p></center><br />
<br />
<br />
<br />
<p><h2><b><a name="Salt1"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Viability" target="_blank">Viability test of the NhaS gene containing bacteria in salt</a> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank"><font color="red">[Capture Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p><b> Experiment #1</b></p><br />
<br />
<p>Bacteria transformed with the capture plasmid were inoculated in Petri dishes with different concentrations of salt</p><br />
<br />
<center><p><img width=380 height=260 src="https://static.igem.org/mediawiki/2014hs/e/e2/Rojas_NhaS_experiment_1.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="3"><b>Image 11. </b>All the 18 Petri dishes inoculated with NhaS Red in pSB1C3 of all the 9 used concentrations.</font></p></center><br />
<br><br />
<br />
<center><p><img width=380 height=260 src="https://static.igem.org/mediawiki/2014hs/2/28/Blancas_NhaS_experimen_1.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="3"><b>Image 12. </b>All the 18 Petri dishes inoculated with NhaS White in pSB1C3 of all the 9 used concentrations.</font></p></center><br />
<br><br />
<br />
<center><p><img width=380 height=260 src="https://static.igem.org/mediawiki/2014hs/1/12/Control_Expriment_1_NhaS_.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="3"><b>Image 13. </b>All the 18 Petri dishes inoculated with the Control bacteria of all the 9 used concentrations.</font></p></center><br />
<p>All the bacteria containing the NhaS in pSB1C3 (Red and White) survived to a 10% concentration of salt.</p> <br />
<p>None of the control group lived in any concentration of salt.</p><br />
<br><br />
<br />
<center><p><img width=262 height=403 src="https://static.igem.org/mediawiki/2014hs/2/28/Experiment_1_Maximum_concentration_of_salt..jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="3"><b>Image 14. </b>Nine Petri dishes with the maximum concentration of salt (10%) used in this experiment. From up to bottom: NhaS Red in pSB1C3, NhaS White in pSB1C3 and the Control bacteria.</font></p></center> <br />
<br><br />
<br />
<p>The first time the experiment one was performed, bacteria transformed with the capture plasmid were inoculated in Petri dishes with different concentrations of salt, but this time the mayor concentration is higher (15%) </p><p><br />
All the bacteria transformed with NhaS in pSB1C3 (Red and White) lived in the 15% saline medium. </p><p><br />
All the control bacteria exposed to any concentration of salt died.</p><p><br />
All the control bacteria inoculated only in LB medium (without salt) lived. <br />
</p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/7/75/Max_concentration_od_salt_experiment_2_.jpg"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 15. </b>In the upper left part NhaS Red in pSB1C3 at 15% of salt. In the upper right part NhaS Whit in pSB1C3 at 15% of salt. In the lower left part the Control bacteria at 15% of salt. In the lower right part the Control bacteria with only LB medium (without salt) </font></p></center> <br />
<br><br />
<br />
<p><b><a name="Salt2"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Viability" target="_blank">Experiment #2</a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p>In the experiment #1, it was proved that the NhaS transformed bacteria (red and white) survived to a saline environment with LB agar. Then it order to know if it would survive only in a saline medium, it was designed a second experiment where the bacteria was inoculated in erlenmeyer flasks with only salty water at different concentrations (1%, 2.5% 5%, 10% and 15%). None of all the inoculated erlenmeyer flasks was murky, it means that all of the bacteria was dead.</p><br />
<br><br />
<p><b>Experiment # 3</b></p><br />
<p>AQUI D: </p><br />
<br><br />
<p><h2><b><a name="AromaRe1"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#AromaExp" target="_blank"> Aroma Qualitative Experiments</a> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><font color="red">[Aroma Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p><b>Experiment 1 - Test tubes</b></p><br />
<br />
<p> AQUI S; </p><br />
<br />
<p><b>Experiment 2 - Petri dishes</b></p><br />
<p>Random people were chosen to smell our bacteria, four people per each concentration. The experiment was performed with three different concentrations of salicylic acid, which were of 10 mM, 20 mM, and 30 mM. All of the samples contained salicylic acid. There was a controlled group grown bellow and above the 32 ºC and a group with transformed bacteria with the Aroma module, also grown bellow and above the 32 ºC; per each concentration. </p><br />
<p>Those are the words that people used to repeat, or synonyms of what the said, because all the opinions were described in a different way. </p><br />
<br />
<center><table style="background-color:#FFFFFF" width="80%" cellpadding="2"><br />
<tr style='background-color:#3C3C3C'><br />
<td></td><br />
<td><font color="#FFFFFF"><b>Controlled Group Below 32 ºC</b></font></td><br />
<td><font color="#FFFFFF"><b>Group Below 32 ºC</b></font></td><br />
<td><font color="#FFFFFF"><b>Controlled Group Above 32 ºC</b></font></td><br />
<td><font color="#FFFFFF"><b>Group Above 32 ºC</b></font></td><br />
</tr><br />
<tr><br />
<td style='background-color:#3C3C3C'><font color="#FFFFFF"><b>10 mM</b></font></td><br />
<td>Corn</td><br />
<td>Rotten food but with a fresh scent</td><br />
<td>Rotten food</td><br />
<td>Ointment or a very Fresh Scent</td><br />
</tr><br />
<tr><br />
<td style='background-color:#3C3C3C'><font color="#FFFFFF"><b>20 mM</b></font></td><br />
<td>Rotten food</td><br />
<td>A little bit fresh</td><br />
<td>Rotten food</td><br />
<td>Household product. (Fresh)</td><br />
</tr><br />
<tr><br />
<td style='background-color:#3C3C3C'><font color="#FFFFFF"><b>30 mM</b></font></td><br />
<td>Rotten food</td><br />
<td>Rotten food</td><br />
<td>Rotten food</td><br />
<td>Rotten food</td><br />
</tr><br />
</table></center><br />
<br><br />
<br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/b/bf/People_smelling_aroma_bacteria.jpg"<br />
align=center hspace=12></p><br />
<p><font size="2"><b>Image 12. </b>People smelling the different Petri dishes previously inoculated with the bacteria transformed with the aroma module in order to describe the odor they perceive. </font></p></center> <br />
<br />
<div style="text-align: left;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_discussions#AromaInt"><font size="2" color="blue">Go to Results Interpretations</font></a></p></div><br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_resultsTeam:CIDEB-UANL Mexico/labwork results2014-06-20T18:48:34Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_labwork}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Results</h2><br />
<br />
<div class="wrapper"><br />
<center><div class="container2"><br />
<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Construction" class="button2">Biobricks construction</a><br />
<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Experiments" class="button2">Experiments</a><br />
</div></center><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<br />
<p><h2><font size="6"><b><a name="Construction"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Construction" target="_blank">Biobricks construction</a></b></font>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>Here are the results of how the team got the modules of the project</p><br />
<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Minipreps" class="button2">Minipreps</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Digestions" class="button2">Digestions</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Purifications" class="button2">Purification</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Ligations" class="button2">Ligations</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Characterization" class="button2">Characterization</a></p><br />
<br />
<p><h2><b><a name="Minipreps"></a>Minipreps</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>The first step to build up the four modules in bio-brick format with the vector pSB1C3 is to isolate the plasmid DNA from the bacteria through a mini prep.</p><br />
<p>The next electrophoresis geles (<b>Image 1</b>) shows that the extraction of the DNA was performed correctly.<br />
As in the beginning it was planned to put the four modules in vectors with different antibiotic resistance (such as pSB1C3, pSB1T3, pSB1A3 and pSB1K3) in a single <i>E. col</i>, but the team decided to first insert all of the genes in pSB1C3 so they could be sent to the parts registry.</p><br />
<center><p><img width=1000 height=400 src="https://static.igem.org/mediawiki/2014hs/2/2e/Geles_miniprep_of_all_genes_cideps.jpg" align=center hspace=12></p></center><br />
<center><p><font size="3"><b>Image 1.</b> Electrophoresis geles showing the plasmid DNA gotten from mini preps of bacteria transformed with pUC57-NhaS, pUC57-BSMT1 opt., pUC57-AIDA, pUC57-L2, pSB1C3-RFP, pSB1K3-RFP and pSB1A3-RFP.</font></p></center><br />
<br><br />
<br />
<p><b><h2><a name=Digestions></a>Digestions</b>-<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>The next step of obtaining the DNA is get only the needed fragment for the project, this would be accomplished through a digestion with the enzymes of the biobrick format: EcoRI and PstI (In the case of pSB1C3, nhaS and BSMT1 opt.). But in the case of the union module, there is a fusion protein, it means that the digestion of AIDA and L2 (parts of the fusion protein) is with other enzymes, the first with PstI and BglII, and the second with EcoRI and BamHI.</p><br />
<p>In the digestion made in order to get the plasmid pSB1C3 and the gene NhaS (<b>Image 2.</b> right gel) both were differentiated from their respective insert (RFP) and plasmid (pUC57) by its length. The plasmid stays in the upper part of the gel while the insert stays below it.</p><br />
<p>The same happened with the digestion of BSMT1 opt., AIDA and L2 (<b>Image 2.</b> left gel) the genes were differentiated by its length.</p><br />
<center><p><img width=655 height=330 src="https://static.igem.org/mediawiki/2014hs/a/ad/Important_Digestions_CIDEB_.jpg" align=center hspace=12></p><br />
<p><font size="3"><b>Image 2.</b>In the left gel: Gel of digestion of pSB1C3 (left black square) and NhaS (right black square). In the right gel: Gel of digestion of pSB1C3 (upper left square), AIDA, L2 and BMST1 opt. (In that order, the tree black squares of the right).</font></p></center><br />
<br><br />
<br />
<p><h2><b><a name="Purifications"></a>Purification</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p> There is not need of make all the purification process of the fragments gotten in the digestion, easily the ligation can be done. But to make sure that only the pieces that were wanted to ligate, were together, it was done a purification. Then to confirm that there were only the fragments such as pSB1C3, BSTM1 opt. L2 and AIDA, it was made an electrophoresis gel:</p><br />
<center><p><img width=390 height=390 src="https://static.igem.org/mediawiki/2014hs/8/82/Purification_of_all_genes_less_NhaS.jpg"align=center hspace=12></center></p><br />
<center><p><b>Image 3.</b> Electrophoresis geles of digestion after purification process after. The "M" before the first well of the gel, stands for Mark</p></center><br />
<br><br />
<br />
<p><h2><b><a name="Ligations"></a>Ligations</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>After the purification of the digestions was made, the fragments were ligated with their respective gene-plasmid. Then bacteria were transformed with those ligations and inoculated in a Petri dish obtaining the next result:</p><br />
<p><b><a name="Ligation"></a>Ligation of NhaS and pSB1C3 <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank"><font color="red">[Capture Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></p><br />
<p>In the first transformation of the ligation of NhaS and pSB1C3 grew red (expressing RFP) and white bacteria. The Petri dish was not cover by aluminum after its inoculation. </p><br />
<center><p><img width=420 height=260 src="https://static.igem.org/mediawiki/2014hs/4/43/Ligation1cideb2014.png"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 4. </b>NhaS first ligation with pSB1C3. Result of the transformation of the ligation between NhaS and pSB1C3.</font></p></center><br />
<p>There was a second transformation of the same ligation, also it was inoculated in a Petri dish getting <b>Image 5.</b> as result. There were also present red and white bacteria. The Petri dish was not cover by aluminum after its inoculation.</p><br />
<center><p><img width=420 height=260 src="https://static.igem.org/mediawiki/2014hs/4/4b/NhaS_%2B_pSB1C3_Ligation_.jpg"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 5.</b>NhaS first ligation with pSB1C3. Result of the transformation of the ligation between NhaS and pSB1C3. </font></p></center><br />
<br><br />
<p><b><a name="Ligation2"></a>Result of ligation BSMT1 (optimized) and pSB1C3 <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><font color="red">[Aroma Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></p><br />
<p>The main gene of the aroma module, BSMT1 opt. was ligated with pSB1C3, and then transformed in bacteria in order to be inoculated. In the resulting inoculation there were only white colonies of bacteria.<br />
<center><p><img width=380 src="https://static.igem.org/mediawiki/2014hs/7/7c/Aroma_%2B_pSB1C3.jpg"<br />
align=center hspace=12></center></p><br />
<center><p><font size="3"><b>Image 6.</b>Colonies obtained from the transformation of the ligation BSMT1 opt and pSB1C3. </font></p></center><br />
<br><br />
<p><h2><b><a name="Characterization"></a>Characterization</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p><b>Capture module characterization</b></p><br />
<p>Once NhaS was in pSB1C3, it was needed to prove it through a characterization, also there was the question of why in the ligation there were red and white bacteria, if all had the plasmid to chloramphenicol resistance (reason they lived). Which of the two types really had NhaS?. To know with which enzyme make the digestion, it was made a digital digestion of the plasmid and the insert getting the next result:</p><br />
<center><p><img width=470 height=330 src="https://static.igem.org/mediawiki/2014hs/a/a2/Virtual_digestion_of_NhaS_in_pSB1C3.jpg"<br />
align=center hspace=12></p><br />
<p><b>Image 7.</b> Virtual digestion of NhaS (yellow) +RFP (red) +pSB1C3 (purple) by the enzyme Arsl (blue), showing that its restriction site is repeated two times, one in NhaS and other in pSB1C3. </center></p><br />
<br><br />
<p>The problem was that the enzyme that cuts NhaS and pSB1C3 was not available to the team, and it would take a long time to get it. To solve this problem, it was sent the DNA to be sequenced and then prove that the ligation actually occurred, and NhaS was inside pSB1C3. It was used a primer that is from 5' to 3' in the complementary chain:</p><br />
<p><pre><br />
5´ATTACCGCCTTTGAGTGAGC 3'<br />
</p></pre><br />
The result of the sequencing of the mini prep of the bacteria transformed with NhaS in pSB1C3 that showed the RFP production was the next: <br />
<p><pre><br />
3' AAAGTGTCCACCCCGTACGACCGAGCGGAGCGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTAATCTTTTCGGCTTAAAGAAAAAGGGCAGGGTGGTGACA<br />
CCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTATATAAACGCAGAAAGGCCCACCCGAAGGTGAGCCAGTGTGACTCTAGTAGAGAGCGTTCACCGACAAA<br />
CAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCTCTAGTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGT<br />
GGAGTGACGACCTTCAGCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACC<br />
GGTTTTTTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGAGCACCGTCTTCCGGGTACA<br />
TACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTG<br />
CAGGGAGGAGTCCTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCCG<br />
GGTGTTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGAACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTTCAGTTTAGCGGTCTCGGGTA<br />
CCTTCGAACGGACGACCTTCACCTTCACCCTTCAATTTTCAAACTCGTGACCGTAAACGGAACCTTTCCATACAACTTTGAAAACGCATGAAACTCATTTGAATAACGTCT<br />
TCCGGAAGAAAGCCCAATCTAAGTATTTTCTCCCTCTTTTCTCATATAAATGTGATGAATATTTGATCTATCCGCCCTCCAACAACTTTCCCACAACAATCATGTATCGAAAT<br />
TCCTGTTATACGACACTATAAAGATGGTATAAAAAGCCCGTGGAGGGGGCGTGACCA 5'<br />
</pre></p><br />
<br><br />
<p>And this is the sequence obtained from the miniPrep of the white bacteria transformed with NhaS:</p><br />
<p><pre><br />
3' TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACCTGCATAACGC<br />
GAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACT<br />
AGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTACCTTCAGCACGTTCGTACTGTTCA<br />
ACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTT<br />
TTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTC<br />
AGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGAC<br />
GGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACA<br />
CCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCC<br />
GGGTGTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTG<br />
GTAACTTTCAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTT<br />
AACGGAACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTCGCTTAC<br />
AAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTTTGCCATGCAGATT<br />
CCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGTAA 5'<br />
</pre></p><br />
<br><br />
<p><b>Aroma module characterization</b></p><br />
<p>To characterize the aroma module, the process of sequencing was made too</p><br />
<p><pre><br />
3' TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACCTGCATAACGC<br />
GAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACT<br />
AGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTACCTTCAGCACGTTCGTACTGTTCA<br />
ACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTT<br />
TTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTC<br />
AGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGAC<br />
GGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACA<br />
CCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCC<br />
GGGTGTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTG<br />
GTAACTTTCAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTT<br />
AACGGAACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTCGCTTAC<br />
AAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTTTGCCATGCAGATT<br />
CCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGTAA 5'<br />
</pre><p><br />
<br><br />
<p><h2><font size="6"><b><a name="Experiments"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Experiments" target="_blank">Experiments</a></b></font>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>It is needed to characterize and prove the modules, here are the results of the experiments made in order to accomplish it.</p><br />
<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#UV" class="button2">Capture</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#AromaRe1" class="button2">Aroma</a></p><br />
<br />
<p><h2><b><a name="UV"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#UVExp" target="_blank">UV Experimentation </a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p>During 2 hours the four Petri dishes were exposed to UV irradiation. None of them showed any change. </p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/7/75/First_UV_irradiation_Experiment.jpg"<br />
align=center hspace=12></p><br />
<p><font size="2"><b>Image 8.</b>Petri Dish inoculated with NhaS in pSB1C3 exposed to UV irradiation at 302 nm. Before, no time being exposed (left) and after 2 hours of being exposed (right). </font></p></center><br />
<br />
<br />
<p><b><a name="RepetitionUV"></a>Repetition UV Experimentation </b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></p><br />
<br />
<p>Two Petri dishes inoculated by streak: One with NhaS Red and the other with NhaS White. Both exposed during 30 minutes to UV irradiation at 302 nm and none of them showed any change. </p><br />
<p>With no time exposed to UV irradiation: <br />
</p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/1/18/Before_NhaS_Video.jpg"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 9.</b>Nhas in pSB1C3 before being exposed to UV irradiation. </font></p></center><br />
<br />
<p>After 30 minutes: <br />
</p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/a/a6/After_NhaS_Video_.jpg"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 10.</b>Nhas in pSB1C3 before being exposed to UV irradiation. </font></p></center><br />
<br />
<br />
<br />
<p><h2><b><a name="Salt1"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Viability" target="_blank">Viability test of the NhaS gene containing bacteria in salt</a> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank"><font color="red">[Capture Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p><b> Experiment #1</b></p><br />
<br />
<p>Bacteria transformed with the capture plasmid were inoculated in Petri dishes with different concentrations of salt</p><br />
<br />
<center><p><img width=380 height=260 src="https://static.igem.org/mediawiki/2014hs/e/e2/Rojas_NhaS_experiment_1.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="3"><b>Image 11. </b>All the 18 Petri dishes inoculated with NhaS Red in pSB1C3 of all the 9 used concentrations.</font></p></center><br />
<br><br />
<br />
<center><p><img width=380 height=260 src="https://static.igem.org/mediawiki/2014hs/2/28/Blancas_NhaS_experimen_1.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="3"><b>Image 12. </b>All the 18 Petri dishes inoculated with NhaS White in pSB1C3 of all the 9 used concentrations.</font></p></center><br />
<br><br />
<br />
<center><p><img width=380 height=260 src="https://static.igem.org/mediawiki/2014hs/1/12/Control_Expriment_1_NhaS_.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="3"><b>Image 13. </b>All the 18 Petri dishes inoculated with the Control bacteria of all the 9 used concentrations.</font></p></center><br />
<p>All the bacteria containing the NhaS in pSB1C3 (Red and White) survived to a 10% concentration of salt.</p> <br />
<p>None of the control group lived in any concentration of salt.</p><br />
<br><br />
<br />
<center><p><img width=262 height=403 src="https://static.igem.org/mediawiki/2014hs/2/28/Experiment_1_Maximum_concentration_of_salt..jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="3"><b>Image 14. </b>Nine Petri dishes with the maximum concentration of salt (10%) used in this experiment. From up to bottom: NhaS Red in pSB1C3, NhaS White in pSB1C3 and the Control bacteria.</font></p></center> <br />
<br><br />
<br />
<p>The first time the experiment one was performed, bacteria transformed with the capture plasmid were inoculated in Petri dishes with different concentrations of salt, but this time the mayor concentration is higher (15%) </p><p><br />
All the bacteria transformed with NhaS in pSB1C3 (Red and White) lived in the 15% saline medium. </p><p><br />
All the control bacteria exposed to any concentration of salt died.</p><p><br />
All the control bacteria inoculated only in LB medium (without salt) lived. <br />
</p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/7/75/Max_concentration_od_salt_experiment_2_.jpg"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 15. </b>In the upper left part NhaS Red in pSB1C3 at 15% of salt. In the upper right part NhaS Whit in pSB1C3 at 15% of salt. In the lower left part the Control bacteria at 15% of salt. In the lower right part the Control bacteria with only LB medium (without salt) </font></p></center> <br />
<br><br />
<br />
<p><b><a name="Salt2"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Viability" target="_blank">Experiment #2</a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p>In the experiment #1, it was proved that the NhaS transformed bacteria (red and white) survived to a saline environment with LB agar. Then it order to know if it would survive only in a saline medium, it was designed a second experiment where the bacteria was inoculated in erlenmeyer flasks with only salty water at different concentrations (1%, 2.5% 5%, 10% and 15%). None of all the inoculated erlenmeyer flasks was murky, it means that all of the bacteria was dead.</p><br />
<br><br />
<p><b>Experiment # 3</b></p><br />
<p>AQUI D: </p><br />
<br><br />
<p><h2><b><a name="AromaRe1"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#AromaExp" target="_blank"> Aroma Qualitative Experiments</a> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><font color="red">[Aroma Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p><b>Experiment 1 - Test tubes</b></p><br />
<br />
<p> AQUI S; </p><br />
<br />
<p><b>Experiment 2 - Petri dishes</b></p><br />
<p>Random people were chosen to smell our bacteria, four people per each concentration. The experiment was performed with three different concentrations of salicylic acid, which were of 10 mM, 20 mM, and 30 mM. All of the samples contained salicylic acid. There was a controlled group grown bellow and above the 32 ºC and a group with transformed bacteria with the Aroma module, also grown bellow and above the 32 ºC; per each concentration. </p><br />
<p>Those are the words that people used to repeat, or synonyms of what the said, because all the opinions were described in a different way. </p><br />
<br />
<center><table style="background-color:#FFFFFF" width="80%" cellpadding="2"><br />
<tr style='background-color:#3C3C3C'><br />
<td></td><br />
<td><font color="#FFFFFF"><b>Controlled Group Below 32 ºC</b></font></td><br />
<td><font color="#FFFFFF"><b>Group Below 32 ºC</b></font></td><br />
<td><font color="#FFFFFF"><b>Controlled Group Above 32 ºC</b></font></td><br />
<td><font color="#FFFFFF"><b>Group Above 32 ºC</b></font></td><br />
</tr><br />
<tr><br />
<td style='background-color:#3C3C3C'><font color="#FFFFFF"><b>10 mM</b></font></td><br />
<td>Corn</td><br />
<td>Rotten food but with a fresh scent</td><br />
<td>Kind of fresh</td><br />
<td>Ointment or a very Fresh Scent</td><br />
</tr><br />
<tr><br />
<td style='background-color:#3C3C3C'><font color="#FFFFFF"><b>20 mM</b></font></td><br />
<td>Rotten food</td><br />
<td>A little bit fresh</td><br />
<td>Rotten food</td><br />
<td>Household product. (Fresh)</td><br />
</tr><br />
<tr><br />
<td style='background-color:#3C3C3C'><font color="#FFFFFF"><b>30 mM</b></font></td><br />
<td>Rotten food</td><br />
<td>Rotten food</td><br />
<td>Rotten food</td><br />
<td>Rotten food</td><br />
</tr><br />
</table></center><br />
<br><br />
<br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/b/bf/People_smelling_aroma_bacteria.jpg"<br />
align=center hspace=12></p><br />
<p><font size="2"><b>Image 12. </b>People smelling the different Petri dishes previously inoculated with the bacteria transformed with the aroma module in order to describe the odor they perceive. </font></p></center> <br />
<br />
<div style="text-align: left;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_discussions#AromaInt"><font size="2" color="blue">Go to Results Interpretations</font></a></p></div><br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_resistanceTeam:CIDEB-UANL Mexico/math resistance2014-06-20T18:40:26Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_math}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<!-- MathJax (LaTeX for the web) --><br />
<script type="text/x-mathjax-config"><br />
MathJax.Hub.Config({tex2jax: {inlineMath: [['$','$'], ['\\(','\\)']]}});<br />
MathJax.Hub.Config({<br />
TeX: { <br />
equationNumbers: { autoNumber: "AMS" }<br />
}<br />
});<br />
</script><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Resistance Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p>The resistance module is based in the use of the IrrE gene. IrrE is a protein which is not affected by external factors during its transcription or in its translation, so established parameters were needed to use in the obtained from IrrE.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \frac{d\left [ mRNA \right ]}{dt}=\alpha_{1}-d_{1}\left [ mRNA \right ]<br />
\end{equation}<br />
<br />
<br><br />
<p>The parameters for translation and transcription rate from Singapore 2008 iGEM team were used, as well as the transcription and translation speeds carried out by <i>E. coli;</i> assuming a transcription speed of <i>70nt/s</i> and a translation speed of <i>40aa/s</i>. So we used them in the equations below with the IrrE gene length <i>(986nt)</i> and protein length <i>(311aa)</i> respectively.</p><br />
<br><br />
<br />
<br />
\begin{equation}<br />
\large \alpha_{1}=\frac{transcription speed}{gen lenght (nt)} <br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2}=\frac{translation speed}{protein lenght (aa)}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{1}=\frac{(70)(60)}{986}=4.25<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2}=\frac{(40)(60)}{311}=7.7<br />
\end{equation}<br><br />
<p>There were used the parameters for degradation rates for proteins and mRNAs from Beijing PKU 2009 iGEM team:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large d_{1}=\frac{1}{half-life(min)}+\frac{1}{30min}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large d_{2}=\frac{1}{half-life(min)}+\frac{1}{30min} <br />
\end{equation}<br><br />
<br />
<p>Since IrrE half-life has not been determined yet, it was decided to research about homologous proteins with the same function as IrrE (transcriptional factor), and according to Dibden and Green (2005) the average half-life for transcriptional factors in <i>E. coli</i> is 45 min. They tested FNR proteins (transcriptional factors) through thermo-inducible<i>fnr</i> expression observing that their half-life was 45min average. </p><br />
<br />
<p>In order for determining the degradation rate of average mRNA we used the information from Selinger’s team (2003). They carried several experiments for finding average mRNA half-life in <i>E. coli</i>. They used mRNAs about <i>1100nt</i> concluding they have an average half-life of 5min. So with this we found the average mRNA half-life of IrrE was 4.45min.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \frac{d[P]}{dt} = \alpha_{2} \cdot[mRNA] - d_{2}[P] - f_{post(p)}<br />
\end{equation}<br><br />
<br />
<br />
<p>With all of this information the degradation rates for both transcription and translation of IrrE were found.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large d_{1}=\frac{1}{4.5}+\frac{1}{30}=0.25<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large d_{2}=\frac{1}{45}+\frac{1}{30}=0.055<br />
\end{equation}<br><br />
<br />
<p>For the simulation the team used Simbiology&reg;, by plugging in the previously calculated data from the equations, to findin the amount of proteins <i>E. coli</i> would produce at certain time. The following was the result of the simulation:</p><br />
<br><br />
<br />
<br />
<center><p><img width=500 height=400 src="https://static.igem.org/mediawiki/2014hs/3/38/Irre_sin_post.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br><br />
<br />
<p>But for translation there was another factor taken in consideration, the <b><i>“f<sub>post(p)</sub>”</i></b> which were the posttranslational variables affecting the production of the functional protein.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \frac{dpi}{dt}=Ti-Dpmi- f_{post (p)}<br />
\end{equation}<br><br />
<br />
<p>After researching, it was found that IrrE needs to have a positive charge to be functional, accepting one Zn<SUP>2+</SUP> ion from <i>E.coli</i> (Vujicic, 2009). Vujicic’s team developed the structure of IrrE deducing it should have three domains; one specific is the zinc-binding site where the Zn<SUP>2+</SUP> ion binds to make IrrE positive. IrrE positivecharge is what makes possible its binding to a substrate forming a substrate complex, but the substrate is unknown. For that reason it was only taken as a <b><i>“f<sub>post(p)</sub>”</i></b> variable the Zn<SUP>2+</SUP> binding because the data for finding the affinity between IrrE and the unknown substrate was not possible to determine.</p><br />
<br />
<p>It was not obtained the data fom the affinity between IrrE and Zn<SUP>2+</SUP> it was needed to find the data from homologous proteins. In fact, proteins with zinc binding domainswere found to have an affinity between 0.1 and 0.2 in <i>E. coli</i> (Vorackova, 2012). We used 0.15 as average in the equation for association constant which is defined as the following:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large Ka=\frac{\left [ C \right ]}{\left [ S \right ]\left [ E \right ]}<br />
\end{equation}<br><br />
<br />
<p>Where <b><i>“[C]”</i></b> is the complex formed, <b><i>“[S]”</i></b> is the substrate and <b><i>“[E]”</i></b> is the enzyme, ligand or ion. Substituting for IrrE it is expressed as below:</p><br><br />
<br />
\begin{equation}<br />
\large Ka=\frac{\left [ C \right ]}{\left [ IrrE \right ]\left [ Zn+ \right ]}0.15=\frac{\left [ C \right ]}{\left [ IrrE \right ]\left [ Zn+ \right ]}<br />
\end{equation}<br><br />
<br />
<p>With the association constant, Simbiology&reg; was used to model the functional IrrE production. The results were the following:</p><br />
<center><p><img width=400 height=400 src="https://static.igem.org/mediawiki/2014hs/c/c4/Grafico_simbiology_irre.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<br><br />
<center><img width=500 height=400 src="https://static.igem.org/mediawiki/2014hs/2/23/Functional_irre.png"<br />
align=center hspace=12 alt="IMG_0317"></center><br />
<br />
<br><br />
<p align: justify>When both graphs were compared, (<b>Graph 1</b> and <b>Graph 2</b>) it was concluded that not all the IrrE production was functional. In fact from the total amount produced (about 2400), only about 1700 are functional. So it demonstrates that the rate at which Zn<SUP>2+</SUP> ions binds to IrrE is slower than the rate at which IrrE is produced, leaving a nonfunctional IrrE.</p><br />
<br />
<br><p><b><h2>Bibliography/References</h2></b></p><br />
<br />
<font size="2"><br />
<p>● DIBDEN, David J. G. (2005). In vivo cycling of the Escherichia coli transcription factor FNR between active and inactive states. <i>Microbiology</i>, 4063-4070.</p><br />
<p>● SELINGER, Douglas R. M. (2003). Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. <i>Genome Research</i>, 216-223.</p><br />
<p>● VORACKOVA Irena, S. S. (2011). Purification of proteins containing zinc finger domains using Immobilized Metal Ion Affinity Chromatography. <i>Protein Expression and Purification</i>, 88-95.</p><br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_resistance#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_aromaTeam:CIDEB-UANL Mexico/math aroma2014-06-20T18:38:22Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_math}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<!-- MathJax (LaTeX for the web) --><br />
<script type="text/x-mathjax-config"><br />
MathJax.Hub.Config({tex2jax: {inlineMath: [['$','$'], ['\\(','\\)']]}});<br />
MathJax.Hub.Config({<br />
TeX: { <br />
equationNumbers: { autoNumber: "AMS" }<br />
}<br />
});<br />
</script><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Aroma Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p>The aroma module is based in the production of SAM/salicylic acid methyltransferase (BSMT1) in order to generate methyl salicylate, leaving a physical evidence of wintergreen odor. Since this module is not affected by external factors during its transcription, the established formula of mRNA was used with their parameters, but with the data we obtained from BSMT1.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \frac{d\left [ mRNA \right ]}{dt}=\alpha_{1}-d_{1}\left [ mRNA \right ]<br />
\end{equation}<br />
<br />
<br><br />
<p>In the case of translation, a RNA thermometer affects the production of the protein BSMT1. When the temperature reaches 32°C, the RBS allows the translation of BSMT1 gene, but below 32&deg; C, the translation is not allowed.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large RBS\left\{\begin{matrix}<br />
T<32=0 & \\ <br />
T\geq 32=1& <br />
\end{matrix}\right.<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \frac{d[P]}{dt} = \alpha_{2} \cdot[mRNA] - d_{2}[P] - f_{post}\left\{\begin{matrix}<br />
T<32 \left\{\begin{matrix}<br />
\alpha_{2}=\frac{2400\cdot 0}{358}; RBS=0 & \\ <br />
No protein degradation& <br />
\end{matrix}\right. & \\ <br />
T\geq 32 \left\{\begin{matrix}<br />
\alpha_{2}\frac{2400}{358}=6.7& \\ <br />
d_{1}\frac{1}{40min}+ \frac{1}{30min}=0.058 & <br />
\end{matrix}\right.& <br />
\end{matrix}\right.<br />
\end{equation}<br />
<br />
<br><br />
<p>The parameters for translation and transcription rate from Singapore 2008 iGEM team were used, as well as the speeds at which <i>E. coli</i> carry out both, the transcription and the translation, assuming a transcription speed of <i>70nt/s</i> and a translation speed of <i>40aa/s</i>. These data were used in the equations below with the Wintergreen gene length being <i>1198nt</i> and the protein length being <i>358aa</i>:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \alpha_{1} = \frac{transcription speed}{gene length (nt)}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2} = \frac{translation speed}{protein length (aa)}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{1} = \frac{(70)(60)}{1198} = 3.5<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2} = \frac{(40)(60)}{358} = 6.7 <br />
\end{equation}<br><br />
<br />
<p>Then, the parameters for degradation rates for proteins and mRNAs from Beijing PKU 2009 iGEM team were used:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large d_{1} = \frac{1}{half-life(min)} + \frac{1}{30min} <br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large d_{2} = \frac{1}{half-life(min)} + \frac{1}{30min} <br />
\end{equation}<br><br />
<br />
<p>Since the half-life of BSMT1 has not been determined by MIT Team 2006, an investigation was made and according to Zubieta (2003), the average half-life for salicylic acid methyltransferases are about 40min.</p><br />
<br />
<p>To determine the degradation rate of the average mRNA, the information from Selinger’s team (2003) was used. Several experiments to find the average mRNA half-life in <i>E. coli </i>were carried out. They used mRNAs of about <i>1100nt</i> length, leading to the conclusion that they have an average half-life of 5min.With this information, it could be determined that the average mRNA half-life of BSMT1 was 5.44min.:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large HL = \frac{1100(nt)}{5 min}<br />
\end{equation}<br><br />
<br />
<p>With all these information, the degradation rates for both, the transcription and the translation of BSMT1, could be calculated:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large d_{1} = \frac{1}{5.44} + \frac{1}{30} = 0.21<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large d_{2} = \frac{1}{40} + \frac{1}{30} = 0.058<br />
\end{equation}<br><br />
<br />
<p>Simbiology was used for the simulation. The previous data were used in the equations to find the amount of proteins <i>E. coli</i> would produce at certain times. The results are shown in the next graph: </p><br />
<br><br />
<br />
<br />
<center><p><img width=500 height=380 src="https://static.igem.org/mediawiki/2014hs/b/b4/Graph_wintergreen_1.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<p>For the translation, another factor was needed to be taken into consideration, the <b><i>“f<sub>post</sub>”</i></b>, which were the post-translational variables affecting the production of the functional protein.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \frac{d[P]}{dt} = \alpha_{2} \cdot[mRNA] - d_{2}[P] - f_{post}<br />
\end{equation}<br />
<br />
<br><br />
<p>During the research of information, it was found out that BSMT1 is a special type of enzyme called Michaelis-Menten enzyme. As BSMT1 will perform an enzymatic reaction, it was needed to know at which rate it will be carried on producing methyl salicylate (Zubieta 2003). For that reason, the post-translational function considers the rate of methyl salicylate production as the variable that directly affects the production of the final protein. The formula used was also called Michaelis-Menten Equation:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large f_{post}=\frac{k_{cat}\left [ S \right ]\left [ E \right ]}{K_{m} + \left [ S \right ]}<br />
\end{equation}<br />
<br />
<br><p>Where: <b><i>“[S]”</i></b> means the substrate concentration; <b><i>“[E]”</i></b>, the enzyme concentration (obtained by the rest of the translational formula); <b><i>“K<sub>cat</sub>”</i></b>; is the turnover number; and <b><i>“K<sub>m</sub>”</i></b>, the substrate concentration needed to achieve a half-maximum enzyme velocity.</p><br />
<br />
<p><b><i>“K<sub>m</sub>”</i></b> and <b><i>“K<sub>cat</sub>”</i></b> were established values for SAM (Zublileta, 2003)of 23 and 0.092, respectively. Based on their results, the oprimal induced concentration of salicylic acid is 2mM, but in the performed expreimentation, the predicted value (at which <i>E. coli</i> could survive) was considered as 10mM. As <b><i>“[E]”</i></b> stands for enzyme concentration, the protein produced (by the rates of translation and degradation of the protein) will introduce this value in the equation. By substituting these values in the Michaelis-Menten Equation, it will change as follows:</p><br><br />
<br />
\begin{equation}<br />
\large f_{post}=\frac{k_{cat}\left [ S \right ]\left [ E \right ]}{K_{m} + \left [ S \right ]}=\frac{0.092\left ( 10mM \right )\left [ P \right ]}{23 + 10mM}<br />
\end{equation}<br />
<br />
<br><p>Also, this formula is used in order to get the maximum rate of methyl salicylate production. This value is given by the product of <b><i>“K<sub>cat</sub>”</i></b> times the substrate concentration <b><i>“[S]”</i></b>.</p><br><br />
<br />
\begin{equation}<br />
\large V_{max}=K_{cat}\cdot \left [ S \right ]=0.092\left ( 10mM \right )=0.92<br />
\end{equation}<br />
<br />
<br><br />
<p>The enzymatic rate were used in Simbiology to model the functional BSMT1 production. The results are shown in the next graphs:</p><br />
<br />
<center><p><img width=430 height=250 src="https://static.igem.org/mediawiki/2014hs/1/14/Diagram_wintergreen.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<center><p><img width=500 height=380 src="https://static.igem.org/mediawiki/2014hs/0/0a/Wintergreen_2_graph.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<br><br />
<p>With the analysis from both graphs (<b>Graph 1</b> and <b>Graph 2</b>) , it was established that the enzymatic reaction was too slow compared to the BSMT1 production, <strong>leaving almost ¼ nonfunctional of the total amount of proteins produced</strong>. It was assumed that the functional BSMT1 is the final product, which releases the Wintergreen odor and it would be relatively concentrated with the amount of proteins produced.</p><br />
<br />
<br><p><b><h2>Bibliography/References</h2></b></p><br />
<br />
<font size="2"><br />
<p>● DIBDEN, David J. G. (2005). In vivo cycling of the Escherichia coli transcription factor FNR between active and inactive states. <i>Microbiology</i>, 4063-4070.</p><br />
<p>● SELINGER, Douglas R. M. (2003). Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. <i>Genome Research</i>, 216-223.</p><br />
<p>● ZUBIETA, C. (2003). Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family. <i>Plant Cell</i>, 1704-1716.</p><br><br />
<br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_aroma#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_captureTeam:CIDEB-UANL Mexico/math capture2014-06-20T18:36:25Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_math}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<!-- MathJax (LaTeX for the web) --><br />
<script type="text/x-mathjax-config"><br />
MathJax.Hub.Config({tex2jax: {inlineMath: [['$','$'], ['\\(','\\)']]}});<br />
MathJax.Hub.Config({<br />
TeX: { <br />
equationNumbers: { autoNumber: "AMS" }<br />
}<br />
});<br />
</script><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Capture Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p>The capture module was based in the use of NhaS gene, but NhaS was not the only gene expressed in the circuit because RFP was used as a reporter, we needed to consider that as a factor. The circuit is shown below:</p><br />
<br />
<br><center><p><img width=334 height=100 src="https://static.igem.org/mediawiki/2014hs/6/60/Nhas_circuit_math.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<br><br />
<p>As it is shown in the circuit, the transcription rate is affected by Uv light. It was needed the use of established parameters with data from NhaS and RFP. Uv promoters, according to Shuang Li’s team (2006), have less efficiency than constitutive promoters, which is aproximately 60% of the constitutive promoters.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \frac{d\left [ mRNA \right ]}{dt}=\alpha_{1}\cdot f_{y}-d1\left [ mRNA \right ]<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large f_{y}=0.6<br />
\end{equation}<br />
<br />
<br><br />
<p>It was assumed that <b><i>“f<sub>y</sub>”</i></b>, is the regulatory function that can activate or inhibit the system of x gene, was 0.6 because of the percentage given by Shuang Li’s team. Uv rays activate the promoter, but it is not as efficient as constitutive promoters in the transcription process.</p><br />
<br />
<p>The parameters from <a href="https://2008.igem.org/Team:NTU-Singapore">Singapore 2008</a> team were used for the translation and transcription rates as well as the speed at which <i>E. coli</i> carries out transcription and translation, assuming a transcription speed of <i>70nt/s</i> and a translation speed of <i>40aa/s</i>. So we used them in the equations below with the NhaS and RFP gene (<i>1019nt</i>), NhaS with <i>69aa</i> and RFP with <i>235aa</i> respectively.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \alpha_{1} =\frac{transcription speed}{gene length (nt)}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2} =\frac{trasnlation speed}{protein length (aa)}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{1}=\frac{(70)(60)}{1019}=4.12<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2}(NhaS)=\frac{(40)(60)}{69}=34.78<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2}(RFP)=\frac{(40)(60)}{235}=10.21<br />
\end{equation}<br />
<br />
<br><br />
<p>Then, the parameters for degradation rates for proteins and mRNAs from <a href="https://2009.igem.org/Team:PKU_Beijing">PKU Beijing 2009</a> team were used :</p><br />
<br />
<br><br />
\begin{equation}<br />
\large D_{i}= \frac{1}{half-life(min)} + \frac{1}{30min} <br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large D_{p} = \frac{1}{half-life(min)} + \frac{1}{30min} <br />
\end{equation}<br />
<br />
<br><br />
<p>However, since NhaS half-life has not been determined yet, it was decided to search for homologous proteins with the same function as NhaS. We found out that the half-life of membrane proteins produced in <i>E. coli</i> range between 2 to 20 hours (Hare, 1991); since NhaS is a membrane protein, it's half life should be between those values. It was decided to use 2 hours as NhaS half-life because of its relatively small size (<i>69aa</i>) .<strong> To obtain the half-life of RFP, the team basethe time on the GFP protein due to the similarity of their functions (fluorescence). Therefore, the half-life of RFP on which we are based is of 8 hours (Longo, 2006).</strong></p><br />
<br />
<p>To determine the average mRNA degradation rate, information from Selinger’s team (2003) was used. The team carried out several experiments to find out the average mRNA half-life in <i>E. coli</i>. They used mRNAs about <i>1100nt</i> in lenght, and they concluded that it has an average half-life of 5min. Based on this information, it was concluded that the mRNA average half-life of NhaS with RFP was 4.63min.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large HL=\frac{1100(nt)}{5min}<br />
\end{equation}<br />
<br />
<br><br />
<p>With all these information, the team was able to find the degradation rates for both, the transcription and translation of NhaS and RFP, respectively.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large d_{1}= \frac{1}{4.63} + \frac{1}{30}=0.25 <br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large d_{2}(NhaS)= \frac{1}{120} + \frac{1}{30}=0.041<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large d_{2}(RFP)= \frac{1}{480} + \frac{1}{30}=0.035<br />
\end{equation}<br />
<br />
<br><br />
<p>For the simulation Simbiology&reg; was used , using the previous data in the equations to calculate the amount of proteins <i>E. coli</i> would produce at certain time. The next graph shows the results of the simulation (assuming <i>E. coli</i> is under UV rays which actives its promoter):</p><br />
<br><br />
<br />
<center><p><img width=500 height=400 src="https://static.igem.org/mediawiki/2014hs/c/c7/Nhas_graph_1.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<br><br />
<p>For translation, there was another factor taken in consideration, the <b><i>“f<sub>post</sub>”</i></b> which were the post-translational variables affecting the production of the functional protein:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \frac{d[P]}{dt} = \alpha_{2} \cdot[mRNA] - d_{2}[P] - f_{post}<br />
\end{equation}<br />
<br />
<br><br />
<p>Since NhaS protein needs to be expressed in <i>E. coli's</i> membrane, the average velocity at which <i>E. coli</i> exports its proteins needed to be calculated. The process by which bacteria exports its proteins is divided into three phases, the “breathing” between translation, the second phase, which is the movement of a protein to the membrane and finally, the translocation in which the protein attaches to the membrane of bacteria (Peskin, 1991). Using this information, we found <i>E. coli</i> completes these three phases at an average of 5 to 6 min, depending on the protein size (Driessen, 1990). 5min were plugged into the data, because NhaS protein is relatively small and it was assumed that RFP had no post-translational variables to consider as well as it was not the protein we wanted to measure.<br />
<p>With the rate of protein transport we could use Simbiology to model the functional NhaS production. The results are shown in next diagrams (assuming <i>E. coli</i> is under UV rays which actives its promoter):</p><br><br />
<br />
<center><p><img width=400 height=300 src="https://static.igem.org/mediawiki/2014hs/e/e1/Nhas_diagram.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<center><p><img width=500 height=400 src="https://static.igem.org/mediawiki/2014hs/1/1f/Nhas_graph_2.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<br><br />
<p>When both graphs were compared (<b>Graph 1</b> and <b>Graph 2</b>) the data shown that NhaS production was functional and that the production of NhaS was really big. It was assumed that this happenned because NhaS is only (<i>69aa</i>) in length. Also it was concluded that NhaS is functional when it is located in the membrane, (by &quot;functional&quot; meaning that it has the potential to capture Na<SUP>+</SUP> ions and be able to give resistance to saline environments in <i>E. coli</i>. As is shown in Graph 2 the amount is of proteins produced are about 6500; we assumed those proteins are ready to bind Na<SUP>+</SUP> ions.</p><br />
<br />
<br><p><b><br />
<h2>Bibliography/References</h2><br />
</b></p><br />
<br />
<font size="2"><br />
<p>● DRIESSEN, Arnold W. W. (1990). Proton transfer rate-limiting for translocation of precursor proteins by the Escherichia coli translocase. <i>Biochemistry</i>, 2471-2475.</p><br />
<p>● PESKIN, Charles S. S. (1991). What drives the translocation of proteins. <i>Biophysics</i>, 3770-3774.</p><br />
<p>● LONNGO, Diane J. H. (2006). Dynamics of single-cell gene expression. <i>Molecular Systems Biology</i>, 1-10.</p><br />
<p>● SELINGER, Douglas R. M. (2003). Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. <i>Genome Research</i>, 216-223. </p><br />
<p>● HARE, James K. T. (1991). Mechanisms of plasma membrane protein degradation: Recycling proteins are degraded more rapidly than those confined to the cell surface. <i>PNAS</i>, 5902-5906.</p><br />
<p>● LI, Shuang L. X. (2007). A set of UV-inducible autolytic vectors for high throughput screening. <i>Journal of biotechnology</i>, 647-652.</p><br />
<br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_capture#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_captureTeam:CIDEB-UANL Mexico/math capture2014-06-20T18:35:06Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_math}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<!-- MathJax (LaTeX for the web) --><br />
<script type="text/x-mathjax-config"><br />
MathJax.Hub.Config({tex2jax: {inlineMath: [['$','$'], ['\\(','\\)']]}});<br />
MathJax.Hub.Config({<br />
TeX: { <br />
equationNumbers: { autoNumber: "AMS" }<br />
}<br />
});<br />
</script><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Capture Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p>The capture module was based in the use of NhaS gene, but NhaS was not the only gene expressed in the circuit because RFP was used as a reporter, we needed to consider that as a factor. The circuit is shown below:</p><br />
<br />
<br><center><p><img width=334 height=100 src="https://static.igem.org/mediawiki/2014hs/6/60/Nhas_circuit_math.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<br><br />
<p>As it is shown in the circuit, the transcription rate is affected by Uv light. It was needed the use of established parameters with data from NhaS and RFP. Uv promoters, according to Shuang Li’s team (2006), have less efficiency than constitutive promoters, which is aproximately 60% of the constitutive promoters.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \frac{d\left [ mRNA \right ]}{dt}=\alpha_{1}\cdot f_{y}-d1\left [ mRNA \right ]<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large f_{y}=0.6<br />
\end{equation}<br />
<br />
<br><br />
<p>It was assumed that <b><i>“f<sub>y</sub>”</i></b>, is the regulatory function that can activate or inhibit the system of x gene, was 0.6 because of the percentage given by Shuang Li’s team. Uv rays activate the promoter, but it is not as efficient as constitutive promoters in the transcription process.</p><br />
<br />
<p>The parameters from <a href="https://2008.igem.org/Team:NTU-Singapore">Singapore 2008</a> team were used for the translation and transcription rates as well as the speed at which <i>E. coli</i> carries out transcription and translation, assuming a transcription speed of <i>70nt/s</i> and a translation speed of <i>40aa/s</i>. So we used them in the equations below with the NhaS and RFP gene (<i>1019nt</i>), NhaS with <i>69aa</i> and RFP with <i>235aa</i> respectively.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \alpha_{1} =\frac{transcription speed}{gene length (nt)}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2} =\frac{trasnlation speed}{protein length (aa)}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{1}=\frac{(70)(60)}{1019}=4.12<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2}(NhaS)=\frac{(40)(60)}{69}=34.78<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2}(RFP)=\frac{(40)(60)}{235}=10.21<br />
\end{equation}<br />
<br />
<br><br />
<p>Then, the parameters for degradation rates for proteins and mRNAs from <a href="https://2009.igem.org/Team:PKU_Beijing">PKU Beijing 2009</a> team were used :</p><br />
<br />
<br><br />
\begin{equation}<br />
\large D_{i}= \frac{1}{half-life(min)} + \frac{1}{30min} <br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large D_{p} = \frac{1}{half-life(min)} + \frac{1}{30min} <br />
\end{equation}<br />
<br />
<br><br />
<p>However, since NhaS half-life has not been determined yet, it was decided to search for homologous proteins with the same function as NhaS. We found out that the half-life of membrane proteins produced in <i>E. coli</i> range between 2 to 20 hours (Hare, 1991); since NhaS is a membrane protein, it's half life should be between those values. It was decided to use 2 hours as NhaS half-life because of its relatively small size (<i>69aa</i>) .<strong> To obtain the half-life of RFP, the team basethe time on the GFP protein due to the similarity of their functions (fluorescence). Therefore, the half-life of RFP on which we are based is of 8 hours (Longo, 2006).</strong></p><br />
<br />
<p>To determine the average mRNA degradation rate, information from Selinger’s team (2003) was used. The team carried out several experiments to find out the average mRNA half-life in <i>E. coli</i>. They used mRNAs about <i>1100nt</i> in lenght, and they concluded that it has an average half-life of 5min. Based on this information, it was concluded that the mRNA average half-life of NhaS with RFP was 4.63min.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large HL=\frac{1100(nt)}{5min}<br />
\end{equation}<br />
<br />
<br><br />
<p>With all these information, the team was able to find the degradation rates for both, the transcription and translation of NhaS and RFP, respectively.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large d_{1}= \frac{1}{4.63} + \frac{1}{30}=0.25 <br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large d_{2}(NhaS)= \frac{1}{120} + \frac{1}{30}=0.041<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large d_{2}(RFP)= \frac{1}{480} + \frac{1}{30}=0.035<br />
\end{equation}<br />
<br />
<br><br />
<p>For the simulation Simbiology&reg; was used , using the previous data in the equations to calculate the amount of proteins <i>E. coli</i> would produce at certain time. The next graph shows the results of the simulation (assuming <i>E. coli</i> is under UV rays which actives its promoter):</p><br />
<br><br />
<br />
<center><p><img width=500 height=400 src="https://static.igem.org/mediawiki/2014hs/c/c7/Nhas_graph_1.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<br><br />
<p>For translation, there was another factor taken in consideration, the <b><i>“f<sub>post</sub>”</i></b> which were the post-translational variables affecting the production of the functional protein:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \frac{d[P]}{dt} = \alpha_{2} \cdot[mRNA] - d_{2}[P] - f_{post}<br />
\end{equation}<br />
<br />
<br><br />
<p>Since NhaS protein needs to be expressed in <i>E. coli's</i> membrane, the average velocity at which <i>E. coli</i> exports its proteins needed to be calculated. The process by which bacteria exports its proteins is divided into three phases, the “breathing” between translation, the second phase, which is the movement of a protein to the membrane and finally, the translocation in which the protein attaches to the membrane of bacteria (Peskin, 1991). Using this information, we found <i>E. coli</i> completes these three phases at an average of 5 to 6 min, depending on the protein size (Driessen, 1990). 5min were plugged into the data, because NhaS protein is relatively small and it was assumed that RFP had no post-translational variables to consider as well as it was not the protein we wanted to measure.<br />
<p>With the rate of protein transport we could use Simbiology to model the functional NhaS production. The results are shown in next diagrams (assuming <i>E. coli</i> is under UV rays which actives its promoter):</p><br><br />
<br />
<center><p><img width=400 height=300 src="https://static.igem.org/mediawiki/2014hs/e/e1/Nhas_diagram.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<center><p><img width=500 height=400 src="https://static.igem.org/mediawiki/2014hs/1/1f/Nhas_graph_2.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<br><br />
<p>When both graphs were compared (<b>Graph 1</b> and <b>Graph 2</b>) the data shown that NhaS production was functional and that the production of NhaS was really big. It was assumed that this happenned because NhaS is only (<i>69aa</i>) in length. Also it was concluded that NhaS is functional when it is located in the membrane, (by &quot;functional&quot; meaning that it has the potential to capture Na<SUP>+</SUP> ions and be able to give resistance to saline environments in <i>E. coli</i>. As is shown in Graph 2 the amount is of proteins produced are about 6500; we assumed those proteins are ready to bind Na<SUP>+</SUP> ions.</p><br />
<br />
<br><p><b><br />
<h2>Bibliography</h2><br />
</b></p><br />
<br />
<font size="2"><br />
<p>● DRIESSEN, Arnold W. W. (1990). Proton transfer rate-limiting for translocation of precursor proteins by the Escherichia coli translocase. <i>Biochemistry</i>, 2471-2475.</p><br />
<p>● PESKIN, Charles S. S. (1991). What drives the translocation of proteins. <i>Biophysics</i>, 3770-3774.</p><br />
<p>● LONNGO, Diane J. H. (2006). Dynamics of single-cell gene expression. <i>Molecular Systems Biology</i>, 1-10.</p><br />
<p>● SELINGER, Douglas R. M. (2003). Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. <i>Genome Research</i>, 216-223. </p><br />
<p>● HARE, James K. T. (1991). Mechanisms of plasma membrane protein degradation: Recycling proteins are degraded more rapidly than those confined to the cell surface. <i>PNAS</i>, 5902-5906.</p><br />
<p>● LI, Shuang L. X. (2007). A set of UV-inducible autolytic vectors for high throughput screening. <i>Journal of biotechnology</i>, 647-652.</p><br />
<br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_capture#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_unionTeam:CIDEB-UANL Mexico/project union2014-06-20T18:29:47Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project<br />
</title><br />
<style>body{margin: 0px; width: 100%;padding: 0px;background: #2056ac;font-family: 'Oxygen', sans-serif;font-size: 12pt;background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);}h1, h2, h3{margin: 0;padding-bottom: 5px;color: #404040;}p, ol, ul{margin-top: 0;}ol, ul{padding: 0;list-style: none;}p{line-height: 1.60em;padding- right: 3em;}strong{}a{color: #2056ac;}a:hover{text-decoration: none;}.container{margin: 0px auto;width: 1200px;}.container-text{margin: 0px auto;width: 75%;padding: 0px;font-family: 'Oxygen', sans-serif;font-size: 12pt; text-align: justify;}.wrapper{overflow: hidden;padding: 0em 0em 1em 0em;background: #FFF;}#wrapper1{background: #FFF;}#wrapper2{overflow: hidden;background: #F3F3F3;padding: 5em 0em;text-align: center;}#wrapper3{overflow: hidden;padding: 0em 0em 0em 0em;background: #FFF;}#wrapper4{}#banner{padding-top: 2em;}#welcome{overflow: hidden;width: 1000px;padding: 0em 100px 0em 100px;text-align: center;}#welcome .content{padding: 0em 8em;}#welcome .title h2{}#welcome a,#welcome strong{}.title{margin-bottom: 1em;}.title h2{font-size: 2em;}.title .byline{font-size: 1.1em;color: #6F6F6F#;}#three-column{overflow: hidden;margin-top: 5em;padding-top: 1em;border-top: 1px solid rgba(0,0,0,0.2);text-align: center;}#three-column h2{margin: 1em 0em;font-size: 1.5em;font-weight: 700;}#three-column .icon{position: relative;display: block;margin: 0px auto 0.80em auto;background: none;line-height: 150px;font-size: 4em;width: 150px;height: 100px;border-radius: 100px;border: 6px solid #67128F;text-align: center;color: #FFF;}#three-column #tbox1,#three-column #tbox2,#three-column #tbox3{float: left;width: 320px;padding: 30px 40px 50px 40px;}#three-column .title{text-align: center;}#three-column .title h2{font-size: 1.60em;}#three-column .title .byline{padding-top: 0.50em;font-size: 0.90em;color: #858585;}#three-column .arrow-down{border-top-color: #292929;}ul.tools{margin: 0;padding: 0em 0em 0em 0em;list-style: none;}ul.tools li{display: inline-block;padding: 0em .2em;font-size: 4em;}ul.tools li span{display: none;margin: 0;padding: 0;}ul.tools li a{color: #FFF;}ul.tools li a:before{display: inline-block;background: #1ABC9C;width: 120px;height: 120px;border-radius: 50%;line-height: 120px;text-align: center;color: #FFFFFF;}.button{display: inline-block;margin-top: 2em;padding: 0.8em 2em;background: #64ABD1;line-height: 1.8em;letter-spacing: 1px;text-decoration: none;font-size: 1em;color: #FFF;}.button:before{display: inline-block;background: #8DCB89;margin-right: 1em;width: 40px;height: 40px;line-height: 40px;border-radius: 20px;text-align: center;color: #272925;}.button-small{}#portfolio{overflow: hidden;padding-top: 5em;border-top: 1px solid rgba(0,0,0,0.2);}#portfolio .box{text-align: center;color: rgba(0,0,0,0.5);}#portfolio h3{display: block;padding-bottom: 1em;font-size: 1em;color: rgba(0,0,0,0.6);}#portfolio .title{text-align: center;}#portfolio .title h2{color: rgba(0,0,0,0.8);}.column1,.column2,.column3,.column4{width: 282px;}.column1,.column2,.column3{float: left;margin-right: 24px;}.column4{float: right;}<br />
</style><br />
<br />
<body><br />
<br />
<div class="wrapper"><br />
<br />
<div id="welcome" class="container"> <br />
<br />
<div class="title"> <h2>Union Module</h2> <br />
</div><br />
</div><br />
<br />
<div class="container-text"><br />
<table width=100%><br />
<tr><br />
<td><br />
<br />
<p>After E.CARU performs its other tasks, in order to remove <i>E. coli</i> from the salty water for making it useful, the ability for binding to silica was introduced to the bacteria. Using this ability, it would be easy to clean the water free of bacterium through a biological filter.</p><br />
<br />
</td><br />
<td style="padding-left:12px;"><img width=154 height=133 src="https://static.igem.org/mediawiki/2014hs/c/cf/Logo_silica.png"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<p><b><h2>Description</h2></b></p><br />
<br />
<p><b>L2</b></p><br />
<p>The gene L2 encodes for a protein that is able to attach to silica. Taniguchi et al. reported in 2007 that the L2 ribosomal protein from <i>E. coli</i> strongly binds to silica surfaces, even up to 200 times tighter than poliarginine tags commonly used for protein purification. In their work, Taniguchi et al. (2007) constructed a fusion protein containing L2 and green fluorescent protein (GFP) which kept attached to a silica surface even after been washed for 24 hours with a buffer containing 1 M NaCl (<b>Figure 1</b>). <a href="https://2012.igem.org/Team:UANL_Mty-Mexico">UANL Mexico 2012</a> did not have this piece in stock, so we decided to synthetize L2 along with a peptide signal.</p><br />
<br />
<center><p><img width=237 height=140 src="https://static.igem.org/mediawiki/2014hs/0/05/Silica_washed.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 1.</b> Proteins absorbed to a silica slide and washed for 24 hours a)GFP b) L2-GFP fusion c) R9-GFP fusion. Taken from Taniguchi (2007)</p></center><br />
<br><br />
<br />
<P><b>AIDA</b></p><br />
<p>AIDA-I is an <i>E. coli</i> membrane protein with a passenger domain of 76 kDa exposed to the extracellular space and a transmembrane beta-barrel domain of 45 kDa; the latter has been used to express functional proteins in the cell-membrane of up to 65 kDa (van Bloois et al., 2011). Furthermore passengers coupled to AIDA-I have been reported to reach an expression level of more than 100,000 copies per cell in the outer membrane (Jose and Meyer, 2007). </p><center><br />
<br />
<p><img width=226 height=251 src="https://static.igem.org/mediawiki/2014hs/a/a2/Aida_system.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 2.</b> Schematic representation of AIDA-I carrier protein</p></center><br />
<br><br />
<br />
<p><b>How do L2 and AIDA act together?</b></p><br />
<p>As AIDA is a membrane protein producer and L2 produces a protein for making possible the attachment to silica, the team decided to make a fusion protein, so that the protein produced by L2 can be anchored to the membrane of the bacteria with the help of AIDA, and in that way, binding the E.CARU to silica pearls for being filtered.</p><br />
<br />
<p><b>Why is it important to use BgIII and BamHI to link L2 and AIDA-I?</b></p><br />
<br />
<p>It was needed to join both proteins in order to make a fusion protein, but SpeI and XbaI could not be used to join them because the reading frame would change, coding for a completely different protein. In order to avoid such problem, BgIII and BamHI were used instead, which could join AIDA and L2 without changing the reading frame. The scar produced between BamHI and BgIII, as it is shown in <b>Figure 3</b>, is formed by six bases, respecting the reading frame from both proteins in order to synthetize the correct protein.</p><br />
<br><center><br />
<br />
<p><img width=397 height=222 src="https://static.igem.org/mediawiki/2014hs/b/b5/Bg_y_bam_III.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 3.</b> Example of a ligation using BamHI and BgIII</p></center><br />
<br />
<p><b><h2>Device</h2></b></p><br />
<br />
<p>Initially, L2+AIDA and IrrE, protein for giving resistance to <i>E. coli</i> to adverse conditions (<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance module</a>), were joined together in only one circuit, but we needed to separate them because L2+AIDA has not been tested and it could affect the production of IrrE (see <b>Figure 4.</b>) as well as for testing each module alone.</p><br />
<br />
<center><p><img width=529 height=322 src="https://static.igem.org/mediawiki/2014hs/0/05/Circuit_l2_and_irre.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 4.</b> Circuit for our project and for testing resistance and union modules. </p></center><br />
<br><br />
<br />
<p>The union circuit consists mainly of a constitutive promoter, an RBS, a peptide signal attached to L2 and this attached to AIDA by a scar and a terminator. The device is designed this way in order to produce a protein that helps the bacteria to bind to silica.</p><br />
<br />
<center><p><img width=463 height=101 src="https://static.igem.org/mediawiki/2014hs/9/92/Composicion_silica.png"align=center hspace=12 alt="IMG_0317"></p></center><center><br />
<br />
<p><b>Figure 5.</b> Union Device</p></center><br />
<br><br />
<br />
<p><b><h2>Parts of the module</h2></b></p><br />
<br />
<br><center><br />
<br />
<div><br />
<table border=0 cellspacing=0 cellpadding=0 width=700 style='width:441.4pt;margin-left:25.5pt;border-collapse: collapse;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh: .5pt solid windowtext;mso-border-insidev:.5pt solid windowtext'> <br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-bottom:solid #AE78D6 1.0pt; mso-border-bottom-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:517'><b style='mso-bidi-font-weight: normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font:major-fareast; mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font:major-bidi; mso-bidi-font-style:italic'>IMAGE<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border:none;border-bottom:solid #934BC9 1.0pt; mso-border-bottom-alt:solid #934BC9 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b style='mso-bidi-font-weight: normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font:major-fareast; mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font:major-bidi; mso-bidi-font-style:italic'>CODE<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border:none;border-bottom:solid #AE78D6 1.0pt; mso-border-bottom-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal;tab-stops:85.15pt center 130.35pt;mso-yfti-cnfc:1'><b style='mso-bidi-font-weight:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font: major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font: major-bidi;mso-bidi-font-style:italic'><br />
<br />
<span style='mso-tab-count:2'> <br />
</span>DESCRIPTION<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:0'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #AE78D6 .5pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1062" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:11.6pt;margin-top:3.55pt;width:54.05pt;height:41.3pt; z-index:251671552;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image013.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1062" DrawAspect="Content" ObjectID="_1464162125"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=72 height=55 src="https://static.igem.org/mediawiki/2014hs/e/e0/PromoterCIDEB.jpg" align=left hspace=12 v:shapes="_x0000_s1062"><![endif]><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:major-fareast;mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:major-bidi;mso-ansi-language:EN-US;mso-bidi-font-style: italic'><o:p></o:p><br />
</span></p><br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #934BC9 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #934BC9 .5pt; background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_J23119">BBa_J23119</a><br />
</span><br />
<br />
<span style='font-size:7.0pt;mso-bidi-font-size:12.0pt;font-family:Oxygen; color:red;mso-ansi-language:EN-US'> <br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen'>The J23119 is the most effective and common constitutive promoter used. It has a length of 35bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:1'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="Picture_x0020_11" o:spid="_x0000_s1067" type="#_x0000_t75" style='position:absolute; left:0;text-align:left;margin-left:12.55pt;margin-top:1.55pt;width:52.6pt; height:49.9pt;z-index:251669504;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image015.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=70 height=67 src="https://static.igem.org/mediawiki/2014hs/3/30/CDSCIDEB.jpg" align=left hspace=12 v:shapes="Picture_x0020_11"><![endif]></p><br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #934BC9 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;mso-border-bottom-alt:solid #934BC9 .5pt; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa%C2%AD_B0034">BBa_B0034</a><br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen'>This specific RBS is based on Elowitz repressilator. It has a length of 12bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:2'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1063" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:8.4pt;margin-top:2.55pt;width:52.8pt;height:39.05pt; z-index:251673600;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image017.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1063" DrawAspect="Content" ObjectID="_1464162126"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=70 height=52 src="https://static.igem.org/mediawiki/2014hs/5/54/CDS2CIDEB.jpg" align=left hspace=12 v:shapes="_x0000_s1063"><![endif]></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #934BC9 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #934BC9 .5pt; background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888000">BBa_K888000</a><br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'>L2. This CDS gives the property for binding silica and glass surfaces to <i>E. coli</i>, it has a length of 819 bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:3'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1064" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:8.65pt;margin-top:2.15pt;width:52.55pt;height:40.65pt; z-index:251675648;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image019.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1064" DrawAspect="Content" ObjectID="_1464162127"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=70 height=54 src="https://static.igem.org/mediawiki/2014hs/f/f2/CDS3CIDEB.jpg" align=left hspace=12 v:shapes="_x0000_s1064"><i><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:major-fareast;mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:major-bidi;mso-ansi-language:EN-US'> <o:p></o:p><br />
</span></i></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888001">BBa_K888001 </a><br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen'>AIDA-I is synthetized as a 132 kDa pre-protein featuring a signal peptide which is cleaved during transport trough the inner membrane, a 78 kDa adhesin (passenger) domain, and a 45 kDa translocator. This autotransporter has a large capability in translocating relatively large passengers from 12-65 kDa by showing a N-terminal type of fusion. Coupled with a passenger domain and a signal peptide (<a href="http://parts.igem.org/Part:BBa_K888005">K888005</a>), it is possible to express functional proteins in the outer membrane of <i>E. coli</i>.<br />
<br />
<span style='mso-spacerun:yes'> <br />
</span>It has a length of 1482 bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:4;height:122.1pt'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:122.1pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'>&nbsp;</p> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1065" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:9.8pt;margin-top:3.6pt;width:50.05pt;height:38.05pt; z-index:251677696;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image021.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1065" DrawAspect="Content" ObjectID="_1464162128"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=67 height=51 src="https://static.igem.org/mediawiki/2014hs/d/d5/CIDEBCDS5.jpg" align=left hspace=12 v:shapes="_x0000_s1065"><![endif]><i><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font: major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font: major-bidi;mso-ansi-language:EN-US'><o:p></o:p><br />
</span></i></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt; height:122.1pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888005">BBa_K888005</a> <br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt; height:122.1pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen'>When this part is coupled with a passenger attached to AIDA-I translocator domain (<a href="http://parts.igem.org/Part:BBa_K888005">K888001</a>), it is possible to express functional proteins in the outer membrane of <i>E. coli</i>. The signal peptide is naturally cleaved during transport trough the inner membrane (Li et al. 2007; van Bloois et al. 2011).It has a length of 147 bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:5;mso-yfti-lastrow:yes;height:51.65pt'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1066" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:17.8pt;margin-top:3.2pt;width:32.25pt;height:44.6pt; z-index:251679744;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image023.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1066" DrawAspect="Content" ObjectID="_1464162130"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=43 height=59 src="https://static.igem.org/mediawiki/2014hs/d/d7/STOP.jpg" align=left hspace=12 v:shapes="_x0000_s1066"><![endif]><i><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font: major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font: major-bidi;mso-ansi-language:EN-US'> <o:p></o:p><br />
</span></i></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_B1002">BBa_B1002</a><br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen; mso-ansi-language:EN-US'>Part made of 6bp, responsible for stopping transcription.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr><br />
</table><br />
</div></center><br />
<br><br />
<br />
<p><b><h2>Justifications</h2></b></p><br />
<br />
<p>Although <i>E. coli</i> could acquire the ability to bind to silica, a biological filter was designed to remove bacteria from water. The team´s proposed biofilter is shown next:</p><br />
<br />
<center><p><img width=236 height=346 src="https://static.igem.org/mediawiki/2014hs/e/e2/Biofiltro.png"align=center hspace=12 alt="IMG_0317"></p></center><center><br />
<br />
<p><b>Figure 6.</b> The team's proposed biofilter model</p></center> <br />
<br />
<p>Silica was chosen as the ideal material because it is cheap and it is commonly found and also because the team wanted to give this material a new use. It was also chosen in order to finish the <a href="https://2012.igem.org/Team:UANL_Mty-Mexico">UANL Mexico 2012</a> team work. They created a circuit to make <i>E. coli</i> bind to silica, but as they did not prove it, we wanted to determine if it is functional.</p><br />
<br />
<p>AIDA-1 allows the expression of proteins larger than small peptides in the outer membrane, which is why it is the best option to use with L2. AIDA-I was obtained by PCR by <a href="https://2012.igem.org/Team:UANL_Mty-Mexico">UANL Mexico 2012</a>, so we decided use their piece for our project, as it was easy for the team to obtain it because both of the teams are in the same city.</p><br />
<br />
<p><b><h2>Other teams that used it</h2></b></p><br />
<br />
<p><b><a href="https://2012.igem.org/Team:UANL_Mty-Mexico">UANL México 2012</a>:</b> They proposed the fusion protein for using it to binding silica after detect and capture arsenic acid in groundwater, and in that way removed the pollutant arsenic acid from the water, as part of water bioremediation. However, their project was not finished.</p><br />
<br />
<p><h2><b>Union Module Zoom In</b></h2></p></br><center><iframe width="640" height="390" src="//www.youtube.com/embed/PC6pQ6gfT9A" frameborder="0" allowfullscreen></iframe></center><br />
<br><br />
<br />
<p><b><h2>Bibliography/References</h2></b></p><font size="2"><br />
<br />
<p>● Antiquity. (2003). <i>Part:BBa_B0034</i>. Retrieved March 30th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034">http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034</a>.</p><br />
<br />
<p>● iGEM2006_Berkeley. (2006). <i>Part:BBa_J23119</i>. Retrieved April 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119">http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119</a>.</p><br />
<br />
<p>● iGEM12_UANL_Mty-Mexico. (2012). <i>Part BBa_K888000</i>. Retrieved March 29th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888000">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888000</a>.</p> <br />
<br />
<p>● iGEM12_UANL_Mty-Mexico. (2012). <i>Part BBa_K888001</i>. Retrieved March 29th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888001">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888001</a>.</p> <br />
<br />
<p>● iGEM12_UANL_Mty-Mexico. (2012) <i>Part BBa_K888005</i>. Retrieved March 29th,2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888005">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888005</a>.</p> <br />
<br />
<p>● UANL Mexico. (2012). <i>Recovery module</i>. Retrieved March 28th,2014, from <a href="https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery">https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery</a>.</p> </p></font><br />
<br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union#"><font color="blue">Return to the Top</font></a></p><br />
</div><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html>{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_raceTeam:CIDEB-UANL Mexico/hp race2014-06-20T18:27:59Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Race for Science</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=290 height=139 src=" https://static.igem.org/mediawiki/2014hs/b/b2/CIDEBHPcarrera1.png"/><br />
<center><p><b>Image 1.</b> Race for Science logo.</p></center><br />
</td><br />
<td><br />
<p> As it is said: <i>“Mens sana in corpore sano” </i> (healthy mind in a healthy body), we, as a team, believe that everyone should enjoy a healthy life, in which there is a balance between study and physical activity.</p><br />
<p>So after making the “Explosion”, once people knew what we do in iGEM, we wanted to expand the knowledge and interest of people about our project. That's why we decided to organize this "Carrera por la Ciencia" (Race for Science), which included a circuit of about 4 kilometers and at the end a fair with entertaining games related to the project in a way that people could spend time together as a family and learn at the same time. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p>Thus, the event gave us the ability to combine the information about our project and synthetic biology, with physical exercise. This last concept is particularly important for us, especially in Mexico, where the rates of obesity and sedentary lifestyle are disturbing. </p><br />
<br />
<p><b><h2> Objectives</h2></b></p> <br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=280 height=174 src="https://static.igem.org/mediawiki/2014hs/0/02/CIDEBHPcarrera3.jpg"/><br />
<center><p><b>Image 2.</b> Obesity chart among different countries.</p></center><br />
</td><br />
<td><br />
<p> According to an article from the United Nations Food and Agricultural Organization (FAO), Mexico is considered as the world's fattest country with a 32.8 percent adult obesity rate, surpassing United States' 31.8 obesity rate. About 70 percent of Mexican adults are considered to be overweight.</p><br />
<p>Monterrey is an industrial city where most people lead stressful and sedentary lifestyles. We, as a part of this society, are too familiar with the dangers of obesity and the prevalent lack of healthy diet and exercise habits. </p><br />
<p>This, combined with the need to develop our project in the Human Practices area, is the reason why we felt motivated to organize this Race for Science. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<p><b> The main purposes of the Race for Science were:</p></b><br />
<p> • To spread information about the project within both the academic and non-academic community, in a fun, innovating and accessible way </p><br />
<p> • To promote physical activities that have a beneficial impact on human health and thus, help cultivate a balance between body and mind </p><br />
<br />
<p>The event was promoted through a personal invitation to the people in our high school, and they were suggested to invite their family members and/or friends to join them. Posters were also made with all the information about the event; they were placed in different parts of the school and simultaneously posted digitally on the official page of the iGEM CIDEB team on Facebook. </p><br />
<br><br />
<p><b><h2> 1st Stage of the Race: Physical Activity</h2></b></p> <br />
<br />
<p>The race was held within the “Mederos” campus of the UANL. The attendees were asked to arrive at 6:30 a.m., so that the event could start at 7:00 a.m. We welcomed about 600 participants, ranging in age from 7 years old to third age.</p><br />
<br />
<p>At 7:00 am a warm-up session was performed. The session was developed with the help of a professional, who lead a dance for about 30 minutes, turning conventional exercises into something fun. The mascot of our team had a very active participation in the warm-up, which encouraged the people to do the exercises properly and enthusiastically. </p><br />
<br />
<p>We then proceeded to take the participants to the start area. The women’s group was the first one to start running, followed 5 minutes later by the men’s group.</p><br />
<br />
<p>The start of the route was the main entrance to our school. Then, the road stretched by the campus’ internal streets to the Faculty of Economics, and then the participants resumed their route in the opposite direction of the streets to return to the entrance of the school. </p><br />
<br></div><br />
<br />
<center><table width=80%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:px;"><img width=400 height=270 src="https://static.igem.org/mediawiki/2014hs/e/e5/CIDEBHPcarrera4.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://static.igem.org/mediawiki/2014hs/0/01/CIDEBHPcarrera5.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://static.igem.org/mediawiki/2014hs/5/5c/CIDEBHPcarrera6.png"/></td><br />
<br />
</tr></table></center><br />
<br />
<center><p><b>Image 3.</b> Images of people during the race.</p></center><br />
<br />
<br><br />
<div class="container-text"><br />
<p><b><h2> 2nd Stage of the Race: Project information</h2></b></p><br />
<br />
<p>Along the route, there were people on the sidewalks with informative signs about different synthetic biology fun facts, general information about the project, about the impact that our project would have on society, etc... At the halfway point, several people could be found giving away small bags of water to hydrate the runners.</p><br />
<br />
<p>At this point, we had already accomplished one of the main objectives of the race (to promote physical activity). The next step was encouraging people to learn more about our project (and have some fun while doing so). </p><br />
<br />
<p> At the end of the route, the participants returned to the starting point (the parking of the school). In this place, there were different modules with information relevant to our project. Each module included an allusive game to every action of the bacterium (Capture, Union, Resistance and Aroma), so that people could learn in an easy and interactive way. Thus, while participants took a break, they could observe and receive a brief explanation of our project, and they could play and get coupons which could be exchanged for prizes. </p><br />
<br />
<center><table width=80%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:px;"><img width=252 height=395 src="https://static.igem.org/mediawiki/2014hs/c/c7/CIDEBHPcarrera7.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=544 height=387 src="https://static.igem.org/mediawiki/2014hs/9/9c/CIDEBHPcarrera8.jpg"/></td><br />
<br />
<br />
</tr></table></center><br />
<br />
<center><p><b>Image 4.</b> People participating in the project games.</p></center><br />
<br />
<p><b><h2>Impact</h2></b></p> <br />
<br />
<p>Two weeks before, the students learned from the DNA WEEK what was our project about, so they made comments such as “Hi E.CARU!” to our costume, or “Is this from iGEM?” and “How can I get in?” to our team members. Even in the game time, when looking at it, some of them were able to recognize easily the parts referring to our project. (Each game was created to give a reference about our project, its modules and their function). </p><br />
<br />
<p>People, who were not students and hadn’t received those talks, were asking about the iGEM team and the project that we are working on. They asked how does it work, how did we do it, what will it be able to do, and more. They were very interested; even though they did not want to play because they were older, they were paying attention while the younger ones were playing and listened to the explanation that the team members gave.</p><br />
<br />
<p>The race was a complete success. We had received supportive comments during it, and we realized that people were interested in what we are doing. The assistants gained knowledge about our project while having a good time, spending time with their families and friends.</p><br />
<center><br />
<object width="550" height="413"> <param name="flashvars" value="offsite=true&lang=es-us&page_show_url=%2Fphotos%2F125091096%40N05%2Fsets%2F72157645103124014%2Fshow%2F&page_show_back_url=%2Fphotos%2F125091096%40N05%2Fsets%2F72157645103124014%2F&set_id=72157645103124014&jump_to="></param> <param name="movie" value="https://www.flickr.com/apps/slideshow/show.swf?v=143270"></param> <param name="allowFullScreen" value="true"></param><embed type="application/x-shockwave-flash" src="https://www.flickr.com/apps/slideshow/show.swf?v=143270" allowFullScreen="true" flashvars="offsite=true&lang=es-us&page_show_url=%2Fphotos%2F125091096%40N05%2Fsets%2F72157645103124014%2Fshow%2F&page_show_back_url=%2Fphotos%2F125091096%40N05%2Fsets%2F72157645103124014%2F&set_id=72157645103124014&jump_to=" width="550" height="413"></embed></object><br />
</center><br />
<br />
<center><p><b>Gallery 1.</b> Images of the race.</p></center><br />
<br />
<p><b><h2>Opinions after the race</h2></b></p><br />
<br />
<center><iframe width="640" height="390" src="//www.youtube.com/embed/7RfgAoWs63I" frameborder="0" allowfullscreen></iframe></center><br />
<br />
<p><b><h2>Bibliography/References</h2></b></p> <br />
<font size="2pt"><br />
United Nations Food and Agricultural Organization (FAO). (2008). <i>The state of food and agriculture.</i> Retrieved from: <a href="http://www.fao.org/docrep/018/i3300e/i3300e.pdf">http://www.fao.org/docrep/018/i3300e/i3300e.pdf</a></font><br><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_raceTeam:CIDEB-UANL Mexico/hp race2014-06-20T18:26:19Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Race for Science</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=290 height=139 src=" https://static.igem.org/mediawiki/2014hs/b/b2/CIDEBHPcarrera1.png"/><br />
<center><p><b>Image 1.</b> Race for Science logo.</p></center><br />
</td><br />
<td><br />
<p> As it is said: <i>“Mens sana in corpore sano” </i> (healthy mind in a healthy body), we, as a team, believe that everyone should enjoy a healthy life, in which there is a balance between study and physical activity.</p><br />
<p>So after making the “Explosion”, once people knew what we do in iGEM, we wanted to expand the knowledge and interest of people about our project. That's why we decided to organize this "Carrera por la Ciencia" (Race for Science), which included a circuit of about 4 kilometers and at the end a fair with entertaining games related to the project in a way that people could spend time together as a family and learn at the same time. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p>Thus, the event gave us the ability to combine the information about our project and synthetic biology, with physical exercise. This last concept is particularly important for us, especially in Mexico, where the rates of obesity and sedentary lifestyle are disturbing. </p><br />
<br />
<p><b><h2> Objectives</h2></b></p> <br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=280 height=174 src="https://static.igem.org/mediawiki/2014hs/0/02/CIDEBHPcarrera3.jpg"/><br />
<center><p><b>Image 2.</b> Obesity chart among different countries.</p></center><br />
</td><br />
<td><br />
<p> According to an article from the United Nations Food and Agricultural Organization (FAO), Mexico is considered as the world's fattest country with a 32.8 percent adult obesity rate, surpassing United States' 31.8 obesity rate. About 70 percent of Mexican adults are considered to be overweight.</p><br />
<p>Monterrey is an industrial city where most people lead stressful and sedentary lifestyles. We, as a part of this society, are too familiar with the dangers of obesity and the prevalent lack of healthy diet and exercise habits. </p><br />
<p>This, combined with the need to develop our project in the Human Practices area, is the reason why we felt motivated to organize this Race for Science. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<p><b> The main purposes of the Race for Science were:</p></b><br />
<p> • To spread information about the project within both the academic and non-academic community, in a fun, innovating and accessible way </p><br />
<p> • To promote physical activities that have a beneficial impact on human health and thus, help cultivate a balance between body and mind </p><br />
<br />
<p>The event was promoted through a personal invitation to the people in our high school, and they were suggested to invite their family members and/or friends to join them. Posters were also made with all the information about the event; they were placed in different parts of the school and simultaneously posted digitally on the official page of the iGEM CIDEB team on Facebook. </p><br />
<br><br />
<p><b><h2> 1st Stage of the Race: Physical Activity</h2></b></p> <br />
<br />
<p>The race was held within the “Mederos” campus of the UANL. The attendees were asked to arrive at 6:30 a.m., so that the event could start at 7:00 a.m. We welcomed about 600 participants, ranging in age from 7 years old to third age.</p><br />
<br />
<p>At 7:00 am a warm-up session was performed. The session was developed with the help of a professional, who lead a dance for about 30 minutes, turning conventional exercises into something fun. The mascot of our team had a very active participation in the warm-up, which encouraged the people to do the exercises properly and enthusiastically. </p><br />
<br />
<p>We then proceeded to take the participants to the start area. The women’s group was the first one to start running, followed 5 minutes later by the men’s group.</p><br />
<br />
<p>The start of the route was the main entrance to our school. Then, the road stretched by the campus’ internal streets to the Faculty of Economics, and then the participants resumed their route in the opposite direction of the streets to return to the entrance of the school. </p><br />
<br></div><br />
<br />
<center><table width=80%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:px;"><img width=400 height=270 src="https://static.igem.org/mediawiki/2014hs/e/e5/CIDEBHPcarrera4.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://static.igem.org/mediawiki/2014hs/0/01/CIDEBHPcarrera5.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://static.igem.org/mediawiki/2014hs/5/5c/CIDEBHPcarrera6.png"/></td><br />
<br />
</tr></table></center><br />
<br />
<center><p><b>Image 3.</b> Images of people during the race.</p></center><br />
<br />
<br><br />
<div class="container-text"><br />
<p><b><h2> 2nd Stage of the Race: Project information</h2></b></p><br />
<br />
<p>Along the route, there were people on the sidewalks with informative signs about different synthetic biology fun facts, general information about the project, about the impact that our project would have on society, etc... At the halfway point, several people could be found giving away small bags of water to hydrate the runners.</p><br />
<br />
<p>At this point, we had already accomplished one of the main objectives of the race (to promote physical activity). The next step was encouraging people to learn more about our project (and have some fun while doing so). </p><br />
<br />
<p> At the end of the route, the participants returned to the starting point (the parking of the school). In this place, there were different modules with information relevant to our project. Each module included an allusive game to every action of the bacterium (Capture, Union, Resistance and Aroma), so that people could learn in an easy and interactive way. Thus, while participants took a break, they could observe and receive a brief explanation of our project, and they could play and get coupons which could be exchanged for prizes. </p><br />
<br />
<center><table width=80%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:px;"><img width=252 height=395 src="https://static.igem.org/mediawiki/2014hs/c/c7/CIDEBHPcarrera7.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=544 height=387 src="https://static.igem.org/mediawiki/2014hs/9/9c/CIDEBHPcarrera8.jpg"/></td><br />
<br />
<br />
</tr></table></center><br />
<br />
<center><p><b>Image 4.</b> People participating in the project games.</p></center><br />
<br />
<p><b><h2>Impact</h2></b></p> <br />
<br />
<p>Two weeks before, the students learned from the DNA WEEK what was our project about, so they made comments such as “Hi E.CARU!” to our costume, or “Is this from iGEM?” and “How can I get in?” to our team members. Even in the game time, when looking at it, some of them were able to recognize easily the parts referring to our project. (Each game was created to give a reference about our project, its modules and their function). </p><br />
<br />
<p>People, who were not students and hadn’t received those talks, were asking about the iGEM team and the project that we are working on. They asked how does it work, how did we do it, what will it be able to do, and more. They were very interested; even though they did not want to play because they were older, they were paying attention while the younger ones were playing and listened to the explanation that the team members gave.</p><br />
<br />
<p>The race was a complete success. We had received supportive comments during it, and we realized that people were interested in what we are doing. The assistants gained knowledge about our project while having a good time, spending time with their families and friends.</p><br />
<center><br />
<object width="550" height="413"> <param name="flashvars" value="offsite=true&lang=es-us&page_show_url=%2Fphotos%2F125091096%40N05%2Fsets%2F72157645103124014%2Fshow%2F&page_show_back_url=%2Fphotos%2F125091096%40N05%2Fsets%2F72157645103124014%2F&set_id=72157645103124014&jump_to="></param> <param name="movie" value="https://www.flickr.com/apps/slideshow/show.swf?v=143270"></param> <param name="allowFullScreen" value="true"></param><embed type="application/x-shockwave-flash" src="https://www.flickr.com/apps/slideshow/show.swf?v=143270" allowFullScreen="true" flashvars="offsite=true&lang=es-us&page_show_url=%2Fphotos%2F125091096%40N05%2Fsets%2F72157645103124014%2Fshow%2F&page_show_back_url=%2Fphotos%2F125091096%40N05%2Fsets%2F72157645103124014%2F&set_id=72157645103124014&jump_to=" width="550" height="413"></embed></object><br />
</center><br />
<br />
<center><p><b>Gallery 1.</b> Images of the race.</p></center><br />
<br />
<p><b><h2>Opinions after the race</h2></b></p<br />
<br />
<center><iframe width="640" height="390" src="//www.youtube.com/embed/7RfgAoWs63I" frameborder="0" allowfullscreen></iframe></center><br />
<br />
<p><b><h2>Bibliography/References</h2></b></p> <br />
<font size="2pt"><br />
United Nations Food and Agricultural Organization (FAO). (2008). <i>The state of food and agriculture.</i> Retrieved from: <a href="http://www.fao.org/docrep/018/i3300e/i3300e.pdf">http://www.fao.org/docrep/018/i3300e/i3300e.pdf</a></font><br><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_overviewTeam:CIDEB-UANL Mexico/math overview2014-06-20T18:16:22Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_math}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<!-- MathJax (LaTeX for the web) --><br />
<script type="text/x-mathjax-config"><br />
MathJax.Hub.Config({tex2jax: {inlineMath: [['$','$'], ['\\(','\\)']]}});<br />
MathJax.Hub.Config({<br />
TeX: { <br />
equationNumbers: { autoNumber: "AMS" }<br />
}<br />
});<br />
</script><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Overview</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b><h2>When Biology meets Math</h2></b></p><br />
<br />
<p>For iGEM projects, the use of mathematical models is necessary to predict the behavior of a biological machine, representing the quantitative relations between two or more variables involved in the function and expression of a gene or a set of genes in organisms like <i>E. coli</i>.</p><br />
<p>Our team decided to use a deterministic model to simulate and represent the function of the four modules, assuming that the variables (mRNA and protein concentrations) adopt a continuous behavior and obey kinetic rules that can be represented with constant values.</p><br />
<br />
<p>This type of mathematical model is used to include variables that considerate both, the gene expression and the physiological cycles (chemical process, transport of proteins, etc.). By the use of traditional differential equations we were able to construct the description and analyze the behavior of mRNAs and protein production. We were focused in determine through a mathematical model the ideal behavior of the four modules independently.<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture</a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">A</b>roma</a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance </a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union</a></p><br />
<br />
<p><b><h2>Deterministic Modelling: Equations and Parameters</h2></b></p><br />
<br />
<p>As it was previously stated, it was necessary to work with different equations, focused in the production and degradation rate of proteins, according to the length of the genes in each module. This was performed in order to obtain both, the concentration rates of mRNA and protein based on system (gene) length and protein length respectively.</p><br />
<br />
<br><p><b>Equations</b></p><br />
<br />
<p>● <b>mRNA</b><p><br />
<br />
<p>Generally, to describe the amount of mRNA produced over <i>t</i> time, the equation implemented is shown below:</p><br />
<br />
<br><br />
\begin{equation}<br />
\large \frac{d[mRNA]}{dt} = \alpha_{1} \cdot f_{y} - d_{1}[mRNA]<br />
\end{equation}<br><br />
<br />
<br><p>Where: <b><i>“&#945;<sub>1</sub>”</i></b> means the transcription rate of a given gene; <b><i>“f<sub>y</sub>”</i></b> represents a regulatory function (if there is) that can activate or inhibit the system; and <b><i>“d<sub>1 </sub> [mRNA]”</i></b> the degradation rate of the mRNA produced.</p><br />
<br />
<p>● <b>Protein</b><p><br />
<br />
<p>The same happens with the protein production, but differs in the formula because it also involves a post-translational variable:</p><br><br />
<br />
<br><br />
\begin{equation}<br />
\large \frac{d[P]}{dt} = \alpha_{2} \cdot[mRNA] - d_{2}[P] - f_{post}<br />
\end{equation}<br><br />
<br />
<br><p>Where: <b><i>“&#945;<sub>2 </sub> [mRNA]”</i></b> means the translation rate of a protein based on the amount of mRNA available; <b><i>“d<sub>2</sub>”[P]</i></b> represents the degradation rate of that protein; and <b><i>“f<sub>post</sub>"</i></b> the posttranslational variables which affect the production of the final (functional) protein.<p><br />
<br />
<br><p><b>Parameters</b></p><br />
<br />
<p>To determine both the transcription <b>(1)</b> and translation <b>(2)</b> rates, the parameters from <a href="https://2008.igem.org/Team:NTU-Singapore">Singapore 2008</a> team, at wich<i> E. coli</i> carries out transcription and translation were used ; as well as the degradation rates from <a href="https://2009.igem.org/Team:PKU_Beijing">PKU Beijing 2009</a>. The parameters <i></i> from <a href="https://2008.igem.org/Team:NTU-Singapore">Singapore 2008</a> were used, assuming a transcription speed of <i>70nt/s</i> and a translation speed of <i>40aa/s</i>. The speeds were multiplied by 60, because minutes were used as units in the simulations of the modules. We assumed that <i>E. coli</i> division time was 30min based on <a href="https://2009.igem.org/Team:PKU_Beijing">PKU Beijing 2009</a> team.</p><br />
<br><br />
<br />
<br><br />
\begin{equation}<br />
\large \alpha_{1} = \frac{transcription speed}{gene length (nt)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{2} = \frac{translation speed}{protein length (aa)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{1} = \frac{70 \frac {nt}{s} \cdot(60)}{gene length (nt)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{2} = \frac{40 \frac {aa}{s} \cdot(60)}{protein length (aa)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{1} = \frac{1}{half-life(min)} + \frac{1}{division time (min)} <br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{2} = \frac{1}{half-life(min)} + \frac{1}{division time (min)} <br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{1} = \frac{1}{half-life(min)} + \frac{1}{30min} <br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{2} = \frac{1}{half-life(min)} + \frac{1}{30min}<br />
\end{equation}<br><br />
<br />
<br />
<p><b><br />
<h2>Bibliography/References</h2><br />
</b></p><br />
<br />
<font size="2"><br />
<p>● DIBDEN, David, J. G. (2005). In vivo cycling of the Escherichia coli transcription factor FNR between active and inactive states. <i>Microbiology</i>, 4063-4070.</p><br />
<p>● SELINGER, Douglas R. M. (2003). Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. <i>Genome Research</i>, 216-223.</p><br />
<p>● iGEM CIDEB UANL. (2012). <i>Modelling: Equations.</i>Retrieved from: <a href="https://2012hs.igem.org/Team:CIDEB-UANL_Mexico/Math/Overview">https://2012hs.igem.org/Team:CIDEB-UANL_Mexico/Math/Overview</a>.</p><br />
<p>● HARE, James K. T. (1991). Mechanisms of plasma membrane protein degradation: Recycling proteins are degraded more rapidly than those confined to the cell surface. <i>PNAS</i>, 5902-5906.</p><br />
<p>● BERGANT, Martina N. M. (2010). <i>Modification of Human Papillomavirus Minor Capsid Protein L2 by Sumoylation Journal of Virology</i>, 11585-11589.</p><br />
<p>● NTU Singapore. (2008). <i>Modelling: Parameters</i>. Retrieved from: <a href="https://2008.igem.org/Team:NTU-Singapore/Modelling/Parameter">https://2008.igem.org/Team:NTU-Singapore/Modelling/Parameter</a>.</p><br />
<p>● PKU Beijing. (2009).<i>Modelling: Parameters</i>. Retrieved from: <a href="https://2009.igem.org/Team:PKU_Beijing/Modeling/Parameters">https://2009.igem.org/Team:PKU_Beijing/Modeling/Parameters</a>.</p><br />
<p>● VORACKOVA Irena, S. S. (2011). Purification of proteins containing zinc finger domains using Immobilized Metal Ion Affinity Chromatography. <i>Protein Expression and Purification</i>, 88-95.</p><br />
<br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_overview#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_resultsTeam:CIDEB-UANL Mexico/labwork results2014-06-20T18:08:23Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_labwork}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Results</h2><br />
<br />
<div class="wrapper"><br />
<center><div class="container2"><br />
<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Construction" class="button2">Biobricks construction</a><br />
<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Experiments" class="button2">Experiments</a><br />
</div></center><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<br />
<p><h2><font size="6"><b><a name="Construction"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Construction" target="_blank">Biobricks construction</a></b></font>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>Here are the results of how the team got the modules of the project</p><br />
<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Minipreps" class="button2">Minipreps</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Digestions" class="button2">Digestions</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Purifications" class="button2">Purification</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Ligations" class="button2">Ligations</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Characterization" class="button2">Characterization</a></p><br />
<br />
<p><h2><b><a name="Minipreps"></a>Minipreps</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>The first step to build up the four modules in bio-brick format with the vector pSB1C3 is to isolate the plasmid DNA from the bacteria through a mini prep.</p><br />
<p>The next electrophoresis geles (<b>Image 1</b>) shows that the extraction of the DNA was performed correctly.<br />
As in the beginning it was planned to put the four modules in vectors with different antibiotic resistance (such as pSB1C3, pSB1T3, pSB1A3 and pSB1K3) in a single <i>E. col</i>, but the team decided to first insert all of the genes in pSB1C3 so they could be sent to the parts registry.</p><br />
<center><p><img width=1000 height=400 src="https://static.igem.org/mediawiki/2014hs/2/2e/Geles_miniprep_of_all_genes_cideps.jpg" align=center hspace=12></p></center><br />
<center><p><font size="3"><b>Image 1.</b> Electrophoresis geles showing the plasmid DNA gotten from mini preps of bacteria transformed with pUC57-NhaS, pUC57-BSMT1 opt., pUC57-AIDA, pUC57-L2, pSB1C3-RFP, pSB1K3-RFP and pSB1A3-RFP.</font></p></center><br />
<br><br />
<br />
<p><b><h2><a name=Digestions></a>Digestions</b>-<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>The next step of obtaining the DNA is get only the needed fragment for the project, this would be accomplished through a digestion with the enzymes of the biobrick format: EcoRI and PstI (In the case of pSB1C3, nhaS and BSMT1 opt.). But in the case of the union module, there is a fusion protein, it means that the digestion of AIDA and L2 (parts of the fusion protein) is with other enzymes, the first with PstI and BglII, and the second with EcoRI and BamHI.</p><br />
<p>In the digestion made in order to get the plasmid pSB1C3 and the gene NhaS (<b>Image 2.</b> right gel) both were differentiated from their respective insert (RFP) and plasmid (pUC57) by its length. The plasmid stays in the upper part of the gel while the insert stays below it.</p><br />
<p>The same happened with the digestion of BSMT1 opt., AIDA and L2 (<b>Image 2.</b> left gel) the genes were differentiated by its length.</p><br />
<center><p><img width=655 height=330 src="https://static.igem.org/mediawiki/2014hs/a/ad/Important_Digestions_CIDEB_.jpg" align=center hspace=12></p><br />
<p><font size="3"><b>Image 2.</b>In the left gel: Gel of digestion of pSB1C3 (left black square) and NhaS (right black square). In the right gel: Gel of digestion of pSB1C3 (upper left square), AIDA, L2 and BMST1 opt. (In that order, the tree black squares of the right).</font></p></center><br />
<br><br />
<br />
<p><h2><b><a name="Purifications"></a>Purification</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p> There is not need of make all the purification process of the fragments gotten in the digestion, easily the ligation can be done. But to make sure that only the pieces that were wanted to ligate, were together, it was done a purification. Then to confirm that there were only the fragments such as pSB1C3, BSTM1 opt. L2 and AIDA, it was made an electrophoresis gel:</p><br />
<center><p><img width=390 height=390 src="https://static.igem.org/mediawiki/2014hs/8/82/Purification_of_all_genes_less_NhaS.jpg"align=center hspace=12></center></p><br />
<center><p><b>Image 3.</b> Electrophoresis geles of digestion after purification process after. The "M" before the first well of the gel, stands for Mark</p></center><br />
<br><br />
<br />
<p><h2><b><a name="Ligations"></a>Ligations</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>After the purification of the digestions was made, the fragments were ligated with their respective gene-plasmid. Then bacteria were transformed with those ligations and inoculated in a Petri dish obtaining the next result:</p><br />
<p><b><a name="Ligation"></a>Ligation of NhaS and pSB1C3 <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank"><font color="red">[Capture Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></p><br />
<p>In the first transformation of the ligation of NhaS and pSB1C3 grew red (expressing RFP) and white bacteria. The Petri dish was not cover by aluminum after its inoculation. </p><br />
<center><p><img width=420 height=260 src="https://static.igem.org/mediawiki/2014hs/4/43/Ligation1cideb2014.png"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 4. </b>NhaS first ligation with pSB1C3. Result of the transformation of the ligation between NhaS and pSB1C3.</font></p></center><br />
<p>There was a second transformation of the same ligation, also it was inoculated in a Petri dish getting <b>Image 5.</b> as result. There were also present red and white bacteria. The Petri dish was not cover by aluminum after its inoculation.</p><br />
<center><p><img width=420 height=260 src="https://static.igem.org/mediawiki/2014hs/4/4b/NhaS_%2B_pSB1C3_Ligation_.jpg"<br />
align=center hspace=12></p><br />
<p><font size="3"><b>Image 5.</b>NhaS first ligation with pSB1C3. Result of the transformation of the ligation between NhaS and pSB1C3. </font></p></center><br />
<br><br />
<p><b><a name="Ligation2"></a>Result of ligation BSMT1 (optimized) and pSB1C3 <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><font color="red">[Aroma Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></p><br />
<p>The main gene of the aroma module, BSMT1 opt. was ligated with pSB1C3, and then transformed in bacteria in order to be inoculated. In the resulting inoculation there were only white colonies of bacteria.<br />
<center><p><img width=380 src="https://static.igem.org/mediawiki/2014hs/7/7c/Aroma_%2B_pSB1C3.jpg"<br />
align=center hspace=12></center></p><br />
<center><p><font size="3"><b>Image 6.</b>Colonies obtained from the transformation of the ligation BSMT1 opt and pSB1C3. </font></p></center><br />
<br><br />
<p><h2><b><a name="Characterization"></a>Characterization</b>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p><b>Capture module characterization</b></p><br />
<p>Once NhaS was in pSB1C3, it was needed to prove it through a characterization, also there was the question of why in the ligation there were red and white bacteria, if all had the plasmid to chloramphenicol resistance (reason they lived). Which of the two types really had NhaS?. To know with which enzyme make the digestion, it was made a digital digestion of the plasmid and the insert getting the next result:</p><br />
<center><p><img width=470 height=330 src="https://static.igem.org/mediawiki/2014hs/a/a2/Virtual_digestion_of_NhaS_in_pSB1C3.jpg"<br />
align=center hspace=12></p><br />
<p><b>Image 7.</b> Virtual digestion of NhaS (yellow) +RFP (red) +pSB1C3 (purple) by the enzyme Arsl (blue), showing that its restriction site is repeated two times, one in NhaS and other in pSB1C3. </center></p><br />
<br><br />
<p>The problem was that the enzyme that cuts NhaS and pSB1C3 was not available to the team, and it would take a long time to get it. To solve this problem, it was sent the DNA to be sequenced and then prove that the ligation actually occurred, and NhaS was inside pSB1C3. It was used a primer that is from 5' to 3' in the complementary chain:</p><br />
<p><pre><br />
5´ATTACCGCCTTTGAGTGAGC 3'<br />
</p></pre><br />
The result of the sequencing of the mini prep of the bacteria transformed with NhaS in pSB1C3 that showed the RFP production was the next: <br />
<p><pre><br />
3' AAAGTGTCCACCCCGTACGACCGAGCGGAGCGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTAATCTTTTCGGCTTAAAGAAAAAGGGCAGGGTGGTGACA<br />
CCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTATATAAACGCAGAAAGGCCCACCCGAAGGTGAGCCAGTGTGACTCTAGTAGAGAGCGTTCACCGACAAA<br />
CAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCTCTAGTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGT<br />
GGAGTGACGACCTTCAGCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACC<br />
GGTTTTTTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGAGCACCGTCTTCCGGGTACA<br />
TACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTG<br />
CAGGGAGGAGTCCTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCCG<br />
GGTGTTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGAACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTTCAGTTTAGCGGTCTCGGGTA<br />
CCTTCGAACGGACGACCTTCACCTTCACCCTTCAATTTTCAAACTCGTGACCGTAAACGGAACCTTTCCATACAACTTTGAAAACGCATGAAACTCATTTGAATAACGTCT<br />
TCCGGAAGAAAGCCCAATCTAAGTATTTTCTCCCTCTTTTCTCATATAAATGTGATGAATATTTGATCTATCCGCCCTCCAACAACTTTCCCACAACAATCATGTATCGAAAT<br />
TCCTGTTATACGACACTATAAAGATGGTATAAAAAGCCCGTGGAGGGGGCGTGACCA 5'<br />
</pre></p><br />
<br><br />
<p>And this is the sequence obtained from the miniPrep of the white bacteria transformed with NhaS:</p><br />
<p><pre><br />
3' TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACCTGCATAACGC<br />
GAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACT<br />
AGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTACCTTCAGCACGTTCGTACTGTTCA<br />
ACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTT<br />
TTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTC<br />
AGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGAC<br />
GGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACA<br />
CCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCC<br />
GGGTGTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTG<br />
GTAACTTTCAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTT<br />
AACGGAACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTCGCTTAC<br />
AAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTTTGCCATGCAGATT<br />
CCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGTAA 5'<br />
</pre></p><br />
<br><br />
<p><b>Aroma module characterization</b></p><br />
<p>To characterize the aroma module, the process of sequencing was made too</p><br />
<p><pre><br />
3' TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACCTGCATAACGC<br />
GAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACT<br />
AGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTACCTTCAGCACGTTCGTACTGTTCA<br />
ACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTT<br />
TTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTC<br />
AGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGAC<br />
GGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACA<br />
CCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCC<br />
GGGTGTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTG<br />
GTAACTTTCAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTT<br />
AACGGAACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTCGCTTAC<br />
AAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTTTGCCATGCAGATT<br />
CCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGTAA 5'<br />
</pre><p><br />
<br><br />
<p><h2><font size="6"><b><a name="Experiments"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Experiments" target="_blank">Experiments</a></b></font>- <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<p>It is needed to characterize and prove the modules, here are the results of the experiments made in order to accomplish it.</p><br />
<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#UV" class="button2">Capture</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#AromaRe1" class="button2">Aroma</a></p><br />
<br />
<p><h2><b><a name="UV"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#UVExp" target="_blank">UV Experimentation </a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p>During 2 hours the four Petri dishes were exposed to UV irradiation. None of them showed any change. </p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/7/75/First_UV_irradiation_Experiment.jpg"<br />
align=center hspace=12></p><br />
<p><font size="2"><b>Image 4.</b>Petri Dish inoculated with NhaS in pSB1C3 exposed to UV irradiation at 302 nm. Before, no time being exposed (left) and after 2 hours of being exposed (right). </font></p></center><br />
<br />
<br />
<p><h2><b><a name="RepetitionUV"></a>Repetition UV Experimentation </b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p>Two Petri dishes inoculated by streak: One with NhaS Red and the other with NhaS White. Both exposed during 30 minutes to UV irradiation at 302 nm and none of them showed any change. </p><br />
<p>With no time exposed to UV irradiation: <br />
</p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/1/18/Before_NhaS_Video.jpg"<br />
align=center hspace=12></p><br />
<p><font size="2"><b>Image 5.</b>Nhas in pSB1C3 before being exposed to UV irradiation. </font></p></center><br />
<br />
<p>After 30 minutes: <br />
</p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/a/a6/After_NhaS_Video_.jpg"<br />
align=center hspace=12></p><br />
<p><font size="2"><b>Image 6.</b>Nhas in pSB1C3 before being exposed to UV irradiation. </font></p></center><br />
<br />
<br />
<br />
<p><h2><b><a name="Salt1"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Viability" target="_blank">Viability in Salt. Experiment 1</a> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank"><font color="red">[Capture Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<br />
<p>Bacteria transformed with the capture plasmid were inoculated in Petri dishes with different concentrations of salt</p><br />
<br />
<center><p><img width=380 height=260 src="https://static.igem.org/mediawiki/2014hs/e/e2/Rojas_NhaS_experiment_1.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="2"><b>Image 7. </b>All the 18 Petri dishes inoculated with NhaS Red in pSB1C3 of all the 9 used concentrations.</font></p></center><br />
<br><br />
<br />
<center><p><img width=380 height=260 src="https://static.igem.org/mediawiki/2014hs/2/28/Blancas_NhaS_experimen_1.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="2"><b>Image 8. </b>All the 18 Petri dishes inoculated with NhaS White in pSB1C3 of all the 9 used concentrations.</font></p></center><br />
<br><br />
<br />
<center><p><img width=380 height=260 src="https://static.igem.org/mediawiki/2014hs/1/12/Control_Expriment_1_NhaS_.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="2"><b>Image 9. </b>All the 18 Petri dishes inoculated with the Control bacteria of all the 9 used concentrations.</font></p></center><br />
<p>All the bacteria containing the NhaS in pSB1C3 (Red and White) survived to a 10% concentration of salt.</p> <br />
<p>None of the control group lived in any concentration of salt.</p><br />
<br><br />
<br />
<center><p><img width=262 height=403 src="https://static.igem.org/mediawiki/2014hs/2/28/Experiment_1_Maximum_concentration_of_salt..jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><font size="2"><b>Image 10. </b>Nine Petri dishes with the maximum concentration of salt (10%) used in this experiment. From up to bottom: NhaS Red in pSB1C3, NhaS White in pSB1C3 and the Control bacteria.</font></p></center> <br />
<br><br />
<br />
<p><h2><b><a name="Salt2"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#Viability" target="_blank">Viability in Salt. Experiment 2</a> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank"><font color="red">[Capture Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<br />
<p>As in the Experiment 1, bacteria transformed with the capture plasmid were inoculated in Petri dishes with different concentrations of salt, but this time the mayor concentration is higher (15%) </p><p><br />
All the bacteria transformed with NhaS in pSB1C3 (Red and White) lived in the 15% saline medium. </p><p><br />
All the control bacteria exposed to any concentration of salt died.</p><p><br />
All the control bacteria inoculated only in LB medium (without salt) lived. <br />
</p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/7/75/Max_concentration_od_salt_experiment_2_.jpg"<br />
align=center hspace=12></p><br />
<p><font size="2"><b>Image 11. </b>In the upper left part NhaS Red in pSB1C3 at 15% of salt. In the upper right part NhaS Whit in pSB1C3 at 15% of salt. In the lower left part the Control bacteria at 15% of salt. In the lower right part the Control bacteria with only LB medium (without salt) </font></p></center> <br />
<br><br />
<br />
<p><b>Experiment 3</b></p><br />
<p>AQUI D: </p><br />
<br><br />
<br />
<p><h2><b><a name="AromaRe1"></a><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#AromaExp" target="_blank"> Aroma Qualitative Experiments</a> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><font color="red">[Aroma Module]</font></a></b> - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the top</font></a></h2></p><br />
<br />
<p><b>Experiment 1 - Test tubes</b></p><br />
<br />
<p> AQUI S; </p><br />
<br />
<p><b>Experiment 2 - Petri dishes</b></p><br />
<p>Random people were chosen to smell our bacteria, four people per each concentration. The experiment was performed with three different concentrations of salicylic acid, which were of 10 mM, 20 mM, and 30 mM. All of the samples contained salicylic acid. There was a controlled group grown bellow and above the 32 ºC and a group with transformed bacteria with the Aroma module, also grown bellow and above the 32 ºC; per each concentration. </p><br />
<p>Those are the words that people used to repeat, or synonyms of what the said, because all the opinions were described in a different way. </p><br />
<br />
<center><table style="background-color:#FFFFFF" width="80%" cellpadding="2"><br />
<tr style='background-color:#3C3C3C'><br />
<td></td><br />
<td><font color="#FFFFFF"><b>Controlled Group Below 32 ºC</b></font></td><br />
<td><font color="#FFFFFF"><b>Group Below 32 ºC</b></font></td><br />
<td><font color="#FFFFFF"><b>Group Above 32 ºC</b></font></td><br />
<td><font color="#FFFFFF"><b>Controlled Group Above 32 ºC</b></font></td><br />
</tr><br />
<tr><br />
<td style='background-color:#3C3C3C'><font color="#FFFFFF"><b>10 mM</b></font></td><br />
<td>Corn</td><br />
<td>Rotten food but with a fresh scent</td><br />
<td>Kind of fresh</td><br />
<td>Ointment or a very Fresh Scent</td><br />
</tr><br />
<tr><br />
<td style='background-color:#3C3C3C'><font color="#FFFFFF"><b>20 mM</b></font></td><br />
<td>Rotten food</td><br />
<td>A little bit fresh</td><br />
<td>Household product. (Fresh)</td><br />
<td>Rotten food</td><br />
</tr><br />
<tr><br />
<td style='background-color:#3C3C3C'><font color="#FFFFFF"><b>30 mM</b></font></td><br />
<td>Rotten food</td><br />
<td>Rotten food</td><br />
<td>Rotten food</td><br />
<td>Rotten food</td><br />
</tr><br />
</table></center><br />
<br><br />
<br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/b/bf/People_smelling_aroma_bacteria.jpg"<br />
align=center hspace=12></p><br />
<p><font size="2"><b>Image 12. </b>People smelling the different Petri dishes previously inoculated with the bacteria transformed with the aroma module in order to describe the odor they perceive. </font></p></center> <br />
<br />
<div style="text-align: left;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_discussions#AromaInt"><font size="2" color="blue">Go to Results Interpretations</font></a></p></div><br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#"><font size="2" color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_captureTeam:CIDEB-UANL Mexico/math capture2014-06-20T17:15:36Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_math}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<!-- MathJax (LaTeX for the web) --><br />
<script type="text/x-mathjax-config"><br />
MathJax.Hub.Config({tex2jax: {inlineMath: [['$','$'], ['\\(','\\)']]}});<br />
MathJax.Hub.Config({<br />
TeX: { <br />
equationNumbers: { autoNumber: "AMS" }<br />
}<br />
});<br />
</script><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Capture Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p>The capture module was based in the use of NhaS gene, but NhaS was not the only gene expressed in the circuit because RFP was used as a reporter, we needed to consider that as a factor. The circuit is shown below:</p><br />
<br />
<br><center><p><img width=334 height=100 src="https://static.igem.org/mediawiki/2014hs/6/60/Nhas_circuit_math.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<br><br />
<p>As it is shown in the circuit, the transcription rate is affected by Uv light. It was needed the use of established parameters with data from NhaS and RFP. Uv promoters, according to Shuang Li’s team (2006), have less efficiency than constitutive promoters, which is aproximately 60% of the constitutive promoters.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \frac{d\left [ mRNA \right ]}{dt}=\alpha_{1}\cdot f_{y}-d1\left [ mRNA \right ]<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large f_{y}=0.6<br />
\end{equation}<br />
<br />
<br><br />
<p>It was assumed that <b><i>“f<sub>y</sub>”</i></b>, is the regulatory function that can activate or inhibit the system of x gene, was 0.6 because of the percentage given by Shuang Li’s team. Uv rays activate the promoter, but it is not as efficient as constitutive promoters in the transcription process.</p><br />
<br />
<p>The parameters from <a href="https://2008.igem.org/Team:NTU-Singapore">Singapore 2008</a> team were used for the translation and transcription rates as well as the speed at which <i>E. coli</i> carries out transcription and translation, assuming a transcription speed of <i>70nt/s</i> and a translation speed of <i>40aa/s</i>. So we used them in the equations below with the NhaS and RFP gene (<i>1019nt</i>), NhaS with <i>69aa</i> and RFP with <i>235aa</i> respectively.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \alpha_{1} =\frac{transcription speed}{gene length (nt)}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2} =\frac{trasnlation speed}{protein length (aa)}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{1}=\frac{(70)(60)}{1019}=4.12<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2}(NhaS)=\frac{(40)(60)}{69}=34.78<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2}(RFP)=\frac{(40)(60)}{235}=10.21<br />
\end{equation}<br />
<br />
<br><br />
<p>Then, the parameters for degradation rates for proteins and mRNAs from <a href="https://2009.igem.org/Team:PKU_Beijing">PKU Beijing 2009</a> team were used :</p><br />
<br />
<br><br />
\begin{equation}<br />
\large D_{i}= \frac{1}{half-life(min)} + \frac{1}{30min} <br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large D_{p} = \frac{1}{half-life(min)} + \frac{1}{30min} <br />
\end{equation}<br />
<br />
<br><br />
<p>However, since NhaS half-life has not been determined yet, it was decided to search for homologous proteins with the same function as NhaS. We found out that the half-life of membrane proteins produced in <i>E. coli</i> range between 2 to 20 hours (Hare, 1991); since NhaS is a membrane protein, it's half life should be between those values. It was decided to use 2 hours as NhaS half-life because of its relatively small size (<i>69aa</i>) .<strong> To obtain the half-life of RFP, the team basethe time on the GFP protein due to the similarity of their functions (fluorescence). Therefore, the half-life of RFP on which we are based is of 8 hours (Longo, 2006).</strong></p><br />
<br />
<p>To determine the average mRNA degradation rate, information from Selinger’s team (2003) was used. The team carried out several experiments to find out the average mRNA half-life in <i>E. coli</i>. They used mRNAs about <i>1100nt</i> in lenght, and they concluded that it has an average half-life of 5min. Based on this information, it was concluded that the mRNA average half-life of NhaS with RFP was 4.63min.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large HL=\frac{1100(nt)}{5min}<br />
\end{equation}<br />
<br />
<br><br />
<p>With all these information, the team was able to find the degradation rates for both, the transcription and translation of NhaS and RFP, respectively.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large d_{1}= \frac{1}{4.63} + \frac{1}{30}=0.25 <br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large d_{2}(NhaS)= \frac{1}{120} + \frac{1}{30}=0.041<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large d_{2}(RFP)= \frac{1}{480} + \frac{1}{30}=0.035<br />
\end{equation}<br />
<br />
<br><br />
<p>For the simulation Simbiology&reg; was used , using the previous data in the equations to calculate the amount of proteins <i>E. coli</i> would produce at certain time. The next graph shows the results of the simulation (assuming <i>E. coli</i> is under UV rays which actives its promoter):</p><br />
<br><br />
<br />
<center><p><img width=500 height=400 src="https://static.igem.org/mediawiki/2014hs/c/c7/Nhas_graph_1.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<br><br />
<p>For translation, there was another factor taken in consideration, the <b><i>“f<sub>post</sub>”</i></b> which were the post-translational variables affecting the production of the functional protein:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \frac{d[P]}{dt} = \alpha_{2} \cdot[mRNA] - d_{2}[P] - f_{post}<br />
\end{equation}<br />
<br />
<br><br />
<p>Since NhaS protein needs to be expressed in <i>E. coli's</i> membrane, the average velocity at which <i>E. coli</i> exports its proteins needed to be calculated. The process by which bacteria exports its proteins is divided into three phases, the “breathing” between translation, the second phase, which is the movement of a protein to the membrane and finally, the translocation in which the protein attaches to the membrane of bacteria (Peskin, 1991). Using this information, we found <i>E. coli</i> completes these three phases at an average of 5 to 6 min, depending on the protein size (Driessen, 1990). 5min were plugged into the data, because NhaS protein is relatively small and it was assumed that RFP had no post-translational variables to consider as well as it was not the protein we wanted to measure.<br />
<p>With the rate of protein transport we could use Simbiology to model the functional NhaS production. The results are shown in next diagrams (assuming <i>E. coli</i> is under UV rays which actives its promoter):</p><br><br />
<br />
<center><p><img width=400 height=300 src="https://static.igem.org/mediawiki/2014hs/e/e1/Nhas_diagram.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<center><p><img width=500 height=400 src="https://static.igem.org/mediawiki/2014hs/1/1f/Nhas_graph_2.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<br><br />
<p>When both graphs were compared (<b>Graph 1</b> and <b>Graph 2</b>) the data shown that NhaS production was functional and that the production of NhaS was really big. It was assumed that this happenned because NhaS is only (<i>69aa</i>) in length. Also it was concluded that NhaS is functional when it is located in the membrane, (by &quot;functional&quot; meaning that it has the potential to capture Na<SUP>+</SUP> ions and be able to give resistance to saline environments in <i>E. coli</i>. As is shown in Graph 2 the amount is of proteins produced are about 6500; we assumed those proteins are ready to bind Na<SUP>+</SUP> ions.</p><br />
<br />
<br><p><b><br />
<h2>Bibliography</h2><br />
</b></p><br />
<br />
<font size="2"><br />
<p>● Arnold Driessen, W. W. (1990). Proton transfer rate-limiting for translocation of precursor proteins by the Escherichia coli translocase. <i>Biochemistry</i>, 2471-2475.</p><br />
<p>● Charles Peskin, S. S. (1991). What drives the translocation of proteins. <i>Biophysics</i>, 3770-3774.</p><br />
<p>● Diane Lonngo, J. H. (2006). Dynamics of single-cell gene expression. <i>Molecular Systems Biology</i>, 1-10.</p><br />
<p>● Douglas Selinger, R. M. (2003). Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. <i>Genome Research</i>, 216-223. </p><br />
<p>● James Hare, K. T. (1991). Mechanisms of plasma membrane protein degradation: Recycling proteins are degraded more rapidly than those confined to the cell surface. <i>PNAS</i>, 5902-5906.</p><br />
<p>● Shuang Li, L. X. (2007). A set of UV-inducible autolytic vectors for high throughput screening. <i>Journal of biotechnology</i>, 647-652.</p><br />
<br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_capture#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_overviewTeam:CIDEB-UANL Mexico/math overview2014-06-20T17:10:26Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_math}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<!-- MathJax (LaTeX for the web) --><br />
<script type="text/x-mathjax-config"><br />
MathJax.Hub.Config({tex2jax: {inlineMath: [['$','$'], ['\\(','\\)']]}});<br />
MathJax.Hub.Config({<br />
TeX: { <br />
equationNumbers: { autoNumber: "AMS" }<br />
}<br />
});<br />
</script><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Overview</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b><h2>When Biology meets Math</h2></b></p><br />
<br />
<p>For iGEM projects, the use of mathematical models is necessary to predict the behavior of a biological machine, representing the quantitative relations between two or more variables involved in the function and expression of a gene or a set of genes in organisms like <i>E. coli</i>.</p><br />
<p>Our team decided to use a deterministic model to simulate and represent the function of the four modules, assuming that the variables (mRNA and protein concentrations) adopt a continuous behavior and obey kinetic rules that can be represented with constant values.</p><br />
<br />
<p>This type of mathematical model is used to include variables that considerate both, the gene expression and the physiological cycles (chemical process, transport of proteins, etc.). By the use of traditional differential equations we were able to construct the description and analyze the behavior of mRNAs and protein production. We were focused in determine through a mathematical model the ideal behavior of the four modules independently.<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture</a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">A</b>roma</a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance </a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union</a></p><br />
<br />
<p><b><h2>Deterministic Modelling: Equations and Parameters</h2></b></p><br />
<br />
<p>As it was previously stated, it was necessary to work with different equations, focused in the production and degradation rate of proteins, according to the length of the genes in each module. This was performed in order to obtain both, the concentration rates of mRNA and protein based on system (gene) length and protein length respectively.</p><br />
<br />
<br><p><b>Equations</b></p><br />
<br />
<p>● <b>mRNA</b><p><br />
<br />
<p>Generally, to describe the amount of mRNA produced over <i>t</i> time, the equation implemented is shown below:</p><br />
<br />
<br><br />
\begin{equation}<br />
\large \frac{d[mRNA]}{dt} = \alpha_{1} \cdot f_{y} - d_{1}[mRNA]<br />
\end{equation}<br><br />
<br />
<br><p>Where: <b><i>“&#945;<sub>1</sub>”</i></b> means the transcription rate of a given gene; <b><i>“f<sub>y</sub>”</i></b> represents a regulatory function (if there is) that can activate or inhibit the system; and <b><i>“d<sub>1 </sub> [mRNA]”</i></b> the degradation rate of the mRNA produced.</p><br />
<br />
<p>● <b>Protein</b><p><br />
<br />
<p>The same happens with the protein production, but differs in the formula because it also involves a post-translational variable:</p><br><br />
<br />
<br><br />
\begin{equation}<br />
\large \frac{d[P]}{dt} = \alpha_{2} \cdot[mRNA] - d_{2}[P] - f_{post}<br />
\end{equation}<br><br />
<br />
<br><p>Where: <b><i>“&#945;<sub>2 </sub> [mRNA]”</i></b> means the translation rate of a protein based on the amount of mRNA available; <b><i>“d<sub>2</sub>”[P]</i></b> represents the degradation rate of that protein; and <b><i>“f<sub>post</sub>"</i></b> the posttranslational variables which affect the production of the final (functional) protein.<p><br />
<br />
<br><p><b>Parameters</b></p><br />
<br />
<p>To determine both the transcription <b>(1)</b> and translation <b>(2)</b> rates, the parameters from <a href="https://2008.igem.org/Team:NTU-Singapore">Singapore 2008</a> team, at wich<i> E. coli</i> carries out transcription and translation were used ; as well as the degradation rates from <a href="https://2009.igem.org/Team:PKU_Beijing">PKU Beijing 2009</a>. The parameters <i></i> from <a href="https://2008.igem.org/Team:NTU-Singapore">Singapore 2008</a> were used, assuming a transcription speed of <i>70nt/s</i> and a translation speed of <i>40aa/s</i>. The speeds were multiplied by 60, because minutes were used as units in the simulations of the modules. We assumed that <i>E. coli</i> division time was 30min based on <a href="https://2009.igem.org/Team:PKU_Beijing">PKU Beijing 2009</a> team.</p><br />
<br><br />
<br />
<br><br />
\begin{equation}<br />
\large \alpha_{1} = \frac{transcription speed}{gene length (nt)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{2} = \frac{translation speed}{protein length (aa)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{1} = \frac{70 \frac {nt}{s} \cdot(60)}{gene length (nt)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{2} = \frac{40 \frac {aa}{s} \cdot(60)}{protein length (aa)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{1} = \frac{1}{half-life(min)} + \frac{1}{division time (min)} <br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{2} = \frac{1}{half-life(min)} + \frac{1}{division time (min)} <br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{1} = \frac{1}{half-life(min)} + \frac{1}{30min} <br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{2} = \frac{1}{half-life(min)} + \frac{1}{30min}<br />
\end{equation}<br><br />
<br />
<br />
<p><b><br />
<h2>Bibliography/References</h2><br />
</b></p><br />
<br />
<font size="2"><br />
<p>● David Dibden, J. G. (2005). In vivo cycling of the Escherichia coli transcription factor FNR between active and inactive states. <i>Microbiology</i>, 4063-4070.</p><br />
<p>● Douglas Selinger, R. M. (2003). Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. <i>Genome Research</i>, 216-223.</p><br />
<p>● iGEM CIDEB UANL. (2012). <i>Modelling: Equations.</i>Retrieved from: <a href="https://2012hs.igem.org/Team:CIDEB-UANL_Mexico/Math/Overview">https://2012hs.igem.org/Team:CIDEB-UANL_Mexico/Math/Overview</a>.</p><br />
<p>● James Hare, K. T. (1991). Mechanisms of plasma membrane protein degradation: Recycling proteins are degraded more rapidly than those confined to the cell surface. <i>PNAS</i>, 5902-5906.</p><br />
<p>● Martina Bergant, N. M. (2010). <i>Modification of Human Papillomavirus Minor Capsid Protein L2 by Sumoylation Journal of Virology</i>, 11585-11589.</p><br />
<p>● NTU Singapore. (2008). <i>Modelling: Parameters</i>. Retrieved from: <a href="https://2008.igem.org/Team:NTU-Singapore/Modelling/Parameter">https://2008.igem.org/Team:NTU-Singapore/Modelling/Parameter</a>.</p><br />
<p>● PKU Beijing. (2009).<i>Modelling: Parameters</i>. Retrieved from: <a href="https://2009.igem.org/Team:PKU_Beijing/Modeling/Parameters">https://2009.igem.org/Team:PKU_Beijing/Modeling/Parameters</a>.</p><br />
<p>● Vorackova Irena, S. S. (2011). Purification of proteins containing zinc finger domains using Immobilized Metal Ion Affinity Chromatography. <i>Protein Expression and Purification</i>, 88-95.</p><br />
<br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_overview#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_overviewTeam:CIDEB-UANL Mexico/math overview2014-06-20T17:01:26Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_math}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<!-- MathJax (LaTeX for the web) --><br />
<script type="text/x-mathjax-config"><br />
MathJax.Hub.Config({tex2jax: {inlineMath: [['$','$'], ['\\(','\\)']]}});<br />
MathJax.Hub.Config({<br />
TeX: { <br />
equationNumbers: { autoNumber: "AMS" }<br />
}<br />
});<br />
</script><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Overview</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b><h2>When Biology meets Math</h2></b></p><br />
<br />
<p>For iGEM projects, the use of mathematical models is necessary to predict the behavior of a biological machine, representing the quantitative relations between two or more variables involved in the function and expression of a gene or a set of genes in organisms like <i>E. coli</i>.</p><br />
<p>Our team decided to use a deterministic model to simulate and represent the function of the four modules, assuming that the variables (mRNA and protein concentrations) adopt a continuous behavior and obey kinetic rules that can be represented with constant values.</p><br />
<br />
<p>This type of mathematical model is used to include variables that considerate both, the gene expression and the physiological cycles (chemical process, transport of proteins, etc.). By the use of traditional differential equations we were able to construct the description and analyze the behavior of mRNAs and protein production. We were focused in determine through a mathematical model the ideal behavior of the four modules independently.<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture</a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">A</b>roma</a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance </a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union</a></p><br />
<br />
<p><b><h2>Deterministic Modelling: Equations and Parameters</h2></b></p><br />
<br />
<p>As it was previously stated, it was necessary to work with different equations, focused in the production and degradation rate of proteins, according to the length of the genes in each module. This was performed in order to obtain both, the concentration rates of mRNA and protein based on system (gene) length and protein length respectively.</p><br />
<br />
<br><p><b>Equations</b></p><br />
<br />
<p>● <b>mRNA</b><p><br />
<br />
<p>Generally, to describe the amount of mRNA produced over <i>t</i> time, the equation implemented is shown below:</p><br />
<br />
<br><br />
\begin{equation}<br />
\large \frac{d[mRNA]}{dt} = \alpha_{1} \cdot f_{y} - d_{1}[mRNA]<br />
\end{equation}<br><br />
<br />
<br><p>Where: <b><i>“&#945;<sub>1</sub>”</i></b> means the transcription rate of a given gene; <b><i>“f<sub>y</sub>”</i></b> represents a regulatory function (if there is) that can activate or inhibit the system; and <b><i>“d<sub>1 </sub> [mRNA]”</i></b> the degradation rate of the mRNA produced.</p><br />
<br />
<p>● <b>Protein</b><p><br />
<br />
<p>The same happens with the protein production, but differs in the formula because it also involves a post-translational variable:</p><br><br />
<br />
<br><br />
\begin{equation}<br />
\large \frac{d[P]}{dt} = \alpha_{2} \cdot[mRNA] - d_{2}[P] - f_{post}<br />
\end{equation}<br><br />
<br />
<br><p>Where: <b><i>“&#945;<sub>2 </sub> [mRNA]”</i></b> means the translation rate of a protein based on the amount of mRNA available; <b><i>“d<sub>2</sub>”[P]</i></b> represents the degradation rate of that protein; and <b><i>“f<sub>post</sub>"</i></b> the posttranslational variables which affect the production of the final (functional) protein.<p><br />
<br />
<br><p><b>Parameters</b></p><br />
<br />
<p>To determine both the transcription <b>(1)</b> and translation <b>(2)</b> rates, the parameters from Singapore 2008 iGEM team, at wich<i> E. coli</i> carries out transcription and translation were used ; as well as the degradation rates from Beijing PKU 2009. The parameters <i></i> from Singapore 2008 iGEM were used, assuming a transcription speed of <i>70nt/s</i> and a translation speed of <i>40aa/s</i>. The speeds were multiplied by 60, because minutes were used as units in the simulations of the modules. We assumed that <i>E. coli</i> division time was 30min based on PKU Beijing 2009 iGEM team.</p><br />
<br><br />
<br />
<br><br />
\begin{equation}<br />
\large \alpha_{1} = \frac{transcription speed}{gene length (nt)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{2} = \frac{translation speed}{protein length (aa)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{1} = \frac{70 \frac {nt}{s} \cdot(60)}{gene length (nt)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{2} = \frac{40 \frac {aa}{s} \cdot(60)}{protein length (aa)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{1} = \frac{1}{half-life(min)} + \frac{1}{division time (min)} <br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{2} = \frac{1}{half-life(min)} + \frac{1}{division time (min)} <br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{1} = \frac{1}{half-life(min)} + \frac{1}{30min} <br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{2} = \frac{1}{half-life(min)} + \frac{1}{30min}<br />
\end{equation}<br><br />
<br />
<br />
<p><b><br />
<h2>Bibliography/References</h2><br />
</b></p><br />
<br />
<font size="2"><br />
<p>● David Dibden, J. G. (2005). In vivo cycling of the Escherichia coli transcription factor FNR between active and inactive states. <i>Microbiology</i>, 4063-4070.</p><br />
<p>● Douglas Selinger, R. M. (2003). Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. <i>Genome Research</i>, 216-223.</p><br />
<p>● iGEM CIDEB UANL. (2012). <i>Modelling: Equations.</i>Retrieved from: <a href="https://2012hs.igem.org/Team:CIDEB-UANL_Mexico/Math/Overview">https://2012hs.igem.org/Team:CIDEB-UANL_Mexico/Math/Overview</a>.</p><br />
<p>● James Hare, K. T. (1991). Mechanisms of plasma membrane protein degradation: Recycling proteins are degraded more rapidly than those confined to the cell surface. <i>PNAS</i>, 5902-5906.</p><br />
<p>● Martina Bergant, N. M. (2010). <i>Modification of Human Papillomavirus Minor Capsid Protein L2 by Sumoylation Journal of Virology</i>, 11585-11589.</p><br />
<p>● NTU Singapore. (2008). <i>Modelling: Parameters</i>. Retrieved from: <a href="https://2008.igem.org/Team:NTU-Singapore/Modelling/Parameter">https://2008.igem.org/Team:NTU-Singapore/Modelling/Parameter</a>.</p><br />
<p>● PKU Beijing. (2009).<i>Modelling: Parameters</i>. Retrieved from: <a href="https://2009.igem.org/Team:PKU_Beijing/Modeling/Parameters">https://2009.igem.org/Team:PKU_Beijing/Modeling/Parameters</a>.</p><br />
<p>● Vorackova Irena, S. S. (2011). Purification of proteins containing zinc finger domains using Immobilized Metal Ion Affinity Chromatography. <i>Protein Expression and Purification</i>, 88-95.</p><br />
<br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_overview#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_overviewTeam:CIDEB-UANL Mexico/math overview2014-06-20T16:59:56Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_math}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<!-- MathJax (LaTeX for the web) --><br />
<script type="text/x-mathjax-config"><br />
MathJax.Hub.Config({tex2jax: {inlineMath: [['$','$'], ['\\(','\\)']]}});<br />
MathJax.Hub.Config({<br />
TeX: { <br />
equationNumbers: { autoNumber: "AMS" }<br />
}<br />
});<br />
</script><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Overview</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b><h2>When Biology meets Math</h2><br />
<p>&nbsp;</p><br />
</b>For iGEM projects, the use of mathematical models is necessary to predict the behavior of a biological machine, representing the quantitative relations between two or more variables involved in the function and expression of a gene or a set of genes in organisms like <i>E. coli</i>.<br />
<p>Our team decided to use a deterministic model to simulate and represent the function of the four modules, assuming that the variables (mRNA and protein concentrations) adopt a continuous behavior and obey kinetic rules that can be represented with constant values.</p><br />
<br />
<p>This type of mathematical model is used to include variables that considerate both, the gene expression and the physiological cycles (chemical process, transport of proteins, etc.). By the use of traditional differential equations we were able to construct the description and analyze the behavior of mRNAs and protein production. We were focused in determine through a mathematical model the ideal behavior of the four modules independently.<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture</a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">A</b>roma</a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance </a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union</a></p><br />
<br />
<p><b><h2>Deterministic Modelling: Equations and Parameters</h2></b></p><br />
<br />
<p>As it was previously stated, it was necessary to work with different equations, focused in the production and degradation rate of proteins, according to the length of the genes in each module. This was performed in order to obtain both, the concentration rates of mRNA and protein based on system (gene) length and protein length respectively.</p><br />
<br />
<br><p><b>Equations</b></p><br />
<br />
<p>● <b>mRNA</b><p><br />
<br />
<p>Generally, to describe the amount of mRNA produced over <i>t</i> time, the equation implemented is shown below:</p><br />
<br />
<br><br />
\begin{equation}<br />
\large \frac{d[mRNA]}{dt} = \alpha_{1} \cdot f_{y} - d_{1}[mRNA]<br />
\end{equation}<br><br />
<br />
<br><p>Where: <b><i>“&#945;<sub>1</sub>”</i></b> means the transcription rate of a given gene; <b><i>“f<sub>y</sub>”</i></b> represents a regulatory function (if there is) that can activate or inhibit the system; and <b><i>“d<sub>1 </sub> [mRNA]”</i></b> the degradation rate of the mRNA produced.</p><br />
<br />
<p>● <b>Protein</b><p><br />
<br />
<p>The same happens with the protein production, but differs in the formula because it also involves a post-translational variable:</p><br><br />
<br />
<br><br />
\begin{equation}<br />
\large \frac{d[P]}{dt} = \alpha_{2} \cdot[mRNA] - d_{2}[P] - f_{post}<br />
\end{equation}<br><br />
<br />
<br><p>Where: <b><i>“&#945;<sub>2 </sub> [mRNA]”</i></b> means the translation rate of a protein based on the amount of mRNA available; <b><i>“d<sub>2</sub>”[P]</i></b> represents the degradation rate of that protein; and <b><i>“f<sub>post</sub>"</i></b> the posttranslational variables which affect the production of the final (functional) protein.<p><br />
<br />
<br><p><b>Parameters</b></p><br />
<br />
<p>To determine both the transcription <b>(1)</b> and translation <b>(2)</b> rates, the parameters from Singapore 2008 iGEM team, at wich<i> E. coli</i> carries out transcription and translation were used ; as well as the degradation rates from Beijing PKU 2009. The parameters <i></i> from Singapore 2008 iGEM were used, assuming a transcription speed of <i>70nt/s</i> and a translation speed of <i>40aa/s</i>. The speeds were multiplied by 60, because minutes were used as units in the simulations of the modules. We assumed that <i>E. coli</i> division time was 30min based on PKU Beijing 2009 iGEM team.</p><br />
<br><br />
<br />
<br><br />
\begin{equation}<br />
\large \alpha_{1} = \frac{transcription speed}{gene length (nt)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{2} = \frac{translation speed}{protein length (aa)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{1} = \frac{70 \frac {nt}{s} \cdot(60)}{gene length (nt)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{2} = \frac{40 \frac {aa}{s} \cdot(60)}{protein length (aa)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{1} = \frac{1}{half-life(min)} + \frac{1}{division time (min)} <br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{2} = \frac{1}{half-life(min)} + \frac{1}{division time (min)} <br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{1} = \frac{1}{half-life(min)} + \frac{1}{30min} <br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{2} = \frac{1}{half-life(min)} + \frac{1}{30min}<br />
\end{equation}<br><br />
<br />
<br />
<p><b><br />
<h2>Bibliography/References</h2><br />
</b></p><br />
<br />
<font size="2"><br />
<p>● David Dibden, J. G. (2005). In vivo cycling of the Escherichia coli transcription factor FNR between active and inactive states. <i>Microbiology</i>, 4063-4070.</p><br />
<p>● Douglas Selinger, R. M. (2003). Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. <i>Genome Research</i>, 216-223.</p><br />
<p>● iGEM CIDEB UANL. (2012). <i>Modelling: Equations.</i>Retrieved from: <a href="https://2012hs.igem.org/Team:CIDEB-UANL_Mexico/Math/Overview">https://2012hs.igem.org/Team:CIDEB-UANL_Mexico/Math/Overview</a>.</p><br />
<p>● James Hare, K. T. (1991). Mechanisms of plasma membrane protein degradation: Recycling proteins are degraded more rapidly than those confined to the cell surface. <i>PNAS</i>, 5902-5906.</p><br />
<p>● Martina Bergant, N. M. (2010). <i>Modification of Human Papillomavirus Minor Capsid Protein L2 by Sumoylation Journal of Virology</i>, 11585-11589.</p><br />
<p>● NTU Singapore. (2008). <i>Modelling: Parameters</i>. Retrieved from: <a href="https://2008.igem.org/Team:NTU-Singapore/Modelling/Parameter">V</a>.</p><br />
<p>● PKU Beijing. (2009).<i>Modelling: Parameters</i>. Retrieved from: <a href="https://2009.igem.org/Team:PKU_Beijing/Modeling/Parameters">https://2009.igem.org/Team:PKU_Beijing/Modeling/Parameters</a>.</p><br />
<p>● Vorackova Irena, S. S. (2011). Purification of proteins containing zinc finger domains using Immobilized Metal Ion Affinity Chromatography. <i>Protein Expression and Purification</i>, 88-95.</p><br />
<br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_overview#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_unionTeam:CIDEB-UANL Mexico/project union2014-06-20T16:57:25Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project<br />
</title><br />
<style>body{margin: 0px; width: 100%;padding: 0px;background: #2056ac;font-family: 'Oxygen', sans-serif;font-size: 12pt;background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);}h1, h2, h3{margin: 0;padding-bottom: 5px;color: #404040;}p, ol, ul{margin-top: 0;}ol, ul{padding: 0;list-style: none;}p{line-height: 1.60em;padding- right: 3em;}strong{}a{color: #2056ac;}a:hover{text-decoration: none;}.container{margin: 0px auto;width: 1200px;}.container-text{margin: 0px auto;width: 75%;padding: 0px;font-family: 'Oxygen', sans-serif;font-size: 12pt; text-align: justify;}.wrapper{overflow: hidden;padding: 0em 0em 1em 0em;background: #FFF;}#wrapper1{background: #FFF;}#wrapper2{overflow: hidden;background: #F3F3F3;padding: 5em 0em;text-align: center;}#wrapper3{overflow: hidden;padding: 0em 0em 0em 0em;background: #FFF;}#wrapper4{}#banner{padding-top: 2em;}#welcome{overflow: hidden;width: 1000px;padding: 0em 100px 0em 100px;text-align: center;}#welcome .content{padding: 0em 8em;}#welcome .title h2{}#welcome a,#welcome strong{}.title{margin-bottom: 1em;}.title h2{font-size: 2em;}.title .byline{font-size: 1.1em;color: #6F6F6F#;}#three-column{overflow: hidden;margin-top: 5em;padding-top: 1em;border-top: 1px solid rgba(0,0,0,0.2);text-align: center;}#three-column h2{margin: 1em 0em;font-size: 1.5em;font-weight: 700;}#three-column .icon{position: relative;display: block;margin: 0px auto 0.80em auto;background: none;line-height: 150px;font-size: 4em;width: 150px;height: 100px;border-radius: 100px;border: 6px solid #67128F;text-align: center;color: #FFF;}#three-column #tbox1,#three-column #tbox2,#three-column #tbox3{float: left;width: 320px;padding: 30px 40px 50px 40px;}#three-column .title{text-align: center;}#three-column .title h2{font-size: 1.60em;}#three-column .title .byline{padding-top: 0.50em;font-size: 0.90em;color: #858585;}#three-column .arrow-down{border-top-color: #292929;}ul.tools{margin: 0;padding: 0em 0em 0em 0em;list-style: none;}ul.tools li{display: inline-block;padding: 0em .2em;font-size: 4em;}ul.tools li span{display: none;margin: 0;padding: 0;}ul.tools li a{color: #FFF;}ul.tools li a:before{display: inline-block;background: #1ABC9C;width: 120px;height: 120px;border-radius: 50%;line-height: 120px;text-align: center;color: #FFFFFF;}.button{display: inline-block;margin-top: 2em;padding: 0.8em 2em;background: #64ABD1;line-height: 1.8em;letter-spacing: 1px;text-decoration: none;font-size: 1em;color: #FFF;}.button:before{display: inline-block;background: #8DCB89;margin-right: 1em;width: 40px;height: 40px;line-height: 40px;border-radius: 20px;text-align: center;color: #272925;}.button-small{}#portfolio{overflow: hidden;padding-top: 5em;border-top: 1px solid rgba(0,0,0,0.2);}#portfolio .box{text-align: center;color: rgba(0,0,0,0.5);}#portfolio h3{display: block;padding-bottom: 1em;font-size: 1em;color: rgba(0,0,0,0.6);}#portfolio .title{text-align: center;}#portfolio .title h2{color: rgba(0,0,0,0.8);}.column1,.column2,.column3,.column4{width: 282px;}.column1,.column2,.column3{float: left;margin-right: 24px;}.column4{float: right;}<br />
</style><br />
<br />
<body><br />
<br />
<div class="wrapper"><br />
<br />
<div id="welcome" class="container"> <br />
<br />
<div class="title"> <h2>Union Module</h2> <br />
</div><br />
</div><br />
<br />
<div class="container-text"><br />
<table width=100%><br />
<tr><br />
<td><br />
<br />
<p>After E.CARU performs its other tasks, in order to remove <i>E. coli</i> from the salty water for making it useful, the ability for binding to silica was introduced to the bacteria. Using this ability, it would be easy to clean the water free of bacterium through a biological filter.</p><br />
<br />
</td><br />
<td style="padding-left:12px;"><img width=154 height=133 src="https://static.igem.org/mediawiki/2014hs/c/cf/Logo_silica.png"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<p><b><h2>Description</h2></b></p><br />
<br />
<p><b>L2</b></p><br />
<p>The gene L2 encodes for a protein that is able to attach to silica. Taniguchi et al. reported in 2007 that the L2 ribosomal protein from <i>E. coli</i> strongly binds to silica surfaces, even up to 200 times tighter than poliarginine tags commonly used for protein purification. In their work, Taniguchi et al. (2007) constructed a fusion protein containing L2 and green fluorescent protein (GFP) which kept attached to a silica surface even after been washed for 24 hours with a buffer containing 1 M NaCl (<b>Figure 1</b>). <a href="https://2012.igem.org/Team:UANL_Mty-Mexico">UANL Mexico 2012</a> did not have this piece in stock, so we decided to synthetize L2 along with a peptide signal.</p><br />
<br />
<center><p><img width=237 height=140 src="https://static.igem.org/mediawiki/2014hs/0/05/Silica_washed.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 1.</b> Proteins absorbed to a silica slide and washed for 24 hours a)GFP b) L2-GFP fusion c) R9-GFP fusion. Taken from Taniguchi (2007)</p></center><br />
<br><br />
<br />
<P><b>AIDA</b></p><br />
<p>AIDA-I is an <i>E. coli</i> membrane protein with a passenger domain of 76 kDa exposed to the extracellular space and a transmembrane beta-barrel domain of 45 kDa; the latter has been used to express functional proteins in the cell-membrane of up to 65 kDa (van Bloois et al., 2011). Furthermore passengers coupled to AIDA-I have been reported to reach an expression level of more than 100,000 copies per cell in the outer membrane (Jose and Meyer, 2007). </p><center><br />
<br />
<p><img width=226 height=251 src="https://static.igem.org/mediawiki/2014hs/a/a2/Aida_system.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 2.</b> Schematic representation of AIDA-I carrier protein</p></center><br />
<br><br />
<br />
<p><b>How do L2 and AIDA act together?</b></p><br />
<p>As AIDA is a membrane protein producer and L2 produces a protein for making possible the attachment to silica, the team decided to make a fusion protein, so that the protein produced by L2 can be anchored to the membrane of the bacteria with the help of AIDA, and in that way, binding the E.CARU to silica pearls for being filtered.</p><br />
<br />
<p><b>Why is it important to use BgIII and BamHI to link L2 and AIDA-I?</b></p><br />
<br />
<p>It was needed to join both proteins in order to make a fusion protein, but SpeI and XbaI could not be used to join them because the reading frame would change, coding for a completely different protein. In order to avoid such problem, BgIII and BamHI were used instead, which could join AIDA and L2 without changing the reading frame. The scar produced between BamHI and BgIII, as it is shown in <b>Figure 3</b>, is formed by six bases, respecting the reading frame from both proteins in order to synthetize the correct protein.</p><br />
<br><center><br />
<br />
<p><img width=397 height=222 src="https://static.igem.org/mediawiki/2014hs/b/b5/Bg_y_bam_III.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 3.</b> Example of a ligation using BamHI and BgIII</p></center><br />
<br />
<p><b><h2>Device</h2></b></p><br />
<br />
<p>Initially, L2+AIDA and IrrE, protein for giving resistance to <i>E. coli</i> to adverse conditions (<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance module</a>), were joined together in only one circuit, but we needed to separate them because L2+AIDA has not been tested and it could affect the production of IrrE (see <b>Figure 4.</b>) as well as for testing each module alone.</p><br />
<br />
<center><p><img width=529 height=322 src="https://static.igem.org/mediawiki/2014hs/0/05/Circuit_l2_and_irre.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 4.</b> Circuit for our project and for testing resistance and union modules. </p></center><br />
<br><br />
<br />
<p>The union circuit consists mainly of a constitutive promoter, an RBS, a peptide signal attached to L2 and this attached to AIDA by a scar and a terminator. The device is designed this way in order to produce a protein that helps the bacteria to bind to silica.</p><br />
<br />
<center><p><img width=463 height=101 src="https://static.igem.org/mediawiki/2014hs/9/92/Composicion_silica.png"align=center hspace=12 alt="IMG_0317"></p></center><center><br />
<br />
<p><b>Figure 5.</b> Union Device</p></center><br />
<br><br />
<br />
<p><b><h2>Parts of the module</h2></b></p><br />
<br />
<br><center><br />
<br />
<div><br />
<table border=0 cellspacing=0 cellpadding=0 width=700 style='width:441.4pt;margin-left:25.5pt;border-collapse: collapse;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh: .5pt solid windowtext;mso-border-insidev:.5pt solid windowtext'> <br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-bottom:solid #AE78D6 1.0pt; mso-border-bottom-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:517'><b style='mso-bidi-font-weight: normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font:major-fareast; mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font:major-bidi; mso-bidi-font-style:italic'>IMAGE<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border:none;border-bottom:solid #934BC9 1.0pt; mso-border-bottom-alt:solid #934BC9 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b style='mso-bidi-font-weight: normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font:major-fareast; mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font:major-bidi; mso-bidi-font-style:italic'>CODE<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border:none;border-bottom:solid #AE78D6 1.0pt; mso-border-bottom-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal;tab-stops:85.15pt center 130.35pt;mso-yfti-cnfc:1'><b style='mso-bidi-font-weight:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font: major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font: major-bidi;mso-bidi-font-style:italic'><br />
<br />
<span style='mso-tab-count:2'> <br />
</span>DESCRIPTION<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:0'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #AE78D6 .5pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1062" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:11.6pt;margin-top:3.55pt;width:54.05pt;height:41.3pt; z-index:251671552;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image013.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1062" DrawAspect="Content" ObjectID="_1464162125"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=72 height=55 src="https://static.igem.org/mediawiki/2014hs/e/e0/PromoterCIDEB.jpg" align=left hspace=12 v:shapes="_x0000_s1062"><![endif]><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:major-fareast;mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:major-bidi;mso-ansi-language:EN-US;mso-bidi-font-style: italic'><o:p></o:p><br />
</span></p><br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #934BC9 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #934BC9 .5pt; background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_J23119">BBa_J23119</a><br />
</span><br />
<br />
<span style='font-size:7.0pt;mso-bidi-font-size:12.0pt;font-family:Oxygen; color:red;mso-ansi-language:EN-US'> <br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen'>The J23119 is the most effective and common constitutive promoter used. It has a length of 35bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:1'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="Picture_x0020_11" o:spid="_x0000_s1067" type="#_x0000_t75" style='position:absolute; left:0;text-align:left;margin-left:12.55pt;margin-top:1.55pt;width:52.6pt; height:49.9pt;z-index:251669504;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image015.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=70 height=67 src="https://static.igem.org/mediawiki/2014hs/3/30/CDSCIDEB.jpg" align=left hspace=12 v:shapes="Picture_x0020_11"><![endif]></p><br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #934BC9 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;mso-border-bottom-alt:solid #934BC9 .5pt; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa%C2%AD_B0034">BBa_B0034</a><br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen'>This specific RBS is based on Elowitz repressilator. It has a length of 12bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:2'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1063" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:8.4pt;margin-top:2.55pt;width:52.8pt;height:39.05pt; z-index:251673600;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image017.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1063" DrawAspect="Content" ObjectID="_1464162126"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=70 height=52 src="https://static.igem.org/mediawiki/2014hs/5/54/CDS2CIDEB.jpg" align=left hspace=12 v:shapes="_x0000_s1063"><![endif]></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #934BC9 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #934BC9 .5pt; background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888000">BBa_K888000</a><br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'>L2. This CDS gives the property for binding silica and glass surfaces to <i>E. coli</i>, it has a length of 819 bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:3'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1064" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:8.65pt;margin-top:2.15pt;width:52.55pt;height:40.65pt; z-index:251675648;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image019.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1064" DrawAspect="Content" ObjectID="_1464162127"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=70 height=54 src="https://static.igem.org/mediawiki/2014hs/f/f2/CDS3CIDEB.jpg" align=left hspace=12 v:shapes="_x0000_s1064"><i><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:major-fareast;mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:major-bidi;mso-ansi-language:EN-US'> <o:p></o:p><br />
</span></i></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888001">BBa_K888001 </a><br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen'>AIDA-I is synthetized as a 132 kDa pre-protein featuring a signal peptide which is cleaved during transport trough the inner membrane, a 78 kDa adhesin (passenger) domain, and a 45 kDa translocator. This autotransporter has a large capability in translocating relatively large passengers from 12-65 kDa by showing a N-terminal type of fusion. Coupled with a passenger domain and a signal peptide (<a href="http://parts.igem.org/Part:BBa_K888005">K888005</a>), it is possible to express functional proteins in the outer membrane of <i>E. coli</i>.<br />
<br />
<span style='mso-spacerun:yes'> <br />
</span>It has a length of 1482 bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:4;height:122.1pt'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:122.1pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'>&nbsp;</p> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1065" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:9.8pt;margin-top:3.6pt;width:50.05pt;height:38.05pt; z-index:251677696;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image021.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1065" DrawAspect="Content" ObjectID="_1464162128"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=67 height=51 src="https://static.igem.org/mediawiki/2014hs/d/d5/CIDEBCDS5.jpg" align=left hspace=12 v:shapes="_x0000_s1065"><![endif]><i><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font: major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font: major-bidi;mso-ansi-language:EN-US'><o:p></o:p><br />
</span></i></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt; height:122.1pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888005">BBa_K888005</a> <br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt; height:122.1pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen'>When this part is coupled with a passenger attached to AIDA-I translocator domain (<a href="http://parts.igem.org/Part:BBa_K888005">K888001</a>), it is possible to express functional proteins in the outer membrane of <i>E. coli</i>. The signal peptide is naturally cleaved during transport trough the inner membrane (Li et al. 2007; van Bloois et al. 2011).It has a length of 147 bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:5;mso-yfti-lastrow:yes;height:51.65pt'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1066" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:17.8pt;margin-top:3.2pt;width:32.25pt;height:44.6pt; z-index:251679744;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image023.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1066" DrawAspect="Content" ObjectID="_1464162130"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=43 height=59 src="https://static.igem.org/mediawiki/2014hs/d/d7/STOP.jpg" align=left hspace=12 v:shapes="_x0000_s1066"><![endif]><i><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font: major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font: major-bidi;mso-ansi-language:EN-US'> <o:p></o:p><br />
</span></i></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_B1002">BBa_B1002</a><br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen; mso-ansi-language:EN-US'>Part made of 6bp, responsible for stopping transcription.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr><br />
</table><br />
</div></center><br />
<br><br />
<br />
<p><b><h2>Justifications</h2></b></p><br />
<br />
<p>Although <i>E. coli</i> could acquire the ability to bind to silica, a biological filter was designed to remove bacteria from water. The team´s proposed biofilter is shown next:</p><br />
<br />
<center><p><img width=236 height=346 src="https://static.igem.org/mediawiki/2014hs/e/e2/Biofiltro.png"align=center hspace=12 alt="IMG_0317"></p></center><center><br />
<br />
<p><b>Figure 6.</b> The team's proposed biofilter model</p></center> <br />
<br />
<p>Silica was chosen as the ideal material for our biofilter in order to finish the <a href="https://2012.igem.org/Team:UANL_Mty-Mexico">UANL Mexico 2012</a> team work. They created a circuit to make <i>E. coli</i> bind to silica, but as they did not prove it, we wanted to determine if it is functional.</p><br />
<br />
<p>AIDA-1 allows the expression of proteins larger than small peptides in the outer membrane, which is why it is the best option to use with L2. AIDA-I was obtained by PCR by <a href="https://2012.igem.org/Team:UANL_Mty-Mexico">UANL Mexico 2012</a>, so we decided use their piece for our project, as it was easy for the team to obtain it because both of the teams are in the same city.</p><br />
<br />
<p><b><h2>Other teams that used it</h2></b></p><br />
<br />
<p><b><a href="https://2012.igem.org/Team:UANL_Mty-Mexico">UANL México 2012</a>:</b> They proposed the fusion protein for using it to binding silica after detect and capture arsenic acid in groundwater, and in that way removed the pollutant arsenic acid from the water, as part of water bioremediation. However, their project was not finished.</p><br />
<br />
<p><h2><b>Union Module Zoom In</b></h2></p></br><center><iframe width="640" height="390" src="//www.youtube.com/embed/PC6pQ6gfT9A" frameborder="0" allowfullscreen></iframe></center><br />
<br><br />
<br />
<p><b><h2>Bibliography/References</h2></b></p><font size="2"><br />
<br />
<p>● Antiquity. (2003). <i>Part:BBa_B0034</i>. Retrieved March 30th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034">http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034</a>.</p><br />
<br />
<p>● iGEM2006_Berkeley. (2006). <i>Part:BBa_J23119</i>. Retrieved April 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119">http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119</a>.</p><br />
<br />
<p>● iGEM12_UANL_Mty-Mexico. (2012). <i>Part BBa_K888000</i>. Retrieved March 29th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888000">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888000</a>.</p> <br />
<br />
<p>● iGEM12_UANL_Mty-Mexico. (2012). <i>Part BBa_K888001</i>. Retrieved March 29th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888001">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888001</a>.</p> <br />
<br />
<p>● iGEM12_UANL_Mty-Mexico. (2012) <i>Part BBa_K888005</i>. Retrieved March 29th,2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888005">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888005</a>.</p> <br />
<br />
<p>● UANL Mexico. (2012). <i>Recovery module</i>. Retrieved March 28th,2014, from <a href="https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery">https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery</a>.</p> </p></font><br />
<br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union#"><font color="blue">Return to the Top</font></a></p><br />
</div><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html>{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_unionTeam:CIDEB-UANL Mexico/project union2014-06-20T16:56:51Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project<br />
</title><br />
<style>body{margin: 0px; width: 100%;padding: 0px;background: #2056ac;font-family: 'Oxygen', sans-serif;font-size: 12pt;background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);}h1, h2, h3{margin: 0;padding-bottom: 5px;color: #404040;}p, ol, ul{margin-top: 0;}ol, ul{padding: 0;list-style: none;}p{line-height: 1.60em;padding- right: 3em;}strong{}a{color: #2056ac;}a:hover{text-decoration: none;}.container{margin: 0px auto;width: 1200px;}.container-text{margin: 0px auto;width: 75%;padding: 0px;font-family: 'Oxygen', sans-serif;font-size: 12pt; text-align: justify;}.wrapper{overflow: hidden;padding: 0em 0em 1em 0em;background: #FFF;}#wrapper1{background: #FFF;}#wrapper2{overflow: hidden;background: #F3F3F3;padding: 5em 0em;text-align: center;}#wrapper3{overflow: hidden;padding: 0em 0em 0em 0em;background: #FFF;}#wrapper4{}#banner{padding-top: 2em;}#welcome{overflow: hidden;width: 1000px;padding: 0em 100px 0em 100px;text-align: center;}#welcome .content{padding: 0em 8em;}#welcome .title h2{}#welcome a,#welcome strong{}.title{margin-bottom: 1em;}.title h2{font-size: 2em;}.title .byline{font-size: 1.1em;color: #6F6F6F#;}#three-column{overflow: hidden;margin-top: 5em;padding-top: 1em;border-top: 1px solid rgba(0,0,0,0.2);text-align: center;}#three-column h2{margin: 1em 0em;font-size: 1.5em;font-weight: 700;}#three-column .icon{position: relative;display: block;margin: 0px auto 0.80em auto;background: none;line-height: 150px;font-size: 4em;width: 150px;height: 100px;border-radius: 100px;border: 6px solid #67128F;text-align: center;color: #FFF;}#three-column #tbox1,#three-column #tbox2,#three-column #tbox3{float: left;width: 320px;padding: 30px 40px 50px 40px;}#three-column .title{text-align: center;}#three-column .title h2{font-size: 1.60em;}#three-column .title .byline{padding-top: 0.50em;font-size: 0.90em;color: #858585;}#three-column .arrow-down{border-top-color: #292929;}ul.tools{margin: 0;padding: 0em 0em 0em 0em;list-style: none;}ul.tools li{display: inline-block;padding: 0em .2em;font-size: 4em;}ul.tools li span{display: none;margin: 0;padding: 0;}ul.tools li a{color: #FFF;}ul.tools li a:before{display: inline-block;background: #1ABC9C;width: 120px;height: 120px;border-radius: 50%;line-height: 120px;text-align: center;color: #FFFFFF;}.button{display: inline-block;margin-top: 2em;padding: 0.8em 2em;background: #64ABD1;line-height: 1.8em;letter-spacing: 1px;text-decoration: none;font-size: 1em;color: #FFF;}.button:before{display: inline-block;background: #8DCB89;margin-right: 1em;width: 40px;height: 40px;line-height: 40px;border-radius: 20px;text-align: center;color: #272925;}.button-small{}#portfolio{overflow: hidden;padding-top: 5em;border-top: 1px solid rgba(0,0,0,0.2);}#portfolio .box{text-align: center;color: rgba(0,0,0,0.5);}#portfolio h3{display: block;padding-bottom: 1em;font-size: 1em;color: rgba(0,0,0,0.6);}#portfolio .title{text-align: center;}#portfolio .title h2{color: rgba(0,0,0,0.8);}.column1,.column2,.column3,.column4{width: 282px;}.column1,.column2,.column3{float: left;margin-right: 24px;}.column4{float: right;}<br />
</style><br />
<br />
<body><br />
<br />
<div class="wrapper"><br />
<br />
<div id="welcome" class="container"> <br />
<br />
<div class="title"> <h2>Union Module</h2> <br />
</div><br />
</div><br />
<br />
<div class="container-text"><br />
<table width=100%><br />
<tr><br />
<td><br />
<br />
<p>After E.CARU performs its other tasks, in order to remove <i>E. coli</i> from the salty water for making it useful, the ability for binding to silica was introduced to the bacteria. Using this ability, it would be easy to clean the water free of bacterium through a biological filter.</p><br />
<br />
</td><br />
<td style="padding-left:12px;"><img width=154 height=133 src="https://static.igem.org/mediawiki/2014hs/c/cf/Logo_silica.png"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<p><b><h2>Description</h2></b></p><br />
<br />
<p><b>L2</b></p><br />
<p>The gene L2 encodes for a protein that is able to attach to silica. Taniguchi et al. reported in 2007 that the L2 ribosomal protein from <i>E. coli</i> strongly binds to silica surfaces, even up to 200 times tighter than poliarginine tags commonly used for protein purification. In their work, Taniguchi et al. (2007) constructed a fusion protein containing L2 and green fluorescent protein (GFP) which kept attached to a silica surface even after been washed for 24 hours with a buffer containing 1 M NaCl (<b>Figure 1</b>). <a href="https://2012.igem.org/Team:UANL_Mty-Mexico">UANL Mexico 2012</a> did not have this piece in stock, so we decided to synthetize L2 along with a peptide signal.</p><br />
<br />
<center><p><img width=237 height=140 src="https://static.igem.org/mediawiki/2014hs/0/05/Silica_washed.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 1.</b> Proteins absorbed to a silica slide and washed for 24 hours a)GFP b) L2-GFP fusion c) R9-GFP fusion. Taken from Taniguchi (2007)</p></center><br />
<br><br />
<br />
<P><b>AIDA</b></p><br />
<p>AIDA-I is an <i>E. coli</i> membrane protein with a passenger domain of 76 kDa exposed to the extracellular space and a transmembrane beta-barrel domain of 45 kDa; the latter has been used to express functional proteins in the cell-membrane of up to 65 kDa (van Bloois et al., 2011). Furthermore passengers coupled to AIDA-I have been reported to reach an expression level of more than 100,000 copies per cell in the outer membrane (Jose and Meyer, 2007). </p><center><br />
<br />
<p><img width=226 height=251 src="https://static.igem.org/mediawiki/2014hs/a/a2/Aida_system.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 2.</b> Schematic representation of AIDA-I carrier protein</p></center><br />
<br><br />
<br />
<p><b>How do L2 and AIDA act together?</b></p><br />
<p>As AIDA is a membrane protein producer and L2 produces a protein for making possible the attachment to silica, the team decided to make a fusion protein, so that the protein produced by L2 can be anchored to the membrane of the bacteria with the help of AIDA, and in that way, binding the E.CARU to silica pearls for being filtered.</p><br />
<br />
<p><b>Why is it important to use BgIII and BamHI to link L2 and AIDA-I?</b></p><br />
<br />
<p>It was needed to join both proteins in order to make a fusion protein, but SpeI and XbaI could not be used to join them because the reading frame would change, coding for a completely different protein. In order to avoid such problem, BgIII and BamHI were used instead, which could join AIDA and L2 without changing the reading frame. The scar produced between BamHI and BgIII, as it is shown in <b>Figure 3</b>, is formed by six bases, respecting the reading frame from both proteins in order to synthetize the correct protein.</p><br />
<br><center><br />
<br />
<p><img width=397 height=222 src="https://static.igem.org/mediawiki/2014hs/b/b5/Bg_y_bam_III.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 3.</b> Example of a ligation using BamHI and BgIII</p></center><br />
<br />
<p><b><h2>Device</h2></b></p><br />
<br />
<p>Initially, L2+AIDA and IrrE, protein for giving resistance to <i>E. coli</i> to adverse conditions (<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance module</a>), were joined together in only one circuit, but we needed to separate them because L2+AIDA has not been tested and it could affect the production of IrrE (see <b>Figure 4.</b>) as well as for testing each module alone.</p><br />
<br />
<center><p><img width=529 height=322 src="https://static.igem.org/mediawiki/2014hs/0/05/Circuit_l2_and_irre.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 4.</b> Circuit for our project and for testing resistance and union modules. </p></center><br />
<br><br />
<br />
<p<The union circuit consists mainly of a constitutive promoter, an RBS, a peptide signal attached to L2 and this attached to AIDA by a scar and a terminator. The device is designed this way in order to produce a protein that helps the bacteria to bind to silica.</p><br />
<br />
<center><p><img width=463 height=101 src="https://static.igem.org/mediawiki/2014hs/9/92/Composicion_silica.png"align=center hspace=12 alt="IMG_0317"></p></center><center><br />
<br />
<p><b>Figure 5.</b> Union Device</p></center><br />
<br><br />
<br />
<p><b><h2>Parts of the module</h2></b></p><br />
<br />
<br><center><br />
<br />
<div><br />
<table border=0 cellspacing=0 cellpadding=0 width=700 style='width:441.4pt;margin-left:25.5pt;border-collapse: collapse;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh: .5pt solid windowtext;mso-border-insidev:.5pt solid windowtext'> <br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-bottom:solid #AE78D6 1.0pt; mso-border-bottom-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:517'><b style='mso-bidi-font-weight: normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font:major-fareast; mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font:major-bidi; mso-bidi-font-style:italic'>IMAGE<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border:none;border-bottom:solid #934BC9 1.0pt; mso-border-bottom-alt:solid #934BC9 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b style='mso-bidi-font-weight: normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font:major-fareast; mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font:major-bidi; mso-bidi-font-style:italic'>CODE<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border:none;border-bottom:solid #AE78D6 1.0pt; mso-border-bottom-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal;tab-stops:85.15pt center 130.35pt;mso-yfti-cnfc:1'><b style='mso-bidi-font-weight:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font: major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font: major-bidi;mso-bidi-font-style:italic'><br />
<br />
<span style='mso-tab-count:2'> <br />
</span>DESCRIPTION<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:0'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #AE78D6 .5pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1062" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:11.6pt;margin-top:3.55pt;width:54.05pt;height:41.3pt; z-index:251671552;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image013.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1062" DrawAspect="Content" ObjectID="_1464162125"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=72 height=55 src="https://static.igem.org/mediawiki/2014hs/e/e0/PromoterCIDEB.jpg" align=left hspace=12 v:shapes="_x0000_s1062"><![endif]><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:major-fareast;mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:major-bidi;mso-ansi-language:EN-US;mso-bidi-font-style: italic'><o:p></o:p><br />
</span></p><br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #934BC9 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #934BC9 .5pt; background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_J23119">BBa_J23119</a><br />
</span><br />
<br />
<span style='font-size:7.0pt;mso-bidi-font-size:12.0pt;font-family:Oxygen; color:red;mso-ansi-language:EN-US'> <br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen'>The J23119 is the most effective and common constitutive promoter used. It has a length of 35bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:1'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="Picture_x0020_11" o:spid="_x0000_s1067" type="#_x0000_t75" style='position:absolute; left:0;text-align:left;margin-left:12.55pt;margin-top:1.55pt;width:52.6pt; height:49.9pt;z-index:251669504;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image015.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=70 height=67 src="https://static.igem.org/mediawiki/2014hs/3/30/CDSCIDEB.jpg" align=left hspace=12 v:shapes="Picture_x0020_11"><![endif]></p><br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #934BC9 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;mso-border-bottom-alt:solid #934BC9 .5pt; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa%C2%AD_B0034">BBa_B0034</a><br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen'>This specific RBS is based on Elowitz repressilator. It has a length of 12bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:2'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1063" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:8.4pt;margin-top:2.55pt;width:52.8pt;height:39.05pt; z-index:251673600;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image017.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1063" DrawAspect="Content" ObjectID="_1464162126"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=70 height=52 src="https://static.igem.org/mediawiki/2014hs/5/54/CDS2CIDEB.jpg" align=left hspace=12 v:shapes="_x0000_s1063"><![endif]></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #934BC9 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #934BC9 .5pt; background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888000">BBa_K888000</a><br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'>L2. This CDS gives the property for binding silica and glass surfaces to <i>E. coli</i>, it has a length of 819 bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:3'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1064" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:8.65pt;margin-top:2.15pt;width:52.55pt;height:40.65pt; z-index:251675648;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image019.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1064" DrawAspect="Content" ObjectID="_1464162127"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=70 height=54 src="https://static.igem.org/mediawiki/2014hs/f/f2/CDS3CIDEB.jpg" align=left hspace=12 v:shapes="_x0000_s1064"><i><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:major-fareast;mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:major-bidi;mso-ansi-language:EN-US'> <o:p></o:p><br />
</span></i></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888001">BBa_K888001 </a><br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen'>AIDA-I is synthetized as a 132 kDa pre-protein featuring a signal peptide which is cleaved during transport trough the inner membrane, a 78 kDa adhesin (passenger) domain, and a 45 kDa translocator. This autotransporter has a large capability in translocating relatively large passengers from 12-65 kDa by showing a N-terminal type of fusion. Coupled with a passenger domain and a signal peptide (<a href="http://parts.igem.org/Part:BBa_K888005">K888005</a>), it is possible to express functional proteins in the outer membrane of <i>E. coli</i>.<br />
<br />
<span style='mso-spacerun:yes'> <br />
</span>It has a length of 1482 bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:4;height:122.1pt'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:122.1pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'>&nbsp;</p> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1065" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:9.8pt;margin-top:3.6pt;width:50.05pt;height:38.05pt; z-index:251677696;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image021.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1065" DrawAspect="Content" ObjectID="_1464162128"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=67 height=51 src="https://static.igem.org/mediawiki/2014hs/d/d5/CIDEBCDS5.jpg" align=left hspace=12 v:shapes="_x0000_s1065"><![endif]><i><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font: major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font: major-bidi;mso-ansi-language:EN-US'><o:p></o:p><br />
</span></i></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt; height:122.1pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888005">BBa_K888005</a> <br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt; height:122.1pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen'>When this part is coupled with a passenger attached to AIDA-I translocator domain (<a href="http://parts.igem.org/Part:BBa_K888005">K888001</a>), it is possible to express functional proteins in the outer membrane of <i>E. coli</i>. The signal peptide is naturally cleaved during transport trough the inner membrane (Li et al. 2007; van Bloois et al. 2011).It has a length of 147 bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:5;mso-yfti-lastrow:yes;height:51.65pt'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1066" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:17.8pt;margin-top:3.2pt;width:32.25pt;height:44.6pt; z-index:251679744;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image023.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1066" DrawAspect="Content" ObjectID="_1464162130"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=43 height=59 src="https://static.igem.org/mediawiki/2014hs/d/d7/STOP.jpg" align=left hspace=12 v:shapes="_x0000_s1066"><![endif]><i><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font: major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font: major-bidi;mso-ansi-language:EN-US'> <o:p></o:p><br />
</span></i></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_B1002">BBa_B1002</a><br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen; mso-ansi-language:EN-US'>Part made of 6bp, responsible for stopping transcription.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr><br />
</table><br />
</div></center><br />
<br><br />
<br />
<p><b><h2>Justifications</h2></b></p><br />
<br />
<p>Although <i>E. coli</i> could acquire the ability to bind to silica, a biological filter was designed to remove bacteria from water. The team´s proposed biofilter is shown next:</p><br />
<br />
<center><p><img width=236 height=346 src="https://static.igem.org/mediawiki/2014hs/e/e2/Biofiltro.png"align=center hspace=12 alt="IMG_0317"></p></center><center><br />
<br />
<p><b>Figure 6.</b> The team's proposed biofilter model</p></center> <br />
<br />
<p>Silica was chosen as the ideal material for our biofilter in order to finish the <a href="https://2012.igem.org/Team:UANL_Mty-Mexico">UANL Mexico 2012</a> team work. They created a circuit to make <i>E. coli</i> bind to silica, but as they did not prove it, we wanted to determine if it is functional.</p><br />
<br />
<p>AIDA-1 allows the expression of proteins larger than small peptides in the outer membrane, which is why it is the best option to use with L2. AIDA-I was obtained by PCR by <a href="https://2012.igem.org/Team:UANL_Mty-Mexico">UANL Mexico 2012</a>, so we decided use their piece for our project, as it was easy for the team to obtain it because both of the teams are in the same city.</p><br />
<br />
<p><b><h2>Other teams that used it</h2></b></p><br />
<br />
<p><b><a href="https://2012.igem.org/Team:UANL_Mty-Mexico">UANL México 2012</a>:</b> They proposed the fusion protein for using it to binding silica after detect and capture arsenic acid in groundwater, and in that way removed the pollutant arsenic acid from the water, as part of water bioremediation. However, their project was not finished.</p><br />
<br />
<p><h2><b>Union Module Zoom In</b></h2></p></br><center><iframe width="640" height="390" src="//www.youtube.com/embed/PC6pQ6gfT9A" frameborder="0" allowfullscreen></iframe></center><br />
<br><br />
<br />
<p><b><h2>Bibliography/References</h2></b></p><font size="2"><br />
<br />
<p>● Antiquity. (2003). <i>Part:BBa_B0034</i>. Retrieved March 30th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034">http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034</a>.</p><br />
<br />
<p>● iGEM2006_Berkeley. (2006). <i>Part:BBa_J23119</i>. Retrieved April 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119">http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119</a>.</p><br />
<br />
<p>● iGEM12_UANL_Mty-Mexico. (2012). <i>Part BBa_K888000</i>. Retrieved March 29th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888000">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888000</a>.</p> <br />
<br />
<p>● iGEM12_UANL_Mty-Mexico. (2012). <i>Part BBa_K888001</i>. Retrieved March 29th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888001">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888001</a>.</p> <br />
<br />
<p>● iGEM12_UANL_Mty-Mexico. (2012) <i>Part BBa_K888005</i>. Retrieved March 29th,2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888005">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888005</a>.</p> <br />
<br />
<p>● UANL Mexico. (2012). <i>Recovery module</i>. Retrieved March 28th,2014, from <a href="https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery">https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery</a>.</p> </p></font><br />
<br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union#"><font color="blue">Return to the Top</font></a></p><br />
</div><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html>{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_unionTeam:CIDEB-UANL Mexico/project union2014-06-20T16:55:52Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project<br />
</title><br />
<style>body{margin: 0px; width: 100%;padding: 0px;background: #2056ac;font-family: 'Oxygen', sans-serif;font-size: 12pt;background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);}h1, h2, h3{margin: 0;padding-bottom: 5px;color: #404040;}p, ol, ul{margin-top: 0;}ol, ul{padding: 0;list-style: none;}p{line-height: 1.60em;padding- right: 3em;}strong{}a{color: #2056ac;}a:hover{text-decoration: none;}.container{margin: 0px auto;width: 1200px;}.container-text{margin: 0px auto;width: 75%;padding: 0px;font-family: 'Oxygen', sans-serif;font-size: 12pt; text-align: justify;}.wrapper{overflow: hidden;padding: 0em 0em 1em 0em;background: #FFF;}#wrapper1{background: #FFF;}#wrapper2{overflow: hidden;background: #F3F3F3;padding: 5em 0em;text-align: center;}#wrapper3{overflow: hidden;padding: 0em 0em 0em 0em;background: #FFF;}#wrapper4{}#banner{padding-top: 2em;}#welcome{overflow: hidden;width: 1000px;padding: 0em 100px 0em 100px;text-align: center;}#welcome .content{padding: 0em 8em;}#welcome .title h2{}#welcome a,#welcome strong{}.title{margin-bottom: 1em;}.title h2{font-size: 2em;}.title .byline{font-size: 1.1em;color: #6F6F6F#;}#three-column{overflow: hidden;margin-top: 5em;padding-top: 1em;border-top: 1px solid rgba(0,0,0,0.2);text-align: center;}#three-column h2{margin: 1em 0em;font-size: 1.5em;font-weight: 700;}#three-column .icon{position: relative;display: block;margin: 0px auto 0.80em auto;background: none;line-height: 150px;font-size: 4em;width: 150px;height: 100px;border-radius: 100px;border: 6px solid #67128F;text-align: center;color: #FFF;}#three-column #tbox1,#three-column #tbox2,#three-column #tbox3{float: left;width: 320px;padding: 30px 40px 50px 40px;}#three-column .title{text-align: center;}#three-column .title h2{font-size: 1.60em;}#three-column .title .byline{padding-top: 0.50em;font-size: 0.90em;color: #858585;}#three-column .arrow-down{border-top-color: #292929;}ul.tools{margin: 0;padding: 0em 0em 0em 0em;list-style: none;}ul.tools li{display: inline-block;padding: 0em .2em;font-size: 4em;}ul.tools li span{display: none;margin: 0;padding: 0;}ul.tools li a{color: #FFF;}ul.tools li a:before{display: inline-block;background: #1ABC9C;width: 120px;height: 120px;border-radius: 50%;line-height: 120px;text-align: center;color: #FFFFFF;}.button{display: inline-block;margin-top: 2em;padding: 0.8em 2em;background: #64ABD1;line-height: 1.8em;letter-spacing: 1px;text-decoration: none;font-size: 1em;color: #FFF;}.button:before{display: inline-block;background: #8DCB89;margin-right: 1em;width: 40px;height: 40px;line-height: 40px;border-radius: 20px;text-align: center;color: #272925;}.button-small{}#portfolio{overflow: hidden;padding-top: 5em;border-top: 1px solid rgba(0,0,0,0.2);}#portfolio .box{text-align: center;color: rgba(0,0,0,0.5);}#portfolio h3{display: block;padding-bottom: 1em;font-size: 1em;color: rgba(0,0,0,0.6);}#portfolio .title{text-align: center;}#portfolio .title h2{color: rgba(0,0,0,0.8);}.column1,.column2,.column3,.column4{width: 282px;}.column1,.column2,.column3{float: left;margin-right: 24px;}.column4{float: right;}<br />
</style><br />
<br />
<body><br />
<br />
<div class="wrapper"><br />
<br />
<div id="welcome" class="container"> <br />
<br />
<div class="title"> <h2>Union Module</h2> <br />
</div><br />
</div><br />
<br />
<div class="container-text"><br />
<table width=100%><br />
<tr><br />
<td><br />
<br />
<p>After E.CARU performs its other tasks, in order to remove <i>E. coli</i> from the salty water for making it useful, the ability for binding to silica was introduced to the bacteria. Using this ability, it would be easy to clean the water free of bacterium through a biological filter.</p><br />
<br />
</td><br />
<td style="padding-left:12px;"><img width=154 height=133 src="https://static.igem.org/mediawiki/2014hs/c/cf/Logo_silica.png"/><br />
</td><br />
</tr><br />
</table><br />
<br><br />
<br />
<p><b><h2>Description</h2></b></p><br />
<br />
<p><b>L2</b></p><br />
<p>The gene L2 encodes for a protein that is able to attach to silica. Taniguchi et al. reported in 2007 that the L2 ribosomal protein from <i>E. coli</i> strongly binds to silica surfaces, even up to 200 times tighter than poliarginine tags commonly used for protein purification. In their work, Taniguchi et al. (2007) constructed a fusion protein containing L2 and green fluorescent protein (GFP) which kept attached to a silica surface even after been washed for 24 hours with a buffer containing 1 M NaCl (<b>Figure 1</b>). <a href="https://2012.igem.org/Team:UANL_Mty-Mexico">UANL Mexico 2012</a> did not have this piece in stock, so we decided to synthetize L2 along with a peptide signal.</p><br />
<br />
<center><p><img width=237 height=140 src="https://static.igem.org/mediawiki/2014hs/0/05/Silica_washed.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 1.</b> Proteins absorbed to a silica slide and washed for 24 hours a)GFP b) L2-GFP fusion c) R9-GFP fusion. Taken from Taniguchi (2007)</p></center><br />
<br><br />
<br />
<P><b>AIDA</b></p><br />
<p>AIDA-I is an <i>E. coli</i> membrane protein with a passenger domain of 76 kDa exposed to the extracellular space and a transmembrane beta-barrel domain of 45 kDa; the latter has been used to express functional proteins in the cell-membrane of up to 65 kDa (van Bloois et al., 2011). Furthermore passengers coupled to AIDA-I have been reported to reach an expression level of more than 100,000 copies per cell in the outer membrane (Jose and Meyer, 2007). </p><center><br />
<br />
<p><img width=226 height=251 src="https://static.igem.org/mediawiki/2014hs/a/a2/Aida_system.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 2.</b> Schematic representation of AIDA-I carrier protein</p></center><br />
<br><br />
<br />
<p><b>How do L2 and AIDA act together?</b></p><br />
<p>As AIDA is a membrane protein producer and L2 produces a protein for making possible the attachment to silica, the team decided to make a fusion protein, so that the protein produced by L2 can be anchored to the membrane of the bacteria with the help of AIDA, and in that way, binding the E.CARU to silica pearls for being filtered.</p><br />
<br />
<p><b>Why is it important to use BgIII and BamHI to link L2 and AIDA-I?</b></p><br />
<br />
<p>It was needed to join both proteins in order to make a fusion protein, but SpeI and XbaI could not be used to join them because the reading frame would change, coding for a completely different protein. In order to avoid such problem, BgIII and BamHI were used instead, which could join AIDA and L2 without changing the reading frame. The scar produced between BamHI and BgIII, as it is shown in <b>Figure 3</b>, is formed by six bases, respecting the reading frame from both proteins in order to synthetize the correct protein.</p><br />
<br><center><br />
<br />
<p><img width=397 height=222 src="https://static.igem.org/mediawiki/2014hs/b/b5/Bg_y_bam_III.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 3.</b> Example of a ligation using BamHI and BgIII</p></center><br />
<br />
<p><b><h2>Device</h2></b></p><br />
<br />
<p>Initially, L2+AIDA and IrrE, protein for giving resistance to <i>E. coli</i> to adverse conditions (<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance module</a>), were joined together in only one circuit, but we needed to separate them because L2+AIDA has not been tested and it could affect the production of IrrE (see <b>Figure 4.</b>) as well as for testing each module alone.</p><br />
<br />
<center><p><img width=529 height=322 src="https://static.igem.org/mediawiki/2014hs/0/05/Circuit_l2_and_irre.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 4.</b> Circuit for our project and for testing resistance and union modules. </p></center><br />
<br><br />
<br />
<p<The union circuit consists mainly of a constitutive promoter, an RBS, a peptide signal attached to L2 and this attached to AIDA by a scar and a terminator. The device is designed this way in order to produce a protein that helps the bacteria to bind to silica.</p><br />
<br />
<center><p><img width=463 height=101 src="https://static.igem.org/mediawiki/2014hs/9/92/Composicion_silica.png"align=center hspace=12 alt="IMG_0317"></p></center><center><br />
<br />
<p><b>Figure 5.</b> Union Device</p></center><br />
<br><br />
<br />
<p><b><h2>Parts of the module</h2></b></p><br />
<br />
<br><center><br />
<br />
<div><br />
<table border=0 cellspacing=0 cellpadding=0 width=700 style='width:441.4pt;margin-left:25.5pt;border-collapse: collapse;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh: .5pt solid windowtext;mso-border-insidev:.5pt solid windowtext'> <br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-bottom:solid #AE78D6 1.0pt; mso-border-bottom-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:517'><b style='mso-bidi-font-weight: normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font:major-fareast; mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font:major-bidi; mso-bidi-font-style:italic'>IMAGE<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border:none;border-bottom:solid #934BC9 1.0pt; mso-border-bottom-alt:solid #934BC9 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b style='mso-bidi-font-weight: normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font:major-fareast; mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font:major-bidi; mso-bidi-font-style:italic'>CODE<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border:none;border-bottom:solid #AE78D6 1.0pt; mso-border-bottom-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal;tab-stops:85.15pt center 130.35pt;mso-yfti-cnfc:1'><b style='mso-bidi-font-weight:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font: major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font: major-bidi;mso-bidi-font-style:italic'><br />
<br />
<span style='mso-tab-count:2'> <br />
</span>DESCRIPTION<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:0'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #AE78D6 .5pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1062" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:11.6pt;margin-top:3.55pt;width:54.05pt;height:41.3pt; z-index:251671552;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image013.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1062" DrawAspect="Content" ObjectID="_1464162125"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=72 height=55 src="https://static.igem.org/mediawiki/2014hs/e/e0/PromoterCIDEB.jpg" align=left hspace=12 v:shapes="_x0000_s1062"><![endif]><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:major-fareast;mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:major-bidi;mso-ansi-language:EN-US;mso-bidi-font-style: italic'><o:p></o:p><br />
</span></p><br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #934BC9 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #934BC9 .5pt; background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_J23119">BBa_J23119</a><br />
</span><br />
<br />
<span style='font-size:7.0pt;mso-bidi-font-size:12.0pt;font-family:Oxygen; color:red;mso-ansi-language:EN-US'> <br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen'>The J23119 is the most effective and common constitutive promoter used. It has a length of 35bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:1'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="Picture_x0020_11" o:spid="_x0000_s1067" type="#_x0000_t75" style='position:absolute; left:0;text-align:left;margin-left:12.55pt;margin-top:1.55pt;width:52.6pt; height:49.9pt;z-index:251669504;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image015.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=70 height=67 src="https://static.igem.org/mediawiki/2014hs/3/30/CDSCIDEB.jpg" align=left hspace=12 v:shapes="Picture_x0020_11"><![endif]></p><br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #934BC9 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;mso-border-bottom-alt:solid #934BC9 .5pt; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa%C2%AD_B0034">BBa_B0034</a><br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen'>This specific RBS is based on Elowitz repressilator. It has a length of 12bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:2'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1063" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:8.4pt;margin-top:2.55pt;width:52.8pt;height:39.05pt; z-index:251673600;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image017.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1063" DrawAspect="Content" ObjectID="_1464162126"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=70 height=52 src="https://static.igem.org/mediawiki/2014hs/5/54/CDS2CIDEB.jpg" align=left hspace=12 v:shapes="_x0000_s1063"><![endif]></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #934BC9 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #934BC9 .5pt; background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888000">BBa_K888000</a><br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'>L2. This CDS gives the property for binding silica and glass surfaces to <i>E. coli</i>, it has a length of 819 bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:3'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1064" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:8.65pt;margin-top:2.15pt;width:52.55pt;height:40.65pt; z-index:251675648;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image019.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1064" DrawAspect="Content" ObjectID="_1464162127"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=70 height=54 src="https://static.igem.org/mediawiki/2014hs/f/f2/CDS3CIDEB.jpg" align=left hspace=12 v:shapes="_x0000_s1064"><i><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:major-fareast;mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:major-bidi;mso-ansi-language:EN-US'> <o:p></o:p><br />
</span></i></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888001">BBa_K888001 </a><br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen'>AIDA-I is synthetized as a 132 kDa pre-protein featuring a signal peptide which is cleaved during transport trough the inner membrane, a 78 kDa adhesin (passenger) domain, and a 45 kDa translocator. This autotransporter has a large capability in translocating relatively large passengers from 12-65 kDa by showing a N-terminal type of fusion. Coupled with a passenger domain and a signal peptide (<a href="http://parts.igem.org/Part:BBa_K888005">K888005</a>), it is possible to express functional proteins in the outer membrane of <i>E. coli</i>.<br />
<br />
<span style='mso-spacerun:yes'> <br />
</span>It has a length of 1482 bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:4;height:122.1pt'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:122.1pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'>&nbsp;</p> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1065" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:9.8pt;margin-top:3.6pt;width:50.05pt;height:38.05pt; z-index:251677696;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image021.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1065" DrawAspect="Content" ObjectID="_1464162128"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=67 height=51 src="https://static.igem.org/mediawiki/2014hs/d/d5/CIDEBCDS5.jpg" align=left hspace=12 v:shapes="_x0000_s1065"><![endif]><i><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font: major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font: major-bidi;mso-ansi-language:EN-US'><o:p></o:p><br />
</span></i></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt; height:122.1pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888005">BBa_K888005</a> <br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt; height:122.1pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen'>When this part is coupled with a passenger attached to AIDA-I translocator domain (<a href="http://parts.igem.org/Part:BBa_K888005">K888001</a>), it is possible to express functional proteins in the outer membrane of <i>E. coli</i>. The signal peptide is naturally cleaved during transport trough the inner membrane (Li et al. 2007; van Bloois et al. 2011).It has a length of 147 bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:5;mso-yfti-lastrow:yes;height:51.65pt'> <br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1066" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:17.8pt;margin-top:3.2pt;width:32.25pt;height:44.6pt; z-index:251679744;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image023.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1066" DrawAspect="Content" ObjectID="_1464162130"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=43 height=59 src="https://static.igem.org/mediawiki/2014hs/d/d7/STOP.jpg" align=left hspace=12 v:shapes="_x0000_s1066"><![endif]><i><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font: major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font: major-bidi;mso-ansi-language:EN-US'> <o:p></o:p><br />
</span></i></p> <br />
</td> <br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_B1002">BBa_B1002</a><br />
</span></p> <br />
</td> <br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen; mso-ansi-language:EN-US'>Part made of 6bp, responsible for stopping transcription.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr><br />
</table><br />
</div></center><br />
<br><br />
<br />
<p><b><h2>Justifications</h2></b></p><br />
<br />
<p>Although <i>E. coli</i> could acquire the ability to bind to silica, a biological filter was designed to remove bacteria from water. The team´s proposed biofilter is shown next:</p><br />
<br />
<center><p><img width=236 height=346 src="https://static.igem.org/mediawiki/2014hs/e/e2/Biofiltro.png"align=center hspace=12 alt="IMG_0317"></p></center><center><br />
<br />
<p><b>Figure 6.</b> The team's proposed biofilter model</p></center> <br />
<br />
<p>Silica was chosen as the ideal material for our biofilter in order to finish the <a href="https://2012.igem.org/Team:UANL_Mty-Mexico">UANL Mexico 2012</a> team work. They created a circuit to make <i>E. coli</i> bind to silica, but as they did not prove it, we wanted to determine if it is functional.</p><br />
<br />
<p>AIDA-1 allows the expression of proteins larger than small peptides in the outer membrane, which is why it is the best option to use with L2. AIDA-I was obtained by PCR by <a href="https://2012.igem.org/Team:UANL_Mty-Mexico">UANL Mexico 2012</a>, so we decided use their piece for our project, as it was easy for the team to obtain it because both of the teams are in the same city.</p><br />
<br />
<p><b><h2>Other teams that used it</h2></b></p><br />
<br />
<p><b><a href="https://2012.igem.org/Team:UANL_Mty-Mexico">UANL México 2012</a>:</b> They proposed the fusion protein for using it to binding silica after detect and capture arsenic acid in groundwater, and in that way removed the pollutant arsenic acid from the water, as part of water bioremediation. However, their project was not finished.</p><br />
<br />
<p><h2><b>Union Module Zoom In</b></h2></p></br><center><iframe width="640" height="390" src="//www.youtube.com/embed/PC6pQ6gfT9A" frameborder="0" allowfullscreen></iframe></center><br />
<br><br />
<br />
<p><b><h2>Bibliography/References</h2></b></p><font size="2"><br />
<br />
<p>● Antiquity. (2003). <i>Part:BBa_B0034</i>. Retrieved March 30th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034">http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034</a>.</p><br />
<br />
<p>● iGEM2006_Berkeley. (2006). <i>Part:BBa_J23119</i>. Retrieved April 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119">http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119</a>.</p><br />
<br />
<p>● iGEM12_UANL_Mty-Mexico. (2012). <i>Part BBa_K888000</i>. Retrieved March 29th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888000">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888000</a>.</p> <br />
<br />
<p>● iGEM12_UANL_Mty-Mexico. (2012). <i>Part BBa_K888001</i>. Retrieved March 29th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888001">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888001</a>.</p> <br />
<br />
<p>● iGEM12_UANL_Mty-Mexico. (2012) <i>Part BBa_K888005</i>. Retrieved March 29th,2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888005">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888005</a>.</p> <br />
<br />
<p>● UANL Mexico. (2012). <i>Recovery module</i>. Retrieved March 28th,2014, from <a href="https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery">https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery</a>.</p> </p></font><br />
<br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union#"><font color="blue">Return to the Top</font></a></p><br />
</div><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html>{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestavTeam:CIDEB-UANL Mexico/hp cinvestav2014-06-19T15:56:23Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>CINVESTAV Conference</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p><img width=300 height=200 src="https://static.igem.org/mediawiki/2014hs/2/2e/CINVESTAV_1CIDEB.JPG"/></p><p font-size="3pt"><The team during the presentation</p><br />
</td><br />
<td style="padding-left:12px;"><p>On Friday March 7th, 40 Chilean teachers from the Instituto Politécnico Nacional, located inMexico D.F. visited our High School. They were not very familiar with what the iGEM competition is all about, so we invited them to a conference in the Auditorium were we gave a presentation including an iGEM introduction, its principal areas, our team background and the explanation of our project, enclosing also our previews ideas, with the intention of letting people from other states know about iGEM, specially about our team, and what we are doing. This gave us not only a state parameter, but a national one too.</p></td><br />
</tr></table><br />
<br />
<br><p><b><h2>Description</h2></b></p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p>In a PPT presentation we covered the most related topics of iGEM. We started with an introduction of what the iGEM competition is and what it is about, we also included the basics of iGEM’s history, mentioning how the High School division was formed.</p><br />
<br />
<p>We explained how this competition is multidisciplinary and showed all the characteristics that an IGEM team has, therefore, we explained to the teachers the different parts of the project like safety, dry lab, human practices, etc.</p><br />
<br />
<p>Then, we wanted to show them how we finally got to our project; including a brief description of all the ideas we had during the meetings until deciding the final one. Afterwards, we included a complete description of our project and the purpose we had for it. Finally, a brief explanation of the previous teams in our High School was included, along with the places they got.</p><br />
<br />
<p>We also had some time for questions from them, and it was very encouraging that they had supporting comments for us and the presentation. This was a great feedback for us.</p><br />
</td><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/5/5a/CINVESTAV_2CIDEB.JPG"/></td><br />
<br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/d/dd/CINVESTAV_3CIDEB.JPG"/></td><br />
<br />
</tr></table><br />
<br />
<font size="3pt"><p><center>Chilean teachers attending to the presentation</center></font></p><br />
<br />
<br><p><b><h2>Impact</h2></b></p><br />
<br />
<p>We applied surveys with 5 different questions to each teacher and registered the results:</p><br />
<br />
<center><p><br><img width=550 height=300 src="https://static.igem.org/mediawiki/2014hs/2/2b/Graphcinvestav1CIDEB.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><font size="3pt"><p>Graph showing the results of the surveys.</font> <br></center><br />
<br />
<p>The questions above showed us that 80% of the teachers that received our presentation and an explanation of our project considered that it is an idea which if developed, could be very useful for the society.</p><br />
<br />
<p>With this survey it was also shown that most teachers qualified our presentation between 4 and 5. This means that what we tried to explain was very clear for them.</p><br />
<br />
<p>Also rating between 5 and 4, teachers considered very complete and understandable our concepts in the presentation.</p><br />
<br />
<p>97% of the teachers considrered synthethic biology as a good path to develop solutions for actual issues in the world, they were in favor of the usage of synthethic biology (see <b>Chart 1</b>).</p><br />
<br />
<p>Finally, we wanted to have a general overview of the presentation and decided to include in the answers different adjectives so the teachers could choose, the most chosen one was “Interesting” which is a positive feedback for us, a minor of 3% chose “confused" (see <b>Chart 2</b>).</p><br />
<br><br />
<table width=100%><br />
<tr><br />
<td><br />
<td style="padding-left:40px;"><p><img width=400 height=225 src="https://static.igem.org/mediawiki/2014hs/a/ad/Graphcinvestav2CIDEB.jpg"/></p><br />
<font size="3pt"><p><center><b>Chart 1</b></p><br />
<br />
</td><br />
<td style="padding-left:80px;"><p><img width=400 height=250 src="https://static.igem.org/mediawiki/2014hs/4/49/Graphcinvestav3CIDEB.jpg"/></p><br />
<font size="3pt"><p><center><b>Chart 2</b></p></font></td><br />
</tr></table><br><br />
<br />
<p>We consider this activity had great repercussions in both the teachers and us, because they learned about a very interesting international project and took that information to Chile, their country. Probably they are going to spread the information we gave them and maybe there could be more Chilean iGEM teams in the future.</p><br />
<br />
<p>As for us, it helped us to hear the perspective of teachers about our project, and as we mentioned, it was very encouraging to hear their positive thoughts and feedback to improve ourselves.</p><br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav#"><font color="blue">Return to the Top</font></a></p></div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestavTeam:CIDEB-UANL Mexico/hp cinvestav2014-06-19T15:49:45Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>CINVESTAV Conference</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p><img width=300 height=200 src="https://static.igem.org/mediawiki/2014hs/2/2e/CINVESTAV_1CIDEB.JPG"/></p><br />
</td><br />
<td style="padding-left:12px;"><p>On Friday March 7th, 40 Chilean teachers from the Instituto Politécnico Nacional, located inMexico D.F. visited our High School. They were not very familiar with what the iGEM competition is all about, so we invited them to a conference in the Auditorium were we gave a presentation including an iGEM introduction, its principal areas, our team background and the explanation of our project, enclosing also our previews ideas, with the intention of letting people from other states know about iGEM, specially about our team, and what we are doing. This gave us not only a state parameter, but a national one too.</p></td><br />
</tr></table><br />
<br />
<br><p><b><h2>Description</h2></b></p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p>In a PPT presentation we covered the most related topics of iGEM. We started with an introduction of what the iGEM competition is and what it is about, we also included the basics of iGEM’s history, mentioning how the High School division was formed.</p><br />
<br />
<p>We explained how this competition is multidisciplinary and showed all the characteristics that an IGEM team has, therefore, we explained to the teachers the different parts of the project like safety, dry lab, human practices, etc.</p><br />
<br />
<p>Then, we wanted to show them how we finally got to our project; including a brief description of all the ideas we had during the meetings until deciding the final one. Afterwards, we included a complete description of our project and the purpose we had for it. Finally, a brief explanation of the previous teams in our High School was included, along with the places they got.</p><br />
<br />
<p>We also had some time for questions from them, and it was very encouraging that they had supporting comments for us and the presentation. This was a great feedback for us.</p><br />
</td><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/5/5a/CINVESTAV_2CIDEB.JPG"/></td><br />
<br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/d/dd/CINVESTAV_3CIDEB.JPG"/></td><br />
<br />
</tr></table><br />
<br />
<p><center>Chilean teachers attending to the presentation</center></p><br />
<br />
<br><br />
<br />
<br><p><b><h2>Impact</h2></b></p><br />
<br />
<p>We applied surveys with 5 different questions to each teacher and registered the results:</p><br />
<br />
<center><p><br><img width=550 height=300 src="https://static.igem.org/mediawiki/2014hs/2/2b/Graphcinvestav1CIDEB.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><p>Graph showing the results of the surveys. <br></center><br />
<br />
<p>The questions above showed us that 80% of the teachers that received our presentation and an explanation of our project considered that it is an idea which if developed, could be very useful for the society.</p><br />
<br />
<p>With this survey it was also shown that most teachers qualified our presentation between 4 and 5. This means that what we tried to explain was very clear for them.</p><br />
<br />
<p>Also rating between 5 and 4, teachers considered very complete and understandable our concepts in the presentation.</p><br />
<br />
<p>97% of the teachers considrered synthethic biology as a good path to develop solutions for actual issues in the world, they were in favor of the usage of synthethic biology (see <b>Chart 1</b>).</p><br />
<br />
<p>Finally, we wanted to have a general overview of the presentation and decided to include in the answers different adjectives so the teachers could choose, the most chosen one was “Interesting” which is a positive feedback for us, a minor of 3% chose “confused" (see <b>Chart 2</b>).</p><br />
<br><br />
<table width=100%><br />
<tr><br />
<td><br />
<td style="padding-left:40px;"><p><img width=400 height=250 src="https://static.igem.org/mediawiki/2014hs/a/ad/Graphcinvestav2CIDEB.jpg"/></p><br />
<p><center><b>Chart 1</b></p><br />
<br />
</td><br />
<td style="padding-left:80px;"><p><img width=400 height=250 src="https://static.igem.org/mediawiki/2014hs/4/49/Graphcinvestav3CIDEB.jpg"/></p><br />
<p><center><b>Chart 2</b></p></td><br />
</tr></table><br><br />
<br />
<p>We consider this activity had great repercussions in both the teachers and us, because they learned about a very interesting international project and took that information to Chile, their country. Probably they are going to spread the information we gave them and maybe there could be more Chilean iGEM teams in the future.</p><br />
<br />
<p>As for us, it helped us to hear the perspective of teachers about our project, and as we mentioned, it was very encouraging to hear their positive thoughts and feedback to improve ourselves.</p><br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav#"><font color="blue">Return to the Top</font></a></p></div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestavTeam:CIDEB-UANL Mexico/hp cinvestav2014-06-19T15:45:53Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>CINVESTAV Conference</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p><img width=300 height=200 src="https://static.igem.org/mediawiki/2014hs/2/2e/CINVESTAV_1CIDEB.JPG"/></p><br />
</td><br />
<td style="padding-left:12px;"><p>On Friday March 7th, 40 Chilean teachers from the Instituto Politécnico Nacional, located inMexico D.F. visited our High School. They were not very familiar with what the iGEM competition is all about, so we invited them to a conference in the Auditorium were we gave a presentation including an iGEM introduction, its principal areas, our team background and the explanation of our project, enclosing also our previews ideas, with the intention of letting people from other states know about iGEM, specially about our team, and what we are doing. This gave us not only a state parameter, but a national one too.</p></td><br />
</tr></table><br />
<br />
<br><p><b><h2>Description</h2></b></p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p>In a PPT presentation we covered the most related topics of iGEM. We started with an introduction of what the iGEM competition is and what it is about, we also included the basics of iGEM’s history, mentioning how the High School division was formed.</p><br />
<br />
<p>We explained how this competition is multidisciplinary and showed all the characteristics that an IGEM team has, therefore, we explained to the teachers the different parts of the project like safety, dry lab, human practices, etc.</p><br />
<br />
<p>Then, we wanted to show them how we finally got to our project; including a brief description of all the ideas we had during the meetings until deciding the final one. Afterwards, we included a complete description of our project and the purpose we had for it. Finally, a brief explanation of the previous teams in our High School was included, along with the places they got.</p><br />
<br />
<p>We also had some time for questions from them, and it was very encouraging that they had supporting comments for us and the presentation. This was a great feedback for us.</p><br />
</td><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/5/5a/CINVESTAV_2CIDEB.JPG"/></td><br />
<br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/d/dd/CINVESTAV_3CIDEB.JPG"/></td><br />
<br />
</tr></table><br />
<br />
<br><br />
<br />
<br><p><b><h2>Impact</h2></b></p><br />
<br />
<p>We applied surveys with 5 different questions to each teacher and registered the results:</p><br />
<br />
<center><p><br><img width=550 height=300 src="https://static.igem.org/mediawiki/2014hs/2/2b/Graphcinvestav1CIDEB.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br></center><br />
<br />
<p>The questions above showed us that 80% of the teachers that received our presentation and an explanation of our project considered that it is an idea which if developed, could be very useful for the society.</p><br />
<br />
<p>With this survey it was also shown that most teachers qualified our presentation between 4 and 5. This means that what we tried to explain was very clear for them.</p><br />
<br />
<p>Also rating between 5 and 4, teachers considered very complete and understandable our concepts in the presentation.</p><br />
<br />
<p>97% of the teachers considrered synthethic biology as a good path to develop solutions for actual issues in the world, they were in favor of the usage of synthethic biology (see <b>Chart 1</b>).</p><br />
<br />
<p>Finally, we wanted to have a general overview of the presentation and decided to include in the answers different adjectives so the teachers could choose, the most chosen one was “Interesting” which is a positive feedback for us, a minor of 3% chose “confused" (see <b>Chart 2</b>).</p><br />
<br><br />
<table width=100%><br />
<tr><br />
<td><br />
<td style="padding-left:40px;"><p><img width=400 height=250 src="https://static.igem.org/mediawiki/2014hs/a/ad/Graphcinvestav2CIDEB.jpg"/></p><br />
<p><center><b>Chart 1</b></p><br />
<br />
</td><br />
<td style="padding-left:80px;"><p><img width=400 height=250 src="https://static.igem.org/mediawiki/2014hs/4/49/Graphcinvestav3CIDEB.jpg"/></p><br />
<p><center><b>Chart 2</b></p></td><br />
</tr></table><br><br />
<br />
<p>We consider this activity had great repercussions in both the teachers and us, because they learned about a very interesting international project and took that information to Chile, their country. Probably they are going to spread the information we gave them and maybe there could be more Chilean iGEM teams in the future.</p><br />
<br />
<p>As for us, it helped us to hear the perspective of teachers about our project, and as we mentioned, it was very encouraging to hear their positive thoughts and feedback to improve ourselves.</p><br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav#"><font color="blue">Return to the Top</font></a></p></div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestavTeam:CIDEB-UANL Mexico/hp cinvestav2014-06-19T15:45:33Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>CINVESTAV Conference</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p><img width=300 height=200 src="https://static.igem.org/mediawiki/2014hs/2/2e/CINVESTAV_1CIDEB.JPG"/></p><br />
</td><br />
<td style="padding-left:12px;"><p>On Friday March 7th, 40 Chilean teachers from the Instituto Politécnico Nacional, located inMexico D.F. visited our High School. They were not very familiar with what the iGEM competition is all about, so we invited them to a conference in the Auditorium were we gave a presentation including an iGEM introduction, its principal areas, our team background and the explanation of our project, enclosing also our previews ideas, with the intention of letting people from other states know about iGEM, specially about our team, and what we are doing. This gave us not only a state parameter, but a national one too.</p></td><br />
</tr></table><br />
<br />
<br><p><b><h2>Description</h2></b></p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p>In a PPT presentation we covered the most related topics of iGEM. We started with an introduction of what the iGEM competition is and what it is about, we also included the basics of iGEM’s history, mentioning how the High School division was formed.</p><br />
<br />
<p>We explained how this competition is multidisciplinary and showed all the characteristics that an IGEM team has, therefore, we explained to the teachers the different parts of the project like safety, dry lab, human practices, etc.</p><br />
<br />
<p>Then, we wanted to show them how we finally got to our project; including a brief description of all the ideas we had during the meetings until deciding the final one. Afterwards, we included a complete description of our project and the purpose we had for it. Finally, a brief explanation of the previous teams in our High School was included, along with the places they got.</p><br />
<br />
<p>We also had some time for questions from them, and it was very encouraging that they had supporting comments for us and the presentation. This was a great feedback for us.</p><br />
</td><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/5/5a/CINVESTAV_2CIDEB.JPG"/></td><br />
<br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/d/dd/CINVESTAV_3CIDEB.JPG"/></td><br />
<br />
</tr></table><br />
<br />
<br><br />
<br />
<br><p><b><h2>Impact</h2></b></p><br />
<br />
<p>We applied surveys with 5 different questions to each teacher and registered the results:</p><br />
<br />
<center><p><br><img width=600 height=300 src="https://static.igem.org/mediawiki/2014hs/2/2b/Graphcinvestav1CIDEB.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br></center><br />
<br />
<p>The questions above showed us that 80% of the teachers that received our presentation and an explanation of our project considered that it is an idea which if developed, could be very useful for the society.</p><br />
<br />
<p>With this survey it was also shown that most teachers qualified our presentation between 4 and 5. This means that what we tried to explain was very clear for them.</p><br />
<br />
<p>Also rating between 5 and 4, teachers considered very complete and understandable our concepts in the presentation.</p><br />
<br />
<p>97% of the teachers considrered synthethic biology as a good path to develop solutions for actual issues in the world, they were in favor of the usage of synthethic biology (see <b>Chart 1</b>).</p><br />
<br />
<p>Finally, we wanted to have a general overview of the presentation and decided to include in the answers different adjectives so the teachers could choose, the most chosen one was “Interesting” which is a positive feedback for us, a minor of 3% chose “confused" (see <b>Chart 2</b>).</p><br />
<br><br />
<table width=100%><br />
<tr><br />
<td><br />
<td style="padding-left:40px;"><p><img width=400 height=250 src="https://static.igem.org/mediawiki/2014hs/a/ad/Graphcinvestav2CIDEB.jpg"/></p><br />
<p><center><b>Chart 1</b></p><br />
<br />
</td><br />
<td style="padding-left:80px;"><p><img width=400 height=250 src="https://static.igem.org/mediawiki/2014hs/4/49/Graphcinvestav3CIDEB.jpg"/></p><br />
<p><center><b>Chart 2</b></p></td><br />
</tr></table><br><br />
<br />
<p>We consider this activity had great repercussions in both the teachers and us, because they learned about a very interesting international project and took that information to Chile, their country. Probably they are going to spread the information we gave them and maybe there could be more Chilean iGEM teams in the future.</p><br />
<br />
<p>As for us, it helped us to hear the perspective of teachers about our project, and as we mentioned, it was very encouraging to hear their positive thoughts and feedback to improve ourselves.</p><br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav#"><font color="blue">Return to the Top</font></a></p></div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestavTeam:CIDEB-UANL Mexico/hp cinvestav2014-06-19T15:45:15Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>CINVESTAV Conference</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p><img width=300 height=200 src="https://static.igem.org/mediawiki/2014hs/2/2e/CINVESTAV_1CIDEB.JPG"/></p><br />
</td><br />
<td style="padding-left:12px;"><p>On Friday March 7th, 40 Chilean teachers from the Instituto Politécnico Nacional, located inMexico D.F. visited our High School. They were not very familiar with what the iGEM competition is all about, so we invited them to a conference in the Auditorium were we gave a presentation including an iGEM introduction, its principal areas, our team background and the explanation of our project, enclosing also our previews ideas, with the intention of letting people from other states know about iGEM, specially about our team, and what we are doing. This gave us not only a state parameter, but a national one too.</p></td><br />
</tr></table><br />
<br />
<br><p><b><h2>Description</h2></b></p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p>In a PPT presentation we covered the most related topics of iGEM. We started with an introduction of what the iGEM competition is and what it is about, we also included the basics of iGEM’s history, mentioning how the High School division was formed.</p><br />
<br />
<p>We explained how this competition is multidisciplinary and showed all the characteristics that an IGEM team has, therefore, we explained to the teachers the different parts of the project like safety, dry lab, human practices, etc.</p><br />
<br />
<p>Then, we wanted to show them how we finally got to our project; including a brief description of all the ideas we had during the meetings until deciding the final one. Afterwards, we included a complete description of our project and the purpose we had for it. Finally, a brief explanation of the previous teams in our High School was included, along with the places they got.</p><br />
<br />
<p>We also had some time for questions from them, and it was very encouraging that they had supporting comments for us and the presentation. This was a great feedback for us.</p><br />
</td><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/5/5a/CINVESTAV_2CIDEB.JPG"/></td><br />
<br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/d/dd/CINVESTAV_3CIDEB.JPG"/></td><br />
<br />
</tr></table><br />
<br />
<br><br />
<br />
<br><p><b><h2>Impact</h2></b></p><br />
<br />
<p>We applied surveys with 5 different questions to each teacher and registered the results:</p><br />
<br />
<center><p><br><img width=600 height=300 src="https://static.igem.org/mediawiki/2014hs/2/2b/Graphcinvestav1CIDEB.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br></center><br />
<br />
<p>The questions above showed us that 80% of the teachers that received our presentation and an explanation of our project considered that it is an idea which if developed, could be very useful for the society.</p><br />
<br />
<p>With this survey it was also shown that most teachers qualified our presentation between 4 and 5. This means that what we tried to explain was very clear for them.</p><br />
<br />
<p>Also rating between 5 and 4, teachers considered very complete and understandable our concepts in the presentation.</p><br />
<br />
<p>97% of the teachers considrered synthethic biology as a good path to develop solutions for actual issues in the world, they were in favor of the usage of synthethic biology (see <b>Chart 1</b>).</p><br />
<br />
<p>Finally, we wanted to have a general overview of the presentation and decided to include in the answers different adjectives so the teachers could choose, the most chosen one was “Interesting” which is a positive feedback for us, a minor of 3% chose “confused" (see <b>Chart 2</b>).</p><br />
<br><br />
<table width=100%><br />
<tr><br />
<td><br />
<td style="padding-left:40px;"><p><img width=400 height=200 src="https://static.igem.org/mediawiki/2014hs/a/ad/Graphcinvestav2CIDEB.jpg"/></p><br />
<p><center><b>Chart 1</b></p><br />
<br />
</td><br />
<td style="padding-left:80px;"><p><img width=400 height=200 src="https://static.igem.org/mediawiki/2014hs/4/49/Graphcinvestav3CIDEB.jpg"/></p><br />
<p><center><b>Chart 2</b></p></td><br />
</tr></table><br><br />
<br />
<p>We consider this activity had great repercussions in both the teachers and us, because they learned about a very interesting international project and took that information to Chile, their country. Probably they are going to spread the information we gave them and maybe there could be more Chilean iGEM teams in the future.</p><br />
<br />
<p>As for us, it helped us to hear the perspective of teachers about our project, and as we mentioned, it was very encouraging to hear their positive thoughts and feedback to improve ourselves.</p><br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav#"><font color="blue">Return to the Top</font></a></p></div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_raceTeam:CIDEB-UANL Mexico/hp race2014-06-19T15:36:47Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Race for Science</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=290 height=139 src=" https://static.igem.org/mediawiki/2014hs/b/b2/CIDEBHPcarrera1.png"/><br />
</td><br />
<td><br />
<p> As it is said: <i>“Mens sana in corpore sano” </i> (healthy mind in a healthy body), we, as a team, believe that everyone should enjoy a healthy life, in which there is a balance between study and physical activity.</p><br />
<p>So after making the “Explosion”, once people knew what we do in iGEM, we wanted to expand the knowledge and interest of people about our project. That's why we decided to organize this "Carrera por la Ciencia" (Race for Science), which included a circuit of about 4 kilometers and at the end a fair with entertaining games related to the project in a way that people could spend time together as a family and learn at the same time. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p>Thus, the event gave us the ability to combine the information about our project and synthetic biology, with physical exercise. This last concept is particularly important for us, especially in Mexico, where the rates of obesity and sedentary lifestyle are disturbing. </p><br />
<br />
<p><b><h2> Objectives</h2></b></p> <br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=280 height=174 src="https://static.igem.org/mediawiki/2014hs/0/02/CIDEBHPcarrera3.jpg"/><br />
</td><br />
<td><br />
<p> According to an article from the United Nations Food and Agricultural Organization (FAO), Mexico is considered as the world's fattest country with a 32.8 percent adult obesity rate, surpassing United States' 31.8 obesity rate. About 70 percent of Mexican adults are considered to be overweight.</p><br />
<p>Monterrey is an industrial city where most people lead stressful and sedentary lifestyles. We, as a part of this society, are too familiar with the dangers of obesity and the prevalent lack of healthy diet and exercise habits. </p><br />
<p>This, combined with the need to develop our project in the Human Practices area, is the reason why we felt motivated to organize this Race for Science. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<p><b> The main purposes of the Race for Science were:</p></b><br />
<p> • To spread information about the project within both the academic and non-academic community, in a fun, innovating and accessible way </p><br />
<p> • To promote physical activities that have a beneficial impact on human health and thus, help cultivate a balance between body and mind </p><br />
<br />
<p>The event was promoted through a personal invitation to the people in our high school, and they were suggested to invite their family members and/or friends to join them. Posters were also made with all the information about the event; they were placed in different parts of the school and simultaneously posted digitally on the official page of the iGEM CIDEB team on Facebook. </p><br />
<br><br />
<p><b><h2> 1st Stage of the Race: Physical Activity</h2></b></p> <br />
<br />
<p>The race was held within the “Mederos” campus of the UANL. The attendees were asked to arrive at 6:30 a.m., so that the event could start at 7:00 a.m. We welcomed about 600 participants, ranging in age from 7 years old to third age.</p><br />
<br />
<p>At 7:00 am a warm-up session was performed. The session was developed with the help of a professional, who lead a dance for about 30 minutes, turning conventional exercises into something fun. The mascot of our team had a very active participation in the warm-up, which encouraged the people to do the exercises properly and enthusiastically. </p><br />
<br />
<p>We then proceeded to take the participants to the start area. The women’s group was the first one to start running, followed 5 minutes later by the men’s group.</p><br />
<br />
<p>The start of the route was the main entrance to our school. Then, the road stretched by the campus’ internal streets to the Faculty of Economics, and then the participants resumed their route in the opposite direction of the streets to return to the entrance of the school. </p><br />
<br></div><br />
<br />
<center><table width=80%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:px;"><img width=400 height=270 src="https://static.igem.org/mediawiki/2014hs/e/e5/CIDEBHPcarrera4.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://static.igem.org/mediawiki/2014hs/0/01/CIDEBHPcarrera5.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://static.igem.org/mediawiki/2014hs/5/5c/CIDEBHPcarrera6.png"/></td><br />
<br />
</tr></table></center><br />
<br />
<br><br />
<div class="container-text"><br />
<p><b><h2> 2nd Stage of the Race: Project information</h2></b></p><br />
<br />
<p>Along the route, there were people on the sidewalks with informative signs about different synthetic biology fun facts, general information about the project, about the impact that our project would have on society, etc... At the halfway point, several people could be found giving away small bags of water to hydrate the runners.</p><br />
<br />
<p>At this point, we had already accomplished one of the main objectives of the race (to promote physical activity). The next step was encouraging people to learn more about our project (and have some fun while doing so). </p><br />
<br />
<p> At the end of the route, the participants returned to the starting point (the parking of the school). In this place, there were different modules with information relevant to our project. Each module included an allusive game to every action of the bacterium (Capture, Union, Resistance and Aroma), so that people could learn in an easy and interactive way. Thus, while participants took a break, they could observe and receive a brief explanation of our project, and they could play and get coupons which could be exchanged for prizes. </p><br />
<br />
<center><table width=80%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:px;"><img width=252 height=395 src="https://static.igem.org/mediawiki/2014hs/0/03/CIDEBHPcarrera7.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=544 height=387 src="https://static.igem.org/mediawiki/2014hs/9/9c/CIDEBHPcarrera8.jpg"/></td><br />
<br />
<br />
</tr></table></center><br />
<br />
<p><b><h2>Impact</h2></b></p> <br />
<br />
<p>Two weeks before, the students learned from the DNA WEEK what was our project about, so they made comments such as “Hi E.CARU!” to our costume, or “Is this from iGEM?” and “How can I get in?” to our team members. Even in the game time, when looking at it, some of them were able to recognize easily the parts referring to our project. (Each game was created to give a reference about our project, its modules and their function). </p><br />
<br />
<p>People, who were not students and hadn’t received those talks, were asking about the iGEM team and the project that we are working on. They asked how does it work, how did we do it, what will it be able to do, and more. They were very interested; even though they did not want to play because they were older, they were paying attention while the younger ones were playing and listened to the explanation that the team members gave.</p><br />
<br />
<p>The race was a complete success. We had received supportive comments during it, and we realized that people were interested in what we are doing. The assistants gained knowledge about our project while having a good time, spending time with their families and friends.</p><br />
<br />
<br />
<p><b><h2>Bibliography</h2></b></p> <br />
<font size="2pt"><br />
United Nations Food and Agricultural Organization (FAO). (2008). <i>The state of food and agriculture.</i> Retrieved from: <a href="http://www.fao.org/docrep/018/i3300e/i3300e.pdf">http://www.fao.org/docrep/018/i3300e/i3300e.pdf</a></font><br><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_raceTeam:CIDEB-UANL Mexico/hp race2014-06-19T15:35:30Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Race for Science</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=290 height=139 src=" https://static.igem.org/mediawiki/2014hs/b/b2/CIDEBHPcarrera1.png"/><br />
</td><br />
<td><br />
<p> As it is said: <i>“Mens sana in corpore sano” </i> (healthy mind in a healthy body), we, as a team, believe that everyone should enjoy a healthy life, in which there is a balance between study and physical activity.</p><br />
<p>So after making the “Explosion”, once people knew what we do in iGEM, we wanted to expand the knowledge and interest of people about our project. That's why we decided to organize this "Carrera por la Ciencia" (Race for Science), which included a circuit of about 4 kilometers and at the end a fair with entertaining games related to the project in a way that people could spend time together as a family and learn at the same time. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p>Thus, the event gave us the ability to combine the information about our project and synthetic biology, with physical exercise. This last concept is particularly important for us, especially in Mexico, where the rates of obesity and sedentary lifestyle are disturbing. </p><br />
<br />
<p><b><h2> Objectives</h2></b></p> <br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=280 height=174 src="https://static.igem.org/mediawiki/2014hs/0/02/CIDEBHPcarrera3.jpg"/><br />
</td><br />
<td><br />
<p> According to an article from the United Nations Food and Agricultural Organization (FAO), Mexico is considered as the world's fattest country with a 32.8 percent adult obesity rate, surpassing United States' 31.8 obesity rate. About 70 percent of Mexican adults are considered to be overweight.</p><br />
<p>Monterrey is an industrial city where most people lead stressful and sedentary lifestyles. We, as a part of this society, are too familiar with the dangers of obesity and the prevalent lack of healthy diet and exercise habits. </p><br />
<p>This, combined with the need to develop our project in the Human Practices area, is the reason why we felt motivated to organize this Race for Science. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<p><b> The main purposes of the Race for Science were:</p></b><br />
<p> • To spread information about the project within both the academic and non-academic community, in a fun, innovating and accessible way </p><br />
<p> • To promote physical activities that have a beneficial impact on human health and thus, help cultivate a balance between body and mind </p><br />
<br />
<p>The event was promoted through a personal invitation to the people in our high school, and they were suggested to invite their family members and/or friends to join them. Posters were also made with all the information about the event; they were placed in different parts of the school and simultaneously posted digitally on the official page of the iGEM CIDEB team on Facebook. </p><br />
<br><br />
<p><b><h2> 1st Stage of the Race: Physical Activity</h2></b></p> <br />
<br />
<p>The race was held within the “Mederos” campus of the UANL. The attendees were asked to arrive at 6:30 a.m., so that the event could start at 7:00 a.m. We welcomed about 600 participants, ranging in age from 7 years old to third age.</p><br />
<br />
<p>At 7:00 am a warm-up session was performed. The session was developed with the help of a professional, who lead a dance for about 30 minutes, turning conventional exercises into something fun. The mascot of our team had a very active participation in the warm-up, which encouraged the people to do the exercises properly and enthusiastically. </p><br />
<br />
<p>We then proceeded to take the participants to the start area. The women’s group was the first one to start running, followed 5 minutes later by the men’s group.</p><br />
<br />
<p>The start of the route was the main entrance to our school. Then, the road stretched by the campus’ internal streets to the Faculty of Economics, and then the participants resumed their route in the opposite direction of the streets to return to the entrance of the school. </p><br />
<br></div><br />
<br />
<center><table width=80%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:px;"><img width=400 height=270 src="https://static.igem.org/mediawiki/2014hs/e/e5/CIDEBHPcarrera4.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://static.igem.org/mediawiki/2014hs/0/01/CIDEBHPcarrera5.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://static.igem.org/mediawiki/2014hs/5/5c/CIDEBHPcarrera6.png"/></td><br />
<br />
</tr></table></center><br />
<br />
<br><br />
<div class="container-text"><br />
<p><b><h2> 2nd Stage of the Race: Project information</h2></b></p><br />
<br />
<p>Along the route, there were people on the sidewalks with informative signs about different synthetic biology fun facts, general information about the project, about the impact that our project would have on society, etc... At the halfway point, several people could be found giving away small bags of water to hydrate the runners.</p><br />
<br />
<p>At this point, we had already accomplished one of the main objectives of the race (to promote physical activity). The next step was encouraging people to learn more about our project (and have some fun while doing so). </p><br />
<br />
<p> At the end of the route, the participants returned to the starting point (the parking of the school). In this place, there were different modules with information relevant to our project. Each module included an allusive game to every action of the bacterium (Capture, Union, Resistance and Aroma), so that people could learn in an easy and interactive way. Thus, while participants took a break, they could observe and receive a brief explanation of our project, and they could play and get coupons which could be exchanged for prizes. </p><br />
<br />
<center><table width=80%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:px;"><img width=252 height=395 src="https://static.igem.org/mediawiki/2014hs/0/03/CIDEBHPcarrera7.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=544 height=387 src="https://static.igem.org/mediawiki/2014hs/9/9c/CIDEBHPcarrera8.jpg"/></td><br />
<br />
<br />
</tr></table></center><br />
<br />
<p><b><h2>Impact</h2></b></p> <br />
<br />
<p>Two weeks before, the students learned from the DNA WEEK what was our project about, so they made comments such as “Hi E.CARU!” to our costume, or “Is this from iGEM?” and “How can I get in?” to our team members. Even in the game time, when looking at it, some of them were able to recognize easily the parts referring to our project. (Each game was created to give a reference about our project, its modules and their function). </p><br />
<br />
<p>People, who were not students and hadn’t received those talks, were asking about the iGEM team and the project that we are working on. They asked how does it work, how did we do it, what will it be able to do, and more. They were very interested; even though they did not want to play because they were older, they were paying attention while the younger ones were playing and listened to the explanation that the team members gave.</p><br />
<br />
<p>The race was a complete success. We had received supportive comments during it, and we realized that people were interested in what we are doing. The assistants gained knowledge about our project while having a good time, spending time with their families and friends.</p><br />
<br />
<br />
<p><b><h2>Bibliography</h2></b></p> <br />
United Nations Food and Agricultural Organization (FAO). (2008). <i>The state of food and agriculture.</i> Retrieved from: <a href="http://www.fao.org/docrep/018/i3300e/i3300e.pdf">http://www.fao.org/docrep/018/i3300e/i3300e.pdf</a><br><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/achievementsTeam:CIDEB-UANL Mexico/achievements2014-06-19T15:32:01Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_achievements}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Achievements</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Achievements</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<table width=100%><br />
<tr><br />
<td><br />
<p>During the project, iGEM CIDEB 2014 acquired the following achievements:</p><br />
<br />
<p><h2><b>Dry Lab <img width=15 height=20 src="https://static.igem.org/mediawiki/2014hs/c/cf/Check1.png"/></h2></b></p><br />
<br />
<br />
<p><b><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Characterize a part from another team and submitting it to the registry.</b></p><br />
<p>From <a href="https://2006.igem.org/wiki/index.php/MIT_2006" target="_blank">MIT 2006</a>:</p><br />
<p>-> <a href="http://parts.igem.org/Part:BBa_J45004" target="_blank">BSMT1 (BBa_J45004)</a> which gives our bacteria the ability to produce an odor. </p> <br />
<p>From <a href="https://2008.igem.org/Team:TUDelft" target="_blank">Tu Delft 2008</a>:</p><br />
<p>-> RNA Thermomether: <a href="http://parts.igem.org/Part:BBa_K115017" target="_blank">BBa_K115017</a> which gives our Aroma module the ability to be regulated by temperature. </p> <br />
<p>From <a href="https://2007.igem.org/wiki/index.php/Colombia-Israel_(ORT_Ebin_High_School)" target="_blank">Colombia-Israel 2007</a>:</p><br />
<p>-> UV Promoter: <a href="http://parts.igem.org/Part:BBa_I765001" target="_blank">BBa_I765001</a> which lets our Capture module the ability to be regulated by UV light. </p><br />
<p><b><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Create a completely new part in the registry.</b></p><br />
<p>-> Which gives our bacteria the ability to ingest Sodium ions: Putative sodium ion binding protein: <a href="http://parts.igem.org/Part:BBa_K1255000" target="_blank">BBa_K1255000</a></p><br />
<p><b><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Finish a construction of the project from another team.</b></p><br />
<p>->From the <a href="https://2012.igem.org/Team:UANL_Mty-Mexico" target="_blank">UANL 2012</a> team:</p><br />
<p>- AIDA-I Signal peptide: <a href="http://parts.igem.org/Part:BBa_K888005" target="_blank">BBa_K888005</a></p><br />
<p>- L2 protein of adhesion to silica: <a href="http://parts.igem.org/Part:BBa_K888000" target="_blank">BBa_K888000</a></p><br />
<p>- AIDA-I Translocator domain: <a href="http://parts.igem.org/Part:BBa_K888001" target="_blank">BBa_K888001</a></p><br />
<p><b><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Use an already existent part from the registry.</b></p><br />
<p> -> Which gives our bacteria the resistance to a saline environment: <a href="http://parts.igem.org/Part:BBa_K729001" target="_blank">IrrE (BBa_K729001)</a> from <a href="https://2012.igem.org/Team:University_College_London" target="_blank">UCL 2012</a>.</p><br />
<br />
<br><p><h2><b>Lab Work <img width=15 height=20 src="https://static.igem.org/mediawiki/2014hs/c/cf/Check1.png"/></b></h2></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Obtained the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results" target="_blank">experimental results</a> that were needed for the correct function of an importante part of our project. </p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> We had a control over our experiments, being regulated by heat (<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank">Aroma module</a>) and UV light (<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank">Capture module</a>).</p><br />
<br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> All the lab work was performed following the correct <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods" target="_blank">methods</a> and the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysis" target="_blank">safety</a> protocols.</p><br />
<br />
<br><p><h2><b>Math Model <img width=15 height=20 src="https://static.igem.org/mediawiki/2014hs/c/cf/Check1.png"/></b></h2></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Mathematically modeled all the four modules of our project:</p><br />
<p> -> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_capture" target="_blank">Capture</a></p><br />
<p> -> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_aroma" target="_blank">Aroma</a></p><br />
<p> -> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_resistance" target="_blank">Resistance</a></p><br />
<p> -> <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_union" target="_blank">Union</a></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Graphs were done with the correct information from the model.</p><br />
<br />
<br><p><h2><b>Human Practices <img width=15 height=20 src="https://static.igem.org/mediawiki/2014hs/c/cf/Check1.png"/></b></h2></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Achieve that all students from our high school knew what iGEM is and the explanation of this year’s project. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_explosion" target="_blank">Explosion</a> & <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_dnaweek" target="_blank">DNA Week</a></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Give a presentation to 40 foreign teachers in which it was explained what iGEM is and our project. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav" target="_blank">CINVESTAV</a></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Organize a 4k race for students and general public to promote: health, science and iGEM’s work. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_race" target="_blank">Race 4 Science</a></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Collaborate with the HS teams UCL Academy and GenetiX Tec CCM. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations" target="_blank"> Collaborations</a></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Collaborate with the College team Evry. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations" target="_blank">Collaborations</a></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Create a videogame to recreate the main function of our project. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_videogame" target="_blank">Videogame</a></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Participate in an event with all the iGEM teams from the state. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_enlacecientifico" target="_blank">Enlace Científico</a></p><br />
<br />
<br><p><h2><b>Safety <img width=15 height=20 src="https://static.igem.org/mediawiki/2014hs/c/cf/Check1.png"/></b></h2></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Perform a complete Risk Analysis from our project. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysis" target="_blank">Risk Analysis</a></p><br />
<p><img width=18 height=21 src="https://static.igem.org/mediawiki/2014hs/1/13/Palomitacideb2014.gif"/> Design a contention method for our bacteria. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysis" target="_blank">Risk Analysis</a></p><br />
</td></tr></table><br />
<br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/achievements#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aromaTeam:CIDEB-UANL Mexico/project aroma2014-06-19T15:23:51Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project<br />
</title><br />
<style>body{margin: 0px; width: 100%;padding: 0px;dubackground: #2056ac;font-family: 'Oxygen', sans-serif;font-size: 12pt;background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);}h1, h2, h3{margin: 0;padding-bottom: 5px;color: #404040;}p, ol, ul{margin-top: 0;}ol, ul{padding: 0;list-style: none;}p{line-height: 1.60em;padding- right: 3em;}strong{}a{color: #2056ac;}a:hover{text-decoration: none;}.container{margin: 0px auto;width: 1200px;}.container-text{margin: 0px auto;width: 75%;padding: 0px;font-family: 'Oxygen', sans-serif;font-size: 12pt; text-align: justify;}.wrapper{overflow: hidden;padding: 0em 0em 1em 0em;background: #FFF;}#wrapper1{background: #FFF;}#wrapper2{overflow: hidden;background: #F3F3F3;padding: 5em 0em;text-align: center;}#wrapper3{overflow: hidden;padding: 0em 0em 0em 0em;background: #FFF;}#wrapper4{}#banner{padding-top: 2em;}#welcome{overflow: hidden;width: 1000px;padding: 0em 100px 0em 100px;text-align: center;}#welcome .content{padding: 0em 8em;}#welcome .title h2{}#welcome a,#welcome strong{}.title{margin-bottom: 1em;}.title h2{font-size: 2em;}.title .byline{font-size: 1.1em;color: #6F6F6F#;}#three-column{overflow: hidden;margin-top: 5em;padding-top: 1em;border-top: 1px solid rgba(0,0,0,0.2);text-align: center;}#three-column h2{margin: 1em 0em;font-size: 1.5em;font-weight: 700;}#three-column .icon{position: relative;display: block;margin: 0px auto 0.80em auto;background: none;line-height: 150px;font-size: 4em;width: 150px;height: 100px;border-radius: 100px;border: 6px solid #67128F;text-align: center;color: #FFF;}#three-column #tbox1,#three-column #tbox2,#three-column #tbox3{float: left;width: 320px;padding: 30px 40px 50px 40px;}#three-column .title{text-align: center;}#three-column .title h2{font-size: 1.60em;}#three-column .title .byline{padding-top: 0.50em;font-size: 0.90em;color: #858585;}#three-column .arrow-down{border-top-color: #292929;}ul.tools{margin: 0;padding: 0em 0em 0em 0em;list-style: none;}ul.tools li{display: inline-block;padding: 0em .2em;font-size: 4em;}ul.tools li span{display: none;margin: 0;padding: 0;}ul.tools li a{color: #FFF;}ul.tools li a:before{display: inline-block;background: #1ABC9C;width: 120px;height: 120px;border-radius: 50%;line-height: 120px;text-align: center;color: #FFFFFF;}.button{display: inline-block;margin-top: 2em;padding: 0.8em 2em;background: #64ABD1;line-height: 1.8em;letter-spacing: 1px;text-decoration: none;font-size: 1em;color: #FFF;}.button:before{display: inline-block;background: #8DCB89;margin-right: 1em;width: 40px;height: 40px;line-height: 40px;border-radius: 20px;text-align: center;color: #272925;}.button-small{}#portfolio{overflow: hidden;padding-top: 5em;border-top: 1px solid rgba(0,0,0,0.2);}#portfolio .box{text-align: center;color: rgba(0,0,0,0.5);}#portfolio h3{display: block;padding-bottom: 1em;font-size: 1em;color: rgba(0,0,0,0.6);}#portfolio .title{text-align: center;}#portfolio .title h2{color: rgba(0,0,0,0.8);}.column1,.column2,.column3,.column4{width: 282px;}.column1,.column2,.column3{float: left;margin-right: 24px;}.column4{float: right;}<br />
</style><br />
<br />
<body><br />
<br />
<div class="wrapper"><br />
<br />
<div id="welcome" class="container"> <br />
<br />
<div class="title"> <h2>Aroma Module</h2> <br />
</div><br />
</div><br />
<br />
<div class="container-text"><br />
<br />
<br />
<img width=131 height=127 src="https://static.igem.org/mediawiki/2014hs/5/5c/HandsomeAroma.jpg" align=right hspace=12/><br />
<p align="justify">Since the beginning of iGEM project, the use of fluorescent reporters has been used in each one of the proposed projects in previous years, trying to test the theoretical presence of other proteins in <i>E. coli.</i> For our iGEM 2014 project, this module proposed to promote the usage of aroma reporters, instead of fluorescent ones.</p><br />
<br />
<br />
<p><b><h2>Description</h2></b></p><br />
<p>In the module, WinterGreen, the coding region, is the most important part. Normally, it catalyzes the conversion of salicylic acid into methyl salicylate. The protein is excreted by the bacteria and when salicylic acid is added to the medium, a chemical reaction takes place and produces methyl salicylate, which is responsible for the wintergreen odor.</p><br />
<br />
<p>But in this module, it will be regulated by temperature with the use of the RNA thermometer. When adding salicylic acid to the bacteria in a 32° Celsius environment, the production of the WinterGreen protein will begin.</p><br><br />
<br />
<br />
<center><img width=350 height=250 src="https://static.igem.org/mediawiki/2014hs/6/6e/AromaFigure1Bb.png" align=center hspace=12/></center><br />
<center><p><b>Figure 1.</b> Production of Wintergreen Odor</p></center><br />
<br />
<p><b><h2>Device</h2></b></p><br />
<p>Originally, WinterGreen was thought to be the reporter of the Capture module, but in order to prove the function of this gene and also the one in charge of the capture of sodium ions (NhaS), we decided to separate the full device into the actual modules of Capture and Aroma, as seen in the figure below.</p><br />
<br />
<center><br />
<p><img width=450 height=250 src="https://static.igem.org/mediawiki/2014hs/3/32/TestCaptureAndAroma.jpg" align=center hspace=12></p><br />
<p><b>Figure 2.</b> The device originally thought, and the 2 modules derived from it.</p></center><br><br />
<br />
<p>This device is composed by the following parts (see <b>figure 3</b>): (1) a constitutive promoter, (2) a ribo-switch, also called RNA thermometer; used to regulate the WinterGreen-odor protein production through temperature, (3) a Wintergreen-odor enzyme generator, used to allow the production of methyl salicylate, induced by salicylic acid, and (4) a terminator. All of these parts are ligated by an 8-bp scar (TACTAGAG).</p><br />
<br />
<center><img width=400 height=170 src="https://static.igem.org/mediawiki/2014hs/5/56/AromaFigure1Aa.png" align=center hspace=12/><br />
<p><b>Figure 3.</b> Aroma Module</p></center><br><br />
<br />
<p>These 4 genetic parts form the Aroma device of the project. The full device's length is 1,251bp (including restriction sites).</p><br />
<br />
<p><b><h2>Parts of the module</h2></b></p><br />
<br><center><div><table class=MsoTable15Grid7ColorfulAccent3 border=1 cellspacing=0 cellpadding=0 width=625 style='width:468.55pt;border-collapse:collapse; border:none;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt'> <tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes; height:15.0pt'> <td width=88 nowrap valign=top style='width:66.1pt;border:none;border-bottom: solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint: 153;mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:517'><b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX;mso-bidi-font-style: italic'>IMAGE</span></b><span lang=ES-MX style='font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:"Times New Roman"; mso-fareast-language:ES-MX;mso-bidi-font-style:italic'><o:p></o:p></span></p> </td> <td width=119 valign=top style='width:89.0pt;border:none;border-bottom:solid #C2D69B 1.0pt; mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint:153; mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>CODE</span></b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></p> </td> <td width=418 nowrap valign=top style='width:313.45pt;border:none;border-bottom: solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint: 153;mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>DESCRIPTION</span></b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:0;height:83.15pt'> <td width=88 nowrap valign=top style='width:66.1pt;border:none;border-right: solid #C2D69B 1.0pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:83.15pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape id="_x0000_s1029" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:10.95pt;margin-top:3.2pt;width:66pt;height:48pt; z-index:251660800;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image007.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=88 height=64 src="https://static.igem.org/mediawiki/2014hs/4/43/PConsAroma.png" align=left hspace=12 v:shapes="_x0000_s1029"><![endif]></p> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><i><span lang=ES-MX style='font-family:Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade: 191;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p>&nbsp;</o:p></span></i></p> </td> <td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; background:#EAF1DD;mso-background-themecolor:accent3;mso-background-themetint: 51;padding:0cm 5.4pt 0cm 5.4pt;height:83.15pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119A</a></span><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'><o:p></o:p></span></p> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p> </td> <td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3; mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:83.15pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>In the specific case of our aroma module, it will help the bacteria to continuously transcribe the <span class=SpellE>WinterGreen</span> gene in order to allow the bacteria to continuously produce the aroma. </span><span class=SpellE><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size: 11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'>This</span></span><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family: Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; color:black;mso-fareast-language:ES-MX'> <span class=SpellE>promoter</span> has a <span class=SpellE>length</span> of 35bp.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:1;height:77.45pt'> <td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:77.45pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape id="_x0000_s1028" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:16.95pt;margin-top:4.25pt;width:57.75pt; height:44.25pt;z-index:251662848;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image009.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=77 height=59 src="https://static.igem.org/mediawiki/2014hs/b/b0/RNAthermAroma.png" align=left hspace=12 v:shapes="_x0000_s1028"><![endif]><i><span lang=ES-MX style='font-family: Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade:191;mso-fareast-language: ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p></td> <td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; padding:0cm 5.4pt 0cm 5.4pt;height:77.45pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><span lang=ES-MX style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K115017">BBa_K115017</a><o:p></o:p></span></p></td> <td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:77.45pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><span style='font-size:12.0pt;mso-bidi-font-size: 11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>A RNA thermometer, used for temperature post-transcriptional regulation (thermo sensor), and is designed to initiate transcription around 32°C.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:2;height:190.6pt'> <td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:190.6pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape id="_x0000_s1027" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:13.95pt;margin-top:3.2pt;width:63pt;height:51.75pt; z-index:251664896;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image011.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=84 height=69 src="https://static.igem.org/mediawiki/2014hs/b/b1/WinterGreenAroma.png" align=left hspace=12 v:shapes="_x0000_s1027"><![endif]><i><span style='font-size:3.0pt;font-family: Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade:191;mso-ansi-language: EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p></td> <td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; background:#EAF1DD;mso-background-themecolor:accent3;mso-background-themetint: 51;padding:0cm 5.4pt 0cm 5.4pt;height:190.6pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; mso-ansi-language:EN-US;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K1255001:Design">BBa_K1255001</a><o:p></o:p></span></p> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p> </td> <td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3; mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:190.6pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>Produces a <span class=SpellE>transferase</span> to convert salicylic acid into methyl salicylate (<span class=SpellE>WinterGreen</span> odor). The wintergreen odor generator requires of 2mM of salicylic acid to produce methyl salicylate. BSMT1 (<a href="http://parts.igem.org/Part:BBa_J45004">BBa_J45004</a>), <span class=SpellE>WinterGreen</span> Odor Generator original name, was created by <a href="https://2006.igem.org/wiki/index.php/MIT_2006">MIT 2006</a>. This year, the team optimized the sequence for <i>Escherichia coli</i>. </span><span class=SpellE><span lang=ES-MX style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'>The</span></span><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family: Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; color:black;mso-fareast-language:ES-MX'> new <span class=SpellE>biobrick</span> has a <span class=SpellE>length</span> of 1,074bp.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes;height:70.7pt'> <td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:70.7pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape id="_x0000_s1026" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:18pt;margin-top:1.85pt;width:59.1pt;height:49.4pt; z-index:251666944;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image013.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=79 height=66 src="https://static.igem.org/mediawiki/2014hs/6/62/TerminatorAroma.png" align=left hspace=12 v:shapes="_x0000_s1026"><![endif]></p> </td> <td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; padding:0cm 5.4pt 0cm 5.4pt;height:70.7pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><span lang=ES-MX style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a><o:p></o:p></span></p> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'>&nbsp;</p> </td> <td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:70.7pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><span style='font-size:12.0pt;mso-bidi-font-size: 11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>Part made of 6bp, responsible for transcription stop. The terminator stops the production of methyl salicylate. <o:p></o:p></span></p> </td> </tr></table></div></center><br><br />
<br />
<p><b><h2>Justification</h2></b></p><br />
<p>Different to fluorescent reporters, this module was made in order to (in the future) perform as an aroma reporter and also to test the correct function of the bacteria, for its future usage as a new reporter and functional part (CDS). It is desired to use this part in the project to replace the red fluorescent protein (RFP) in the Capture module. But it was preferable to test it apart to demonstrate its effectiveness. Similarly, this piece is also helpful when the biofilter is assembled, because when performing the filtration by silica, WinterGreen can demonstrate the presence of bacteria in the beads. </p><br />
<br />
<p>The team added the RNA thermometer in the device for regulating the production of the aroma. Another reason for selecting the RNA thermometer as a regulator was to continue the CIDEB UANL 2013 work with it.</p><br />
<br />
<p><b><h2>Other teams that used RNA thermometer and BSMT1</h2></b></p><br />
<br />
<style type="text/css"><br />
.tftable {font-size:12px;color:#333333;width:100%;border-width: 1px;border-color: #9dcc7a;border-collapse: collapse;}<br />
.tftable th {font-size:12px;background-color:#abd28e;border-width: 1px;padding: 8px;border-style: solid;border-color: #9dcc7a;text-align:left;}<br />
.tftable tr {background-color:#bedda7;}<br />
.tftable td {font-size:12px;border-width: 1px;padding: 8px;border-style: solid;border-color: #9dcc7a;}<br />
.tftable tr:hover {background-color:#ffffff;}<br />
</style><br />
<br />
<table class="tftable" border="1"><br />
<tr><th><center>Team</center></th><th><center>Part used</center></th><th><center>Description</center></th></tr><br />
<tr><td><b><a href="https://2008.igem.org/Team:TUDelft">TU Delft 2008</a></b></td><td>RNA themometer</td><td>Temperature-sensing bacteria that changescolor at different temperatures; as a temperature reporter system inlarge-scale fermentations, or as a temperature-inducible protein productionsystem.</td></tr><br />
<tr><td><b><a href="https://2009.igem.org/Team:VictoriaBC">Victoria BC 2009</a></b></td><td>RNA themometer</td><td>NAND logic gate using the ribo-key/ribo-lock system designed by <a href="https://2006.igem.org/wiki/index.php/Berkeley">Berkeley 2006</a> team , producing RFP except when the cells are grown in the presence of both arabinose and IPTG, also coupling fluorescent outputs with the ribo-thermometers made by TUDelft 2008 team.</td></tr><br />
<tr><td><b><a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico">CIDEB UANL 2013</a></b></td><td>RNA themometer</td><td>Production of Vip3ca3, which acts as a pesticide protein, regulated by specific temperatures in order to avoid overproduction and it will show activity against target organisms Coleoptera and Lepidoptera.</td></tr><br />
<tr><td><b><a href="https://2006.igem.org/wiki/index.php/MIT_2006">MIT 2006</a></b></td><td>BSMT1</td><td>This device produces methyl salicylate in the presence of salicylic acid. Methyl salicylate smells strongly of mint (wintergreen). Production of methyl salicylate was verified both by scent and by gas chromatography: <i>E. coli</i> with no WGD did not produce methyl salicylate when SA was added to the medium, while <i>E. coli</i> with the WGD did produce methyl salicylate when SA was added to the medium.</td></tr><br />
</table><br />
<br />
<p><b><h2>Project Zoom in</h2></b></p><br />
<p><center><iframe width="600" height="500" src="//www.youtube.com/embed/fd9EQNCOr2k" frameborder="0" allowfullscreen></iframe></center></p><br />
<br><br />
<br />
<p><b><h2>Bibliography/References</h2></b></p><font size="2"><br />
<br />
<p>● Huang, H. (2006, August 30). <i>Part:BBa_B1002. </i> Retrieved August 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002"> http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002</a>.</p><br />
<br />
<p>● iGEM2006_Berkeley. (2006). <i>Part:BBa_J23100</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_J23100"> http://parts.igem.org/Part:BBa_J23100</a>.</p><br />
<br />
<p>● iGEM2006_MIT. (2006). <i>Part:BBa_J45004</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_J45004"> http://parts.igem.org/Part:BBa_J45004</a>. </p><br />
<br />
<p>● iGEM CIDEB Team. (2013). <i>iGEM CIDEB UANL 2013</i>. Retrieved on March 31th, 2014. <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico/Project"> https://2013hs.igem.org/Team:CIDEB-UANL_Mexico/Project</a>. </p><br />
<br />
<p>● iGEM08_TUDelft. (2008). <i>Part:BBa_K115017</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_K115017"> http://parts.igem.org/Part:BBa_K115017</a>. </p><br />
<br />
<p>● MIT IGEM Team. (2006). <i>MIT 2006</i>. Retrieved on March 31th, 2014, from: <a href="https://2006.igem.org/wiki/index.php/MIT_2006"> https://2006.igem.org/wiki/index.php/MIT_2006</a>. </p><br />
<br />
<p>● TUDelft iGEM Team. (2008). <i>TUDelft 2008</i>. Retrieved on March 31th, 2014, from: <a href="https://2008.igem.org/Team:TUDelft"> https://2008.igem.org/Team:TUDelft</a>. </p><br />
<br />
<p>● VictoriaBC. (2009). <i>VictoriaBC 2009</i>. Retrieved on March 31th, 2014, from: <a href="https://2009.igem.org/Team:VictoriaBC"> https://2009.igem.org/Team:VictoriaBC</a>. </p><br />
<br />
<p>● Zubieta, Chole et al. (2003). <i>Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family</i>. Manuscript submitted for publication. Retrieved from <a href="www.plantcell.org"> www.plantcell.org</a>. </p></font><br />
<br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma#"><font color="blue">Return to the Top</font></a></p><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html>{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysisTeam:CIDEB-UANL Mexico/safety riskanalysis2014-06-18T20:06:04Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_safety}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Risk Analysis</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b>You can see and download the PDF version of this document, <a href="https://static.igem.org/mediawiki/2014hs/5/5f/SafetyRiskAnalysisCIDEB.pdf">Right Here!</a></b></p><br />
<br />
<br />
<p><b><h2>Overview</h2></b></p><br />
<br />
<p align="justify">IGEM CIDEB 2014 considers biosafety as important as every other points of the iGEM competition. Because of this reason, the team decided to perform a <a href="https://static.igem.org/mediawiki/2014hs/5/5f/SafetyRiskAnalysisCIDEB.pdf">Safety Risk Assessment</a> focused on the project and in the lab practices needed to accomplish it. <br />
In this assessment, a description of our host organism is made, along with the genetic modifications that were applied to it, including preventive measures to avoid its dissemination and appropriate identification and containment measures, in the case it was released into the environment. Also the overall potential risks of the project were included, taking in consideration all of the possible risks of working in our laboratory, along with preventive measures to reduce risk to a minimum.</p><br />
<br />
<br />
<p><b><h2>Organism's Description</h2></b></p><br />
<br />
<p><i>Escherichia coli (E. coli)</i> is a large and diverse genus of bacteria belonging to the <i>Enterobacteriaceae.</i> Although most strains of <i>E. coli</i> are relatively harmless, some can potentially affect humans and animals. Pathogenic kinds of <i>E. coli</i> can cause diarrhea, along with urinary tract infections, respiratory illness and pneumonia, among other symptoms. <i>E. coli</i> can be commonly found in the digestive tract of humans and many animals. It plays an important role in the decomposition and absorption of certain nutrients in the intestine that the body cannot break down by itself and to also prevent the digestive track to be colonized by other harmful bacteria.</p><br />
<p><i>E. coli</i> are capable of both aerobic and anaerobic cellular respiration, which is a characteristic that allows them to live in both oxygen rich and oxygen poor environments, which has allowed them to thrive in a wide variety of ecosystems.</p><br />
<br />
<img width=250 height=200 src="https://static.igem.org/mediawiki/2014hs/f/f3/EcoliCIDEB.jpg" align=left hspace=12><br />
<p>As a prokaryote, <i>E. coli</i> bacterium has no organelles, and its genetic information is not enclosed in a nucleus. <i>E. coli</i> protective layer consists on a cell wall and a capsule that protects it from the outside, potentially harmful environment. <i>E. coli</i> goes through binary fusion on a regular basis if given the right conditions, usually at 37° Celsius, and it is able to thrive and reproduce at a very fast rate.</p><br />
<br />
<p>As previously mentioned, <i>E. coli</i> is one of the most diverse genera of bacteria, probably due to its adaptive abilities. Although there is a wide variety of different <i>E. coli</i> strains to choose from, not all of them have the same characteristics; some of them are pathogenic and are not safe to work with, which is the main reason why during the practices at the team’s laboratory, the <i>E. coli</i>’s strain that was used is the K12 DH5-α strain, which is one of the safest strains to work with, and one of the most used in biotechnology research. The K12 DH5-α strain is characterized by its poor abilities to colonize plant and animal tissue, and a low resistance to outside-lab environment, temperature fluctuation and different media composition causing the organism to die.</p><br />
<br />
<p><i>E. coli</i>’s K12 DH5-α inability to colonize intestinal tissue was experimented in 1978 in a work made by R. Curtiss “Biological containment and cloning vector transmissibility” showing that the K12 DH5-α strain is not likely to behave as a pathogen in mammal tissue. Due to these previous mentioned characteristics, it is classified as a Class 1 Containment under the European Federation of Biotechnology guidelines, and according to the United States Environmental Control Agency (EPA) <i>E. coli</i> K12 DH5-α strain opposes a very low risk for other organisms and under contained conditions of fermentation and are safe to work with.</p><br />
<br />
<br><br />
<p><b><h2>Genetic Modifications</h2></b></p><br />
<p>In order to accomplish the iGEM CIDEB 2014 project’s objective, <i>E. coli</i> went through some genetic modifications. The E. CARU project is divided into four different modules, each one of them adding a different characteristic to the bacterium. The four modules are:</p><br />
<p> 1. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance</a></p><br />
<p> 2. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture</a></p><br />
<p> 3. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma</a></p><br />
<p> 4. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union</a></p><br />
<br />
<br><p><b>1. Resistance module</b><p><br />
<br />
<img width=260 height=210 src="https://static.igem.org/mediawiki/2014hs/0/0c/ExperimentalCIDEB.jpg" align=right hspace=12><br />
<p>Unmodified <i>E. coli</i> K-12 is able to tolerate added salt of up to 10% concentration (M. Don, 2008), however, E. CARU was tested with higher amounts than those mentioned (For further information, check the Capture module in this wiki).</p><br />
<br />
<p>In order to work with abnormal higher saline concentrations without killing the bacteria, IrrE, a gene that provides resistance to some adverse conditions for it, was introduced to <i>E. coli</i>.</p><br />
<br />
<p>The gene IrrE up regulates the production of several stress responsive proteins, protein kinases, metabolic proteins, and detoxification proteins. It also down-regulates glycerol degradation. With this global regulatory effect, <i>E. coli</i> becomes more salt tolerant (UCL, 2012).</p> <br />
<br />
<p>The module’s sequence is as follows:</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/f/ff/ResistanceCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>The sequence begins with a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), followed by an RBS (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), the gene IrrE (<a href="http://parts.igem.org/Part:BBa_K729001">BBa_K729001</a>) and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<br><p><b>2. Capture module</b><p><br />
<br />
<p>One of the most important genetic modifications in the project is the capture of sodium ions in order to desalinize water. This was made possible by taking advantage of NhaS, a putative gene which is characterized after its expression, “by its corresponding protein ability to bind and sequestering sodium ions.” (Ivey, Krulwich, 1994).</p><br />
<br />
<p>The project’s circuit sequence is:<p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/8/82/ProjectCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>Since NhaS is putative, iGEM CIDEB 2014 decided to test the module with a red fluorescence protein, which is simpler than the original reporter idea for the module, and this allowed us to test one gene at a time in each module.</p><br />
<br />
<p>The sequence used for the NhaS experimentation is:</p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/5/54/ExperimentCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>An UV Promoter (<a href="http://parts.igem.org/Part:BBa_I765001">BBa_I765001</a>) was chosen to begin the circuit in order to control the NhaS gene’s expression in E. CARU. The promoter is followed by (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), the NhaS gene (<a href="http://parts.igem.org/Part:BBa_K1255000">BBa_K1255000</a>), then the same RBS, an RFP reporter (<a href="http://parts.igem.org/Part:BBa_E1010">BBa_E1010</a>) and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<p>Basically the same, just changing the RFP reporter for BSMT1 Opt (<a href="http://parts.igem.org/Part:BBa_K1255001">BBa_K1255001</a>), which is the CDS that is able to produce a Wintergreen aroma. For further information look at the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma module</a> in this document.</p><br />
<br />
<br><p><b>3. Aroma module</b><p><br />
<br />
<p>The use of reporters differing from the usual fluorescence proteins is one of the objectives iGEM CIDEB 2014 team is pursuing by using aromatic reporters, like banana or, in this case, wintergreen odor.</p><br />
<br />
<p>The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma module</a> is used in order to prove the effectiveness of BSMT1 Opt CDS, for further use as an odor reporter for other teams and modules for this project. </p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/4/4c/AromaCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>BSMT1 (Salicylic Acid Carboxyl Methyltransferase I) is formed as part of a different circuit, composed by a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), a riboswitch (RNA thermometer, <a href="http://parts.igem.org/Part:BBa_K115017">BBa_K115017</a>), a CDS that, when it is induced by salicylic acid, it releases an enzymatic product (methyl salicylate), responsible of wintergreen odor (<a href="http://parts.igem.org/Part:BBa_K1255001">BBa_K1255001</a>), and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<img width=270 height=220 src="https://static.igem.org/mediawiki/2014hs/1/16/WgCIDEB.jpg" align=left hspace=12><br />
<p>This sequence will help to test its effectiveness and future usage as an odor reporter, since other teams (<a href="https://2006.igem.org/wiki/index.php/MIT_2006">MIT 2006</a>) have just analyzed it theoretically. <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico">IGEM CIDEB 2013</a> uses a riboswitch to induce the gene expression at high temperatures.</p><br />
<br />
<p>This piece (BSMT1 Opt) can replace RFP on capture module, or be added on union module; as wintergreen odor to demonstrate the presence of bacteria in silica beads or the capture of sodium ions on salty environments.</p><br />
<br />
<p>This module will be tested on a culture medium, and induced by salicylic acid to produce WG (WinterGreen) odor.</p><br />
<br />
<br><p><b>4. Union module</b><p><br />
<br />
<p>The main objective for iGEM CIDEB 2014 team is the construction of a biological circuit capable to capture sodium ions, and to remove them by using a silica-beads based bio-filter. In this module, the outer membrane of the bacteria is modified so it can bind silica or glass surfaces.</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/7/79/UnionCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<img width=130 height=210 src="https://static.igem.org/mediawiki/2014hs/8/88/BiofilterCIDEB.jpg" align=right hspace=12><br />
<br />
<p>This device is composed by a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), a common RBS (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), a fusion protein that of a set which includes the CDS L2 with its peptide signal and AIDA, in order to make the protein for binding silica; a membrane protein L2 (<a href="http://parts.igem.org/Part:BBa_K888000">BBa_K888000</a>); AIDA (<a href="http://parts.igem.org/Part:BBa_K888001">BBa_K888001</a>), and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<p>This module was available and proportionated by UANL iGEM 2013 team, however, iGEM CIDEB 2014 made some modifications to it, ligating the peptide signal and L2.</p><br />
<br />
<p>A silica bio-filter will be used to remove <i>E. coli</i> from the water, but, in order to have also qualitative evidence of <i>E. coli’s</i> attachment to silica beads, the aroma module’s function as reporter will indicate its presence in the silica.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Potential Risks</h2></b></p><br />
<br />
<p>The project uses <i>E. coli</i> K-12 as the host bacteria, causing it to be resistant to saline water, capture sodium ions, getting attached to silica surfaces and releasing the winter-green aroma as reporter.</p><br />
<br />
<p>Potential Risks with the bacteria are minimum because, as previously mentioned in the organism’s description, the strain used is a non-pathogenic type. <I>E. coli</i> K12 has no known survival mechanism in living tissues, nor any of the health affecting symptoms that some varieties have.</p><br />
<br />
<p><i>E. coli</i> is absolutely safe, as P Kunhert states: “They are [<i>E. coli</i> K 12] classified as biologically safe vehicles for the propagation of many efficient gene cloning and expression vectors in all major national and international guidelines on biological safety for work with recombinant DNA technology” (1995).</p><br />
<br />
<p>K-12 strain is defective in its cell wall components relevant to the ability to reorganize and adhere to the mucosal surface of colonic cells (Curtiss 1978). It does not have the type of glycocalyx required for attachment to the mucosal surface of the human colon.</p><br />
<br />
<p>Performing genetic modifications in the project was not dangerous because the materials were handled carefully, in accordance with the “Laboratory Category One” guidelines published by the World Health Organization (WHO).</p><br />
<br />
<p>The modified <i>E. coli</i> parts are safe for the environment and for human use. Variables are controlled by the team, as in the case of <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture module</a> (NhaS) which is controlled by a UV promoter.</p><br />
<br />
<p>Similarly, the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma module</a> is controlled by a Riboswitch regulated by temperature in order to decide when and how is going to be activated, besides adding salicylic acid, which is only harmful in high doses for humans, and in the project it is used in very small amounts (2mm) to activate it.</p><br />
<br />
<p>The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance module</a> is also safe, since it gives the bacteria the ability to resist adverse conditions that would normally kill it, like high temperatures, high saline levels and high UV radiation, and nevertheless the bacteria would die in a normal environment.</p><br />
<br />
<p>The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union module</a> gives E. CARU the ability to bind glass and silica surfaces, which we will use in beads form with the presentation that is used commercially. No direct risks are related to the module itself, but Silica gel beads may contain toxic and potentially carcinogenic cobalt (II) chloride, which is added as a moisture indicator in commercially available product. This point is analyzed further in the “Union as a safety measurement” section.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Lab Methods</h2></b></p><br />
<br />
<p>IGEM CIDEB 2014 had to take in consideration some aspects about biosafety when working in the project. At all times an instructor was present as a supervisor during the practices.</p><br />
<p>The team followed what the WHO’s category 1 laboratory guidelines indicated. The use of lab coat, long jeans, closed shoes and, if needed, tied hair was performed at all times while working on the lab. When managing dangerous substances gloves and/or special glasses were used depending on the situation.</p><br />
<p>When working with the trans-illuminator, the team took care of not looking directly the UV rays, instead a plastic UV protective shield and glasses were used while working with UV.</p><br />
<p>The laboratory was kept perfectly clean and dry, especially the place in which the instruments were located nearby electrical outputs. Glassware were reviewed and checked for cracks, before each usage; especially before applying under vacuum or pressure on them.</p><br />
<p>The generated waste was always placed in a properly labeled waste container, placed handily to avoid spills.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Hazardous Substances</h2></b></p><br />
<p>While working in the E.CARU project, specifically in the laboratory, the team was exposed to different substances that, if managed incorrectly, could cause harmful effects.</p><br />
<p>The main substances used in the project were the following (click for further information):</p><br />
<p>● <a href="https://static.igem.org/mediawiki/2014hs/d/de/EthidiumBromideCIDEB.pdf">Ethidium bromide</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/9e/NaOHCIDEB.pdf">NaOH</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/4/44/AceticAcidCIDEB.pdf">Acetic acid</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f9/MethylSalicylateCIDEB.pdf">Methyl salicylate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/a/a6/UV1CIDEB.pdf">UV radiation</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/74/TRIS_HCLCIDEB.pdf">Tris HCl</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/72/EDTACIDEB.pdf">EDTA (Ethylenediamineetetraacetic acid)</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/e3/DSSCIDEB.pdf">DSS (Dodecyl-sodium sulfate)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7c/PotassiumAcetateCIDEB.pdf">Potassium acetate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/6b/AgaroseCIDEB.pdf">Agarose</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/d/df/CaCl2CIDEB.pdf">Calcium Chloride (CaCl)<br></a><br />
● <a href="https://static.igem.org/mediawiki/2014hs/0/06/EthanolCIDEB.pdf">Ethanol (Ethyl Alcohol)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7a/AgarCIDEB.pdf">&ldquo;Lysogenic Broth&rdquo; (LB) broth and agar</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/ee/BuffersCIDEB.pdf">Buffers</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/97/RNaseCIDEB.pdf">RNase</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f8/RestrictionCIDEB.pdf">Restriction enzymes</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/69/SalineCIDEB.pdf">Saline water</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/c/c0/MilliQCIDEB.pdf">Milli-Q water</a></p><br />
<br />
<br><br />
<br />
<p><b><h2>Union as a safety measurement</h2></b></p><br />
<p>The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union module</a> in the project has a genetic device that gives the bacteria the ability to anchor itself to silica surfaces. The team used this ability to use the bacteria as a biological filter. This biological filter would clean the water free of <i>Escherichia coli</i> to meet a solution for salty water. </p><br />
<p>Why silica pearls? Because silica pearls are very common to find, and even though that they are known for being harmful for humans if ingested, it’s not the silica gel that is toxic, what is toxic are the substances that the silica pearl can absorb (silica gel is known for its characteristic of having a great ability for absorbing humidity). Silica is, for example, used as a safe food additive, this means no permit is needed when added.</p><br />
<p>If people are not comfortable with using silica gel pearls for the biological filter, glass pearls can also be used, as the genetic device permits anchorage to glass surfaces, and glass has the advantage of not releasing any kind of substance if introduced in water, even for long periods of time, for the bacterium to attach. Also, for more efficiency in the de-contamination, glass recipients could be used, that way it would be easier for the anchorage of the bacterium.</p><br />
<p>The functioning of the biological filter is very simple: due to the reason that after the first three modules of the project, salt water would still have the genetically modified bacteria, which will have sodium ions within its cellular membrane, a filtration process will be carried out by silica pearls, which will result in desalinized water without the before mentioned bacteria.</p><br />
<p>For the filtration process to happen, no modification was used besides the genetic information that gives <i>Escherichia coli</i> the ability to adhere to the silica gel or to glass surfaces. Thus, when bacteria have already captured the desired amount of sodium ions, by adding silica or glass beads, the bacteria will attach in these and this will help remove the GMO (Genetically Modified Organism) in the water by an easy filtration of the water to be free of silica or glass beads containing the bacteria.</p><br />
<p>The risks considered in the use of silica beads are minimal since "The silica gel is inert and considered a non-toxic product," according to CITUC (UC Toxicological Information Centre for its acronym in Spanish). Actually, if the pearls are not correctly removed, there is only one risk: choking hazard, which is prevented by the safety guidelines that are followed in the laboratory and warns that under no circumstance water should be ingested with or without the silica beads before being tested and approved.</p><br />
<p>The biological filter, besides being the main purpose of our project, is one of the team’s safety measurements, because it prevents the bacterium from contaminating and reproducing in water by being removed.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Contention Method</h2></b></p><br />
<p>When treating with GMOs there’s no such thing as “overprotection”. iGEM CIDEB 2014 takes safety seriously and decided that the project should include at least one method to shut off <i>E. coli</i> in case of an unexpected emergency situation, at least in a theoretical way.</p><br />
<p>The method proposed is simple, increasing the intensity of the UV light already used in the Project to turn off the organism.</p><br />
<p>First of all, Ultraviolet or UV light is light with wavelengths from 100 to 400 nm. According to Meulemans in 1986, its spectrum is divided into 4 different categories, as the following table shows:</p><br><br />
<br />
<style><br />
.data-table {<br />
border-collapse: collapse;<br />
}<br />
.border-top {<br />
border-top: 1px solid #000;<br />
}<br />
.border-bottom {<br />
border-bottom: 1px solid #000;<br />
}<br />
.border-left {<br />
border-left: 1px solid #000;<br />
}<br />
.border-right {<br />
border-right: 1px solid #000;<br />
}<br />
</style><br />
<img width=410 height=180 src="https://static.igem.org/mediawiki/2014hs/7/7e/Light-spectrumCIDEB.jpg" align=right hspace=12><br />
<table class="data-table" align="center"><br />
<tr><br />
<th class="border-top border-bottom border-left border-right">&nbsp;Type of UV&nbsp;</th><br />
<th class="border-top border-bottom border-right">&nbsp; Wavelenght&nbsp;</th><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;Vacuum UV&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;100 to 200nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-C&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;200 to 280nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-B&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;280 to 315nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-A&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;315 to 400nm&nbsp;</td><br />
</tr><br />
</table><br><br />
<br />
<p>EPA (United States Environmental Protection Agency) states that disinfection by UV primarily occurs due to the germicidal action of UV-B and UV-C light on microorganisms. And that the germicidal action of UV-A light is small relative to UV-B and UV-C light. So, in order for UV-A light to cause a “shut off” effect in the organism, very long exposure times are necessary.</p><br />
<p>What UV light does to microorganisms is that, once absorbed, it modifies and damages irreparably the DNA of the organism on the matters of question, in this case <i>E. coli</i> K12, by causing a photochemical damage. Therefore, RNA and DNA, molecules in charge of storing and carrying genetic information, can’t function properly, causing it to lose the ability to reproduce.</i><br />
<p>As Wolfe in 1990 states, and with the information from EPA, 254 nm is the most potent wavelength that can cause damage in DNA. 254 nm belongs to the UV-C light category and the team is planning to use it that way to deactivate E. CARU in extreme situations.</p><br />
<p>The UV light already used in the project is a promoter of the Capture module. This promoter is activated by 360nm, so it belongs in the UV-A category, and as it was mentioned before, this does not cause damage to the bacteria in short periods of time.</p><br />
<p>According to our project, UV is one of the easiest methods to shut off our GMO. </p><br />
<br />
<br />
<br><br />
<br />
<p><b><h2>Conclusions</h2></b></p><br />
<br />
<p>After doing an analysis of the possible risk related to our project and the safety measures that should be taken into consideration, it can be concluded that the project itself do not represents a considerable risk for human health, due to the poor resistance of the used strain of bacteria, even with the IrrE resistance module, the bacteria is still too weak to thrive in a non-controlled environment. Even though the bacteria cannot live outside the lab, all of the safety related issues to bio-contention of the organisms were all taken into consideration to avoid any possible contamination outside the laboratory. As previously mentioned, the bacteria does not oppose a significant threat for safety, but some substances used in the lab can be a major health concern if not managed properly. Because of this, the laboratory rules were made according to the WHO level 1 laboratory guidelines, and supervision was always present to avoid threats for the team. </p><br />
<br />
<br><br />
<p><b><h2>Bibliography/References</h2></b></p><br />
<br />
<font size="2"><p align=left>● ACETIC ACID (80%, 99.5%, Glacial). Hazard Communication Sheet. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf">http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf</a>.</p><br />
<p align=left>● Agaroses Manual. Condalab. Retrieved May 12, 2014, from: <a href="http://www.condalab.com/pdf/agarose_manual_09.pdf">http://www.condalab.com/pdf/agarose_manual_09.pdf</a>.</p><br />
<p align=left>● <i> “A toxic death for ethidium bromide”</i>. (n.d.). Laboratory News. Retrieved May 13, 2014, from: <a href="http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/">http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/</a>.</p><br />
<p align=left>● <i>Boric Acid. R.E.D. Facts. </i> Retrieved May 11, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf</a>.</p><br />
<p align=left>● Calcium Chloride - MSDS. (n.d.). <i>Calcium Chloride - MSDS</i>. Retrieved May 13, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● CHEMWATCH. <i>Sodium Dodecyl Sulfate</i>. Santa Cruz Biotechnology, Inc. Retrieved May 12, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● Curtiss, R, 1978, <i>Biological containment and cloning vector transmissibility, </i> J. Infectious Dis. 137:668-675.</p><br />
<p align=left>● Don Sarah (2008). <i>Optimal Conditions for the Growth of E Coli. </i>Retrieved May 11, 2014, from: <a href="http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli">http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli</a>.</p><br />
<p align=left>● EDETIC ACID (EDTA). <i>Summary Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f">http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f</a>.</p><br />
<p align=left>● <i>Environmental Health and Safety</i> (2007-09-10). "Silica Gel". Retrieved May 29, 2014, from: <a href="http://hazard.com/msds/mf/baker/baker/files/s1610.htm">http://hazard.com/msds/mf/baker/baker/files/s1610.htm</a>.</p><br />
<p align=left>● Environmental Protection Agency. <i>Sodium Hydroxide. R.E.ED. Facts</i>. Retrieved May 1, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf</a>.</p><br />
<p align=left>● Escherichia coli K-12 Derivatives <i>Final Risk Assessment. </i> EPA. Retrieved May 6, 2014, from: <a href="http://epa.gov/biotech_rule/pubs/fra/fra004.htm">http://epa.gov/biotech_rule/pubs/fra/fra004.htm</a>.</p><br />
<p align=left>● ETHANOL. <i>Hazard Communication Sheet</i>. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf">http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf</a>.</p><br />
<p align=left>● Ethylenediaminetetraacetic acid. <i>Summary of Initial Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf">http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf</a>.</p><br />
<p align=left>● Fotadar U, Zaveloff P, Terracio L (2005). <i>"Growth of Escherichia coli at elevated temperatures"</i>. J. Basic Microbiology. 45 (5): 403–4.doi:10.1002/jobm.200410542. PMID 16187264.</p><br />
<p align=left>● EPA (2006). <i>Ultraviolet disinfection guidance manual for the final long term 2 enhanced surface water treatment rule.</i> Retrieved May 29, 2014, from: <a href="http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf">http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf</a>.</p><br />
<p align=left>● EPA Guidance Manual (1999). <i>Alternative Disinfectants and Oxidants. </i> Chapter 8. Retrieved May 29, 2014. </p><br />
<p align=left>● <i>General Information Escherichia coli (E. coli) </i>. (2012, August 3). Centers for Disease Control and Prevention. Retrieved May 6, 2014, from: <a href="http://www.cdc.gov/ecoli/general/index.html">http://www.cdc.gov/ecoli/general/index.html</a>.</p><br />
<p align=left>● UANL Mexico (2012). <i>Recovery module. </i> Retrieved on March 28, from: <a href="https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery">https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery</a>.</p><br />
<p align=left>● Helmestine Anne Marie, 2014. <i>What happens if you eat silica gel beads? </i> Retrieved May 16, 2014, from: <a href="http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm">http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm</a>.</p><br />
<p align=left>● IGEM biosafety 2013. Retrieved May 16, 2014 from: <a href="http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf">http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf</a>.</p><br />
<p align=left>● IVEY Mark, KRULWICH Terry. (1994) <i>Sodium ion binding proteins. </i> Retrieved April 1, 2014 from: <a href="http://www.google.com.mx/patents/US5346815">http://www.google.com.mx/patents/US5346815</a>.</p><br />
<p align=left>● Jin Huh (2008). <i>Part BBa_k112808</i>. Retrieved May 16, 2014, from: <a href="https://2012.igem.org/Team:METU/KillSwitchOverview">https://2012.igem.org/Team:METU/KillSwitchOverview</a>.</p><br />
<p align=left>● Jones, T. F. (2007). <i>Investigation of Foodborne and Waterborne Disease Outbreaks. </i> In P. R. Murray, E. J. Baron, J. H. Jorgensen, M. L. Landry & M. A. Pfaller (Eds.), Manual of Clinical Microbiology (9th ed., pp. 152-169). Washignton, DC: ASM press. </p><br />
<p align=left>● Kunhert, P, J Nicolet, and J Frey. "Applied and Environmental Microbiology." <i>Rapid and accurate identification of Escherichia Coli k-12 strands. </i> Ed. P Kunhert. N.P., 31 Aug. 1995. Web. Retrieved May 13, 2014, from: <a href="http://aem.asm.org/content/61/11/4135.full.pdf">http://aem.asm.org/content/61/11/4135.full.pdf</a>.</p><br />
<p align=left>● McWilliams, M. <i>Luria Broth and Luria Agar Media and Their Uses Protocol</i>. American Society for Microbiology: Microbe Library. Retrieved May 12, 2014, from: <a href="http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Material Safety Data Sheet</i>. United Biochemicals. Retrieved May 12, 2014, from: <a href="http://www.unitedbiochemicals.com/msds/tris_hcl.pdf">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Methyl salicylate overdose</i> Medline plus Medical Encyclopedia. (n.d.). U.S National Library of Medicine. Retrieved May 13, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002683.htm">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>MIT IGEM Team. </i> (2006). MIT 2006. Retrieved on March 31, 2014, from; <a href="https://2006.igem.org/wiki/index.php/MIT_2006">https://2006.igem.org/wiki/index.php/MIT_2006</a>.</p><br />
<p align=left>● <i>Normas de Seguridad Laboratorio</i> Retrieved May 16, 2014, from: <a href="http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf">http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf</a>.</p><br />
<p align=left>● Pérez, E. (n.d.). <i>Boric acid poisoning</i>: Medline Plus Medical Encyclopedia. U.S National Library of Medicine. Retrieved May 12, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002485.html">http://www.nlm.nih.gov/medlineplus/ency/article/002485.html</a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). - <i>Worthington Enzyme Manual. </i> Retrieved May 12, 2014, from: <a href="http://www.worthington-biochem.com/RNASE/"></a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). <i>RCSB PDB-101. </i> Retrieved May 12, 2014, from: <a href="http://www.rcsb.org/pdb/101/motm.do?momID=105">http://www.rcsb.org/pdb/101/motm.do?momID=105</a>.</p><br />
<p align=left>● <i>"Silica Gel." </i> Centro De Información Toxicológica. CITUC. Red Salud UC Facultad De Medicina. Web. Retrieved May 30, 2014, from: <a href="http://www.cituc.cl/temas/ficha1.php?id=22">http://www.cituc.cl/temas/ficha1.php?id=22</a>.</p><br />
<p align=left>● <i>The known health effects of UV</i>. (n.d.). WHO. Retrieved May 13, 2014, from: <a href="http://www.who.int/uv/faq/uvhealtfac/en/">http://www.who.int/uv/faq/uvhealtfac/en/</a>.</p><br />
<p align=left>● <i>Type 1 Water, Milli-Q and Ultrapure Water System</i>. (n.d.). Retrieved May 12, 2014, from: <a href="http://www.millipore.com/lab_water/clw4/type1">http://www.millipore.com/lab_water/clw4/type1</a>.</p><br />
<p align=left>● UCL iGEM Team. (2012). <i>irrE module</i>. Retrieved March 31, 2014, from: <a href="https://2012.igem.org/Team:University_College_London/Module_5">https://2012.igem.org/Team:University_College_London/Module_5</a>.</p><br />
<p align=left>● Zubieta, Chole et al. (2003). <i>Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family. </i> Manuscript submitted for publication. Retrieved from <a href="www.plantcell.org; American Society of Plant Biologists">www.plantcell.org; American Society of Plant Biologists</a>.</p><br />
</font><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysis#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</li><br />
</ul><br />
<br></td><br />
</tr><br />
</table><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysisTeam:CIDEB-UANL Mexico/safety riskanalysis2014-06-18T20:01:59Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_safety}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Risk Analysis</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b>You can see and download the PDF version of this document, <a href="https://static.igem.org/mediawiki/2014hs/5/5f/SafetyRiskAnalysisCIDEB.pdf">Right Here!</a></b></p><br />
<br />
<br />
<p><b><h2>Overview</h2></b></p><br />
<br />
<p align="justify">IGEM CIDEB 2014 considers biosafety as important as every other points of the iGEM competition. Because of this reason, the team decided to perform a <a href="https://static.igem.org/mediawiki/2014hs/5/5f/SafetyRiskAnalysisCIDEB.pdf">Safety Risk Assessment</a> focused on the project and in the lab practices needed to accomplish it. <br />
In this assessment, a description of our host organism is made, along with the genetic modifications that were applied to it, including preventive measures to avoid its dissemination and appropriate identification and containment measures, in the case it was released into the environment. Also the overall potential risks of the project were included, taking in consideration all of the possible risks of working in our laboratory, along with preventive measures to reduce risk to a minimum.</p><br />
<br />
<br />
<p><b><h2>Organism's Description</h2></b></p><br />
<br />
<p><i>Escherichia coli (E. coli)</i> is a large and diverse genus of bacteria belonging to the <i>Enterobacteriaceae.</i> Although most strains of <i>E. coli</i> are relatively harmless, some can potentially affect humans and animals. Pathogenic kinds of <i>E. coli</i> can cause diarrhea, along with urinary tract infections, respiratory illness and pneumonia, among other symptoms. <i>E. coli</i> can be commonly found in the digestive tract of humans and many animals. It plays an important role in the decomposition and absorption of certain nutrients in the intestine that the body cannot break down by itself and to also prevent the digestive track to be colonized by other harmful bacteria.</p><br />
<p><i>E. coli</i> are capable of both aerobic and anaerobic cellular respiration, which is a characteristic that allows them to live in both oxygen rich and oxygen poor environments, which has allowed them to thrive in a wide variety of ecosystems.</p><br />
<br />
<img width=250 height=200 src="https://static.igem.org/mediawiki/2014hs/f/f3/EcoliCIDEB.jpg" align=left hspace=12><br />
<p>As a prokaryote, <i>E. coli</i> bacterium has no organelles, and its genetic information is not enclosed in a nucleus. <i>E. coli</i> protective layer consists on a cell wall and a capsule that protects it from the outside, potentially harmful environment. <i>E. coli</i> goes through binary fusion on a regular basis if given the right conditions, usually at 37° Celsius, and it is able to thrive and reproduce at a very fast rate.</p><br />
<br />
<p>As previously mentioned, <i>E. coli</i> is one of the most diverse genera of bacteria, probably due to its adaptive abilities. Although there is a wide variety of different <i>E. coli</i> strains to choose from, not all of them have the same characteristics; some of them are pathogenic and are not safe to work with, which is the main reason why during the practices at the team’s laboratory, the <i>E. coli</i>’s strain that was used is the K12 DH5-α strain, which is one of the safest strains to work with, and one of the most used in biotechnology research. The K12 DH5-α strain is characterized by its poor abilities to colonize plant and animal tissue, and a low resistance to outside-lab environment, temperature fluctuation and different media composition causing the organism to die.</p><br />
<br />
<p><i>E. coli</i>’s K12 DH5-α inability to colonize intestinal tissue was experimented in 1978 in a work made by R. Curtiss “Biological containment and cloning vector transmissibility” showing that the K12 DH5-α strain is not likely to behave as a pathogen in mammal tissue. Due to these previous mentioned characteristics, it is classified as a Class 1 Containment under the European Federation of Biotechnology guidelines, and according to the United States Environmental Control Agency (EPA) <i>E. coli</i> K12 DH5-α strain opposes a very low risk for other organisms and under contained conditions of fermentation and are safe to work with.</p><br />
<br />
<br><br />
<p><b><h2>Genetic Modifications</h2></b></p><br />
<p>In order to accomplish the iGEM CIDEB 2014 project’s objective, <i>E. coli</i> went through some genetic modifications. The E. CARU project is divided into four different modules, each one of them adding a different characteristic to the bacterium. The four modules are:</p><br />
<p> 1. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance</a></p><br />
<p> 2. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture</a></p><br />
<p> 3. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma</a></p><br />
<p> 4. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union</a></p><br />
<br />
<br><p><b>1. Resistance module</b><p><br />
<br />
<img width=260 height=210 src="https://static.igem.org/mediawiki/2014hs/0/0c/ExperimentalCIDEB.jpg" align=right hspace=12><br />
<p>Unmodified <i>E. coli</i> K-12 is able to tolerate added salt of up to 10% concentration (M. Don, 2008), however, E. CARU was tested with higher amounts than those mentioned (For further information, check the Capture module in this wiki).</p><br />
<br />
<p>In order to work with abnormal higher saline concentrations without killing the bacteria, IrrE, a gene that provides resistance to some adverse conditions for it, was introduced to <i>E. coli</i>.</p><br />
<br />
<p>The gene IrrE up regulates the production of several stress responsive proteins, protein kinases, metabolic proteins, and detoxification proteins. It also down-regulates glycerol degradation. With this global regulatory effect, <i>E. coli</i> becomes more salt tolerant (UCL, 2012).</p> <br />
<br />
<p>The module’s sequence is as follows:</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/f/ff/ResistanceCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>The sequence begins with a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), followed by an RBS (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), the gene IrrE (<a href="http://parts.igem.org/Part:BBa_K729001">BBa_K729001</a>) and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<br><p><b>2. Capture module</b><p><br />
<br />
<p>One of the most important genetic modifications in the project is the capture of sodium ions in order to desalinize water. This was made possible by taking advantage of NhaS, a putative gene which is characterized after its expression, “by its corresponding protein ability to bind and sequestering sodium ions.” (Ivey, Krulwich, 1994).</p><br />
<br />
<p>The project’s circuit sequence is:<p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/8/82/ProjectCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>Since NhaS is putative, iGEM CIDEB 2014 decided to test the module with a red fluorescence protein, which is simpler than the original reporter idea for the module, and this allowed us to test one gene at a time in each module.</p><br />
<br />
<p>The sequence used for the NhaS experimentation is:</p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/5/54/ExperimentCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>An UV Promoter (<a href="http://parts.igem.org/Part:BBa_I765001">BBa_I765001</a>) was chosen to begin the circuit in order to control the NhaS gene’s expression in E. CARU. The promoter is followed by (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), the NhaS gene (<a href="http://parts.igem.org/Part:BBa_K1255000">BBa_K1255000</a>), then the same RBS, an RFP reporter (<a href="http://parts.igem.org/Part:BBa_E1010">BBa_E1010</a>) and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<p>Basically the same, just changing the RFP reporter for BSMT1 Opt (<a href="http://parts.igem.org/Part:BBa_K1255001">BBa_K1255001</a>), which is the CDS that is able to produce a Wintergreen aroma. For further information look at the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma module</a> in this document.</p><br />
<br />
<br><p><b>3. Aroma module</b><p><br />
<br />
<p>The use of reporters differing from the usual fluorescence proteins is one of the objectives iGEM CIDEB 2014 team is pursuing by using aromatic reporters, like banana or, in this case, wintergreen odor.</p><br />
<br />
<p>The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma module</a> is used in order to prove the effectiveness of BSMT1 Opt CDS, for further use as an odor reporter for other teams and modules for this project. </p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/4/4c/AromaCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>BSMT1 (Salicylic Acid Carboxyl Methyltransferase I) is formed as part of a different circuit, composed by a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), a riboswitch (RNA thermometer, <a href="http://parts.igem.org/Part:BBa_K115017">BBa_K115017</a>), a CDS that, when it is induced by salicylic acid, it releases an enzymatic product (methyl salicylate), responsible of wintergreen odor (<a href="http://parts.igem.org/Part:BBa_K1255001">BBa_K1255001</a>), and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<img width=270 height=220 src="https://static.igem.org/mediawiki/2014hs/1/16/WgCIDEB.jpg" align=left hspace=12><br />
<p>This sequence will help to test its effectiveness and future usage as an odor reporter, since other teams (<a href="https://2006.igem.org/wiki/index.php/MIT_2006">MIT 2006</a>) have just analyzed it theoretically. <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico">IGEM CIDEB 2013</a> uses a riboswitch to induce the gene expression at high temperatures.</p><br />
<br />
<p>This piece (BSMT1 Opt) can replace RFP on capture module, or be added on union module; as wintergreen odor to demonstrate the presence of bacteria in silica beads or the capture of sodium ions on salty environments.</p><br />
<br />
<p>This module will be tested on a culture medium, and induced by salicylic acid to produce WG (WinterGreen) odor.</p><br />
<br />
<br><p><b>4. Union module</b><p><br />
<br />
<p>The main objective for iGEM CIDEB 2014 team is the construction of a biological circuit capable to capture sodium ions, and to remove them by using a silica-beads based bio-filter. In this module, the outer membrane of the bacteria is modified so it can bind silica or glass surfaces.</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/7/79/UnionCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<img width=130 height=210 src="https://static.igem.org/mediawiki/2014hs/8/88/BiofilterCIDEB.jpg" align=right hspace=12><br />
<br />
<p>This device is composed by a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), a common RBS (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), a fusion protein that of a set which includes the CDS L2 with its peptide signal and AIDA, in order to make the protein for binding silica; a membrane protein L2 (<a href="http://parts.igem.org/Part:BBa_K888000">BBa_K888000</a>); AIDA (<a href="http://parts.igem.org/Part:BBa_K888001">BBa_K888001</a>), and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<p>This module was available and proportionated by UANL iGEM 2013 team, however, iGEM CIDEB 2014 made some modifications to it, ligating the peptide signal and L2.</p><br />
<br />
<p>A silica bio-filter will be used to remove <i>E. coli</i> from the water, but, in order to have also qualitative evidence of <i>E. coli’s</i> attachment to silica beads, the aroma module’s function as reporter will indicate its presence in the silica.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Potential Risks</h2></b></p><br />
<br />
<p>The project uses <i>E. coli</i> K-12 as the host bacteria, causing it to be resistant to saline water, capture sodium ions, getting attached to silica surfaces and releasing the winter-green aroma as reporter.</p><br />
<br />
<p>Potential Risks with the bacteria are minimum because, as previously mentioned in the organism’s description, the strain used is a non-pathogenic type. <I>E. coli</i> K12 has no known survival mechanism in living tissues, nor any of the health affecting symptoms that some varieties have.</p><br />
<br />
<p><i>E. coli</i> is absolutely safe, as P Kunhert states: “They are [<i>E. coli</i> K 12] classified as biologically safe vehicles for the propagation of many efficient gene cloning and expression vectors in all major national and international guidelines on biological safety for work with recombinant DNA technology” (1995).</p><br />
<br />
<p>K-12 strain is defective in its cell wall components relevant to the ability to reorganize and adhere to the mucosal surface of colonic cells (Curtiss 1978). It does not have the type of glycocalyx required for attachment to the mucosal surface of the human colon.</p><br />
<br />
<p>Performing genetic modifications in the project was not dangerous because the materials were handled carefully, in accordance with the “Laboratory Category One” guidelines published by the World Health Organization (WHO).</p><br />
<br />
<p>The modified <i>E. coli</i> parts are safe for the environment and for human use. Variables are controlled by the team, as in the case of Capture module (NhaS) which is controlled by a UV promoter.</p><br />
<br />
<p>Similarly, the Aroma module is controlled by a Riboswitch regulated by temperature in order to decide when and how is going to be activated, besides adding salicylic acid, which is only harmful in high doses for humans, and in the project it is used in very small amounts (2mm) to activate it.</p><br />
<br />
<p>The resistance module is also safe, since it gives the bacteria the ability to resist adverse conditions that would normally kill it, like high temperatures, high saline levels and high UV radiation, and nevertheless the bacteria would die in a normal environment.</p><br />
<br />
<p>The Union module gives E. CARU the ability to bind glass and silica surfaces, which we will use in beads form with the presentation that is used commercially. No direct risks are related to the module itself, but Silica gel beads may contain toxic and potentially carcinogenic cobalt (II) chloride, which is added as a moisture indicator in commercially available product. This point is analyzed further in the “Union as a safety measurement” section.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Lab Methods</h2></b></p><br />
<br />
<p>IGEM CIDEB 2014 had to take in consideration some aspects about biosafety when working in the project. At all times an instructor was present as a supervisor during the practices.</p><br />
<p>The team followed what the WHO’s category 1 laboratory guidelines indicated. The use of lab coat, long jeans, closed shoes and, if needed, tied hair was performed at all times while working on the lab. When managing dangerous substances gloves and/or special glasses were used depending on the situation.</p><br />
<p>When working with the trans-illuminator, the team took care of not looking directly the UV rays, instead a plastic UV protective shield and glasses were used while working with UV.</p><br />
<p>The laboratory was kept perfectly clean and dry, especially the place in which the instruments were located nearby electrical outputs. Glassware were reviewed and checked for cracks, before each usage; especially before applying under vacuum or pressure on them.</p><br />
<p>The generated waste was always placed in a properly labeled waste container, placed handily to avoid spills.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Hazardous Substances</h2></b></p><br />
<p>While working in the E.CARU project, specifically in the laboratory, the team was exposed to different substances that, if managed incorrectly, could cause harmful effects.</p><br />
<p>The main substances used in the project were the following (click for further information):</p><br />
<p>● <a href="https://static.igem.org/mediawiki/2014hs/d/de/EthidiumBromideCIDEB.pdf">Ethidium bromide</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/9e/NaOHCIDEB.pdf">NaOH</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/4/44/AceticAcidCIDEB.pdf">Acetic acid</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f9/MethylSalicylateCIDEB.pdf">Methyl salicylate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/a/a6/UV1CIDEB.pdf">UV radiation</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/74/TRIS_HCLCIDEB.pdf">Tris HCl</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/72/EDTACIDEB.pdf">EDTA (Ethylenediamineetetraacetic acid)</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/e3/DSSCIDEB.pdf">DSS (Dodecyl-sodium sulfate)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7c/PotassiumAcetateCIDEB.pdf">Potassium acetate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/6b/AgaroseCIDEB.pdf">Agarose</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/d/df/CaCl2CIDEB.pdf">Calcium Chloride (CaCl)<br></a><br />
● <a href="https://static.igem.org/mediawiki/2014hs/0/06/EthanolCIDEB.pdf">Ethanol (Ethyl Alcohol)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7a/AgarCIDEB.pdf">&ldquo;Lysogenic Broth&rdquo; (LB) broth and agar</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/ee/BuffersCIDEB.pdf">Buffers</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/97/RNaseCIDEB.pdf">RNase</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f8/RestrictionCIDEB.pdf">Restriction enzymes</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/69/SalineCIDEB.pdf">Saline water</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/c/c0/MilliQCIDEB.pdf">Milli-Q water</a></p><br />
<br />
<br><br />
<br />
<p><b><h2>Union as a safety measurement</h2></b></p><br />
<p>The Union module in the project has a genetic device that gives the bacteria the ability to anchor itself to silica surfaces. The team used this ability to use the bacteria as a biological filter. This biological filter would clean the water free of <i>Escherichia coli</i> to meet a solution for salty water. </p><br />
<p>Why silica pearls? Because silica pearls are very common to find, and even though that they are known for being harmful for humans if ingested, it’s not the silica gel that is toxic, what is toxic are the substances that the silica pearl can absorb (silica gel is known for its characteristic of having a great ability for absorbing humidity). Silica is, for example, used as a safe food additive, this means no permit is needed when added.</p><br />
<p>If people are not comfortable with using silica gel pearls for the biological filter, glass pearls can also be used, as the genetic device permits anchorage to glass surfaces, and glass has the advantage of not releasing any kind of substance if introduced in water, even for long periods of time, for the bacterium to attach. Also, for more efficiency in the de-contamination, glass recipients could be used, that way it would be easier for the anchorage of the bacterium.</p><br />
<p>The functioning of the biological filter is very simple: due to the reason that after the first three modules of the project, salt water would still have the genetically modified bacteria, which will have sodium ions within its cellular membrane, a filtration process will be carried out by silica pearls, which will result in desalinized water without the before mentioned bacteria.</p><br />
<p>For the filtration process to happen, no modification was used besides the genetic information that gives <i>Escherichia coli</i> the ability to adhere to the silica gel or to glass surfaces. Thus, when bacteria have already captured the desired amount of sodium ions, by adding silica or glass beads, the bacteria will attach in these and this will help remove the GMO (Genetically Modified Organism) in the water by an easy filtration of the water to be free of silica or glass beads containing the bacteria.</p><br />
<p>The risks considered in the use of silica beads are minimal since "The silica gel is inert and considered a non-toxic product," according to CITUC (UC Toxicological Information Centre for its acronym in Spanish). Actually, if the pearls are not correctly removed, there is only one risk: choking hazard, which is prevented by the safety guidelines that are followed in the laboratory and warns that under no circumstance water should be ingested with or without the silica beads before being tested and approved.</p><br />
<p>The biological filter, besides being the main purpose of our project, is one of the team’s safety measurements, because it prevents the bacterium from contaminating and reproducing in water by being removed.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Contention Method</h2></b></p><br />
<p>When treating with GMOs there’s no such thing as “overprotection”. iGEM CIDEB 2014 takes safety seriously and decided that the project should include at least one method to shut off <i>E. coli</i> in case of an unexpected emergency situation, at least in a theoretical way.</p><br />
<p>The method proposed is simple, increasing the intensity of the UV light already used in the Project to turn off the organism.</p><br />
<p>First of all, Ultraviolet or UV light is light with wavelengths from 100 to 400 nm. According to Meulemans in 1986, its spectrum is divided into 4 different categories, as the following table shows:</p><br><br />
<br />
<style><br />
.data-table {<br />
border-collapse: collapse;<br />
}<br />
.border-top {<br />
border-top: 1px solid #000;<br />
}<br />
.border-bottom {<br />
border-bottom: 1px solid #000;<br />
}<br />
.border-left {<br />
border-left: 1px solid #000;<br />
}<br />
.border-right {<br />
border-right: 1px solid #000;<br />
}<br />
</style><br />
<img width=410 height=180 src="https://static.igem.org/mediawiki/2014hs/7/7e/Light-spectrumCIDEB.jpg" align=right hspace=12><br />
<table class="data-table" align="center"><br />
<tr><br />
<th class="border-top border-bottom border-left border-right">&nbsp;Type of UV&nbsp;</th><br />
<th class="border-top border-bottom border-right">&nbsp; Wavelenght&nbsp;</th><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;Vacuum UV&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;100 to 200nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-C&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;200 to 280nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-B&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;280 to 315nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-A&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;315 to 400nm&nbsp;</td><br />
</tr><br />
</table><br><br />
<br />
<p>EPA (United States Environmental Protection Agency) states that disinfection by UV primarily occurs due to the germicidal action of UV-B and UV-C light on microorganisms. And that the germicidal action of UV-A light is small relative to UV-B and UV-C light. So, in order for UV-A light to cause a “shut off” effect in the organism, very long exposure times are necessary.</p><br />
<p>What UV light does to microorganisms is that, once absorbed, it modifies and damages irreparably the DNA of the organism on the matters of question, in this case <i>E. coli</i> K12, by causing a photochemical damage. Therefore, RNA and DNA, molecules in charge of storing and carrying genetic information, can’t function properly, causing it to lose the ability to reproduce.</i><br />
<p>As Wolfe in 1990 states, and with the information from EPA, 254 nm is the most potent wavelength that can cause damage in DNA. 254 nm belongs to the UV-C light category and the team is planning to use it that way to deactivate E. CARU in extreme situations.</p><br />
<p>The UV light already used in the project is a promoter of the Capture module. This promoter is activated by 360nm, so it belongs in the UV-A category, and as it was mentioned before, this does not cause damage to the bacteria in short periods of time.</p><br />
<p>According to our project, UV is one of the easiest methods to shut off our GMO. </p><br />
<br />
<br />
<br><br />
<br />
<p><b><h2>Conclusions</h2></b></p><br />
<br />
<p>After doing an analysis of the possible risk related to our project and the safety measures that should be taken into consideration, it can be concluded that the project itself do not represents a considerable risk for human health, due to the poor resistance of the used strain of bacteria, even with the IrrE resistance module, the bacteria is still too weak to thrive in a non-controlled environment. Even though the bacteria cannot live outside the lab, all of the safety related issues to bio-contention of the organisms were all taken into consideration to avoid any possible contamination outside the laboratory. As previously mentioned, the bacteria does not oppose a significant threat for safety, but some substances used in the lab can be a major health concern if not managed properly. Because of this, the laboratory rules were made according to the WHO level 1 laboratory guidelines, and supervision was always present to avoid threats for the team. </p><br />
<br />
<br><br />
<p><b><h2>Bibliography/References</h2></b></p><br />
<br />
<font size="2"><p align=left>● ACETIC ACID (80%, 99.5%, Glacial). Hazard Communication Sheet. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf">http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf</a>.</p><br />
<p align=left>● Agaroses Manual. Condalab. Retrieved May 12, 2014, from: <a href="http://www.condalab.com/pdf/agarose_manual_09.pdf">http://www.condalab.com/pdf/agarose_manual_09.pdf</a>.</p><br />
<p align=left>● <i> “A toxic death for ethidium bromide”</i>. (n.d.). Laboratory News. Retrieved May 13, 2014, from: <a href="http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/">http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/</a>.</p><br />
<p align=left>● <i>Boric Acid. R.E.D. Facts. </i> Retrieved May 11, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf</a>.</p><br />
<p align=left>● Calcium Chloride - MSDS. (n.d.). <i>Calcium Chloride - MSDS</i>. Retrieved May 13, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● CHEMWATCH. <i>Sodium Dodecyl Sulfate</i>. Santa Cruz Biotechnology, Inc. Retrieved May 12, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● Curtiss, R, 1978, <i>Biological containment and cloning vector transmissibility, </i> J. Infectious Dis. 137:668-675.</p><br />
<p align=left>● Don Sarah (2008). <i>Optimal Conditions for the Growth of E Coli. </i>Retrieved May 11, 2014, from: <a href="http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli">http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli</a>.</p><br />
<p align=left>● EDETIC ACID (EDTA). <i>Summary Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f">http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f</a>.</p><br />
<p align=left>● <i>Environmental Health and Safety</i> (2007-09-10). "Silica Gel". Retrieved May 29, 2014, from: <a href="http://hazard.com/msds/mf/baker/baker/files/s1610.htm">http://hazard.com/msds/mf/baker/baker/files/s1610.htm</a>.</p><br />
<p align=left>● Environmental Protection Agency. <i>Sodium Hydroxide. R.E.ED. Facts</i>. Retrieved May 1, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf</a>.</p><br />
<p align=left>● Escherichia coli K-12 Derivatives <i>Final Risk Assessment. </i> EPA. Retrieved May 6, 2014, from: <a href="http://epa.gov/biotech_rule/pubs/fra/fra004.htm">http://epa.gov/biotech_rule/pubs/fra/fra004.htm</a>.</p><br />
<p align=left>● ETHANOL. <i>Hazard Communication Sheet</i>. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf">http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf</a>.</p><br />
<p align=left>● Ethylenediaminetetraacetic acid. <i>Summary of Initial Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf">http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf</a>.</p><br />
<p align=left>● Fotadar U, Zaveloff P, Terracio L (2005). <i>"Growth of Escherichia coli at elevated temperatures"</i>. J. Basic Microbiology. 45 (5): 403–4.doi:10.1002/jobm.200410542. PMID 16187264.</p><br />
<p align=left>● EPA (2006). <i>Ultraviolet disinfection guidance manual for the final long term 2 enhanced surface water treatment rule.</i> Retrieved May 29, 2014, from: <a href="http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf">http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf</a>.</p><br />
<p align=left>● EPA Guidance Manual (1999). <i>Alternative Disinfectants and Oxidants. </i> Chapter 8. Retrieved May 29, 2014. </p><br />
<p align=left>● <i>General Information Escherichia coli (E. coli) </i>. (2012, August 3). Centers for Disease Control and Prevention. Retrieved May 6, 2014, from: <a href="http://www.cdc.gov/ecoli/general/index.html">http://www.cdc.gov/ecoli/general/index.html</a>.</p><br />
<p align=left>● UANL Mexico (2012). <i>Recovery module. </i> Retrieved on March 28, from: <a href="https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery">https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery</a>.</p><br />
<p align=left>● Helmestine Anne Marie, 2014. <i>What happens if you eat silica gel beads? </i> Retrieved May 16, 2014, from: <a href="http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm">http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm</a>.</p><br />
<p align=left>● IGEM biosafety 2013. Retrieved May 16, 2014 from: <a href="http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf">http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf</a>.</p><br />
<p align=left>● IVEY Mark, KRULWICH Terry. (1994) <i>Sodium ion binding proteins. </i> Retrieved April 1, 2014 from: <a href="http://www.google.com.mx/patents/US5346815">http://www.google.com.mx/patents/US5346815</a>.</p><br />
<p align=left>● Jin Huh (2008). <i>Part BBa_k112808</i>. Retrieved May 16, 2014, from: <a href="https://2012.igem.org/Team:METU/KillSwitchOverview">https://2012.igem.org/Team:METU/KillSwitchOverview</a>.</p><br />
<p align=left>● Jones, T. F. (2007). <i>Investigation of Foodborne and Waterborne Disease Outbreaks. </i> In P. R. Murray, E. J. Baron, J. H. Jorgensen, M. L. Landry & M. A. Pfaller (Eds.), Manual of Clinical Microbiology (9th ed., pp. 152-169). Washignton, DC: ASM press. </p><br />
<p align=left>● Kunhert, P, J Nicolet, and J Frey. "Applied and Environmental Microbiology." <i>Rapid and accurate identification of Escherichia Coli k-12 strands. </i> Ed. P Kunhert. N.P., 31 Aug. 1995. Web. Retrieved May 13, 2014, from: <a href="http://aem.asm.org/content/61/11/4135.full.pdf">http://aem.asm.org/content/61/11/4135.full.pdf</a>.</p><br />
<p align=left>● McWilliams, M. <i>Luria Broth and Luria Agar Media and Their Uses Protocol</i>. American Society for Microbiology: Microbe Library. Retrieved May 12, 2014, from: <a href="http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Material Safety Data Sheet</i>. United Biochemicals. Retrieved May 12, 2014, from: <a href="http://www.unitedbiochemicals.com/msds/tris_hcl.pdf">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Methyl salicylate overdose</i> Medline plus Medical Encyclopedia. (n.d.). U.S National Library of Medicine. Retrieved May 13, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002683.htm">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>MIT IGEM Team. </i> (2006). MIT 2006. Retrieved on March 31, 2014, from; <a href="https://2006.igem.org/wiki/index.php/MIT_2006">https://2006.igem.org/wiki/index.php/MIT_2006</a>.</p><br />
<p align=left>● <i>Normas de Seguridad Laboratorio</i> Retrieved May 16, 2014, from: <a href="http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf">http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf</a>.</p><br />
<p align=left>● Pérez, E. (n.d.). <i>Boric acid poisoning</i>: Medline Plus Medical Encyclopedia. U.S National Library of Medicine. Retrieved May 12, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002485.html">http://www.nlm.nih.gov/medlineplus/ency/article/002485.html</a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). - <i>Worthington Enzyme Manual. </i> Retrieved May 12, 2014, from: <a href="http://www.worthington-biochem.com/RNASE/"></a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). <i>RCSB PDB-101. </i> Retrieved May 12, 2014, from: <a href="http://www.rcsb.org/pdb/101/motm.do?momID=105">http://www.rcsb.org/pdb/101/motm.do?momID=105</a>.</p><br />
<p align=left>● <i>"Silica Gel." </i> Centro De Información Toxicológica. CITUC. Red Salud UC Facultad De Medicina. Web. Retrieved May 30, 2014, from: <a href="http://www.cituc.cl/temas/ficha1.php?id=22">http://www.cituc.cl/temas/ficha1.php?id=22</a>.</p><br />
<p align=left>● <i>The known health effects of UV</i>. (n.d.). WHO. Retrieved May 13, 2014, from: <a href="http://www.who.int/uv/faq/uvhealtfac/en/">http://www.who.int/uv/faq/uvhealtfac/en/</a>.</p><br />
<p align=left>● <i>Type 1 Water, Milli-Q and Ultrapure Water System</i>. (n.d.). Retrieved May 12, 2014, from: <a href="http://www.millipore.com/lab_water/clw4/type1">http://www.millipore.com/lab_water/clw4/type1</a>.</p><br />
<p align=left>● UCL iGEM Team. (2012). <i>irrE module</i>. Retrieved March 31, 2014, from: <a href="https://2012.igem.org/Team:University_College_London/Module_5">https://2012.igem.org/Team:University_College_London/Module_5</a>.</p><br />
<p align=left>● Zubieta, Chole et al. (2003). <i>Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family. </i> Manuscript submitted for publication. Retrieved from <a href="www.plantcell.org; American Society of Plant Biologists">www.plantcell.org; American Society of Plant Biologists</a>.</p><br />
</font><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysis#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</li><br />
</ul><br />
<br></td><br />
</tr><br />
</table><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysisTeam:CIDEB-UANL Mexico/safety riskanalysis2014-06-18T20:01:06Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_safety}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Risk Analysis</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b>You can see and download the PDF version of this document, <a href="https://static.igem.org/mediawiki/2014hs/5/5f/SafetyRiskAnalysisCIDEB.pdf">Right Here!</a></b></p><br />
<br />
<br />
<p><b><h2>Overview</h2></b></p><br />
<br />
<p align="justify">IGEM CIDEB 2014 considers biosafety as important as every other points of the iGEM competition. Because of this reason, the team decided to perform a <a href="https://static.igem.org/mediawiki/2014hs/5/5f/SafetyRiskAnalysisCIDEB.pdf">Safety Risk Assessment</a> focused on the project and in the lab practices needed to accomplish it. <br />
In this assessment, a description of our host organism is made, along with the genetic modifications that were applied to it, including preventive measures to avoid its dissemination and appropriate identification and containment measures, in the case it was released into the environment. Also the overall potential risks of the project were included, taking in consideration all of the possible risks of working in our laboratory, along with preventive measures to reduce risk to a minimum.</p><br />
<br />
<br />
<p><b><h2>Organism's Description</h2></b></p><br />
<br />
<p><i>Escherichia coli (E. coli)</i> is a large and diverse genus of bacteria belonging to the <i>Enterobacteriaceae.</i> Although most strains of <i>E. coli</i> are relatively harmless, some can potentially affect humans and animals. Pathogenic kinds of <i>E. coli</i> can cause diarrhea, along with urinary tract infections, respiratory illness and pneumonia, among other symptoms. <i>E. coli</i> can be commonly found in the digestive tract of humans and many animals. It plays an important role in the decomposition and absorption of certain nutrients in the intestine that the body cannot break down by itself and to also prevent the digestive track to be colonized by other harmful bacteria.</p><br />
<p><i>E. coli</i> are capable of both aerobic and anaerobic cellular respiration, which is a characteristic that allows them to live in both oxygen rich and oxygen poor environments, which has allowed them to thrive in a wide variety of ecosystems.</p><br />
<br />
<img width=250 height=200 src="https://static.igem.org/mediawiki/2014hs/f/f3/EcoliCIDEB.jpg" align=left hspace=12><br />
<p>As a prokaryote, <i>E. coli</i> bacterium has no organelles, and its genetic information is not enclosed in a nucleus. <i>E. coli</i> protective layer consists on a cell wall and a capsule that protects it from the outside, potentially harmful environment. <i>E. coli</i> goes through binary fusion on a regular basis if given the right conditions, usually at 37° Celsius, and it is able to thrive and reproduce at a very fast rate.</p><br />
<br />
<p>As previously mentioned, <i>E. coli</i> is one of the most diverse genera of bacteria, probably due to its adaptive abilities. Although there is a wide variety of different <i>E. coli</i> strains to choose from, not all of them have the same characteristics; some of them are pathogenic and are not safe to work with, which is the main reason why during the practices at the team’s laboratory, the <i>E. coli</i>’s strain that was used is the K12 DH5-α strain, which is one of the safest strains to work with, and one of the most used in biotechnology research. The K12 DH5-α strain is characterized by its poor abilities to colonize plant and animal tissue, and a low resistance to outside-lab environment, temperature fluctuation and different media composition causing the organism to die.</p><br />
<br />
<p><i>E. coli</i>’s K12 DH5-α inability to colonize intestinal tissue was experimented in 1978 in a work made by R. Curtiss “Biological containment and cloning vector transmissibility” showing that the K12 DH5-α strain is not likely to behave as a pathogen in mammal tissue. Due to these previous mentioned characteristics, it is classified as a Class 1 Containment under the European Federation of Biotechnology guidelines, and according to the United States Environmental Control Agency (EPA) <i>E. coli</i> K12 DH5-α strain opposes a very low risk for other organisms and under contained conditions of fermentation and are safe to work with.</p><br />
<br />
<br><br />
<p><b><h2>Genetic Modifications</h2></b></p><br />
<p>In order to accomplish the iGEM CIDEB 2014 project’s objective, <i>E. coli</i> went through some genetic modifications. The E. CARU project is divided into four different modules, each one of them adding a different characteristic to the bacterium. The four modules are:</p><br />
<p> 1. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance</a></p><br />
<p> 2. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture</a></p><br />
<p> 3. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma</a></p><br />
<p> 4. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union</a></p><br />
<br />
<br><p><b>1. Resistance module</b><p><br />
<br />
<img width=260 height=210 src="https://static.igem.org/mediawiki/2014hs/0/0c/ExperimentalCIDEB.jpg" align=right hspace=12><br />
<p>Unmodified <i>E. coli</i> K-12 is able to tolerate added salt of up to 10% concentration (M. Don, 2008), however, E. CARU was tested with higher amounts than those mentioned (For further information, check the Capture module in this wiki).</p><br />
<br />
<p>In order to work with abnormal higher saline concentrations without killing the bacteria, IrrE, a gene that provides resistance to some adverse conditions for it, was introduced to <i>E. coli</i>.</p><br />
<br />
<p>The gene IrrE up regulates the production of several stress responsive proteins, protein kinases, metabolic proteins, and detoxification proteins. It also down-regulates glycerol degradation. With this global regulatory effect, <i>E. coli</i> becomes more salt tolerant (UCL, 2012).</p> <br />
<br />
<p>The module’s sequence is as follows:</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/f/ff/ResistanceCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>The sequence begins with a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), followed by an RBS (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), the gene IrrE (<a href="http://parts.igem.org/Part:BBa_K729001">BBa_K729001</a>) and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<br><p><b>2. Capture module</b><p><br />
<br />
<p>One of the most important genetic modifications in the project is the capture of sodium ions in order to desalinize water. This was made possible by taking advantage of NhaS, a putative gene which is characterized after its expression, “by its corresponding protein ability to bind and sequestering sodium ions.” (Ivey, Krulwich, 1994).</p><br />
<br />
<p>The project’s circuit sequence is:<p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/8/82/ProjectCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>Since NhaS is putative, iGEM CIDEB 2014 decided to test the module with a red fluorescence protein, which is simpler than the original reporter idea for the module, and this allowed us to test one gene at a time in each module.</p><br />
<br />
<p>The sequence used for the NhaS experimentation is:</p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/5/54/ExperimentCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>An UV Promoter (<a href="http://parts.igem.org/Part:BBa_I765001">BBa_I765001</a>) was chosen to begin the circuit in order to control the NhaS gene’s expression in E. CARU. The promoter is followed by (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), the NhaS gene (<a href="http://parts.igem.org/Part:BBa_K1255000">BBa_K1255000</a>), then the same RBS, an RFP reporter (<a href="http://parts.igem.org/Part:BBa_E1010">BBa_E1010</a>) and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<p>Basically the same, just changing the RFP reporter for BSMT1 Opt (<a href="http://parts.igem.org/Part:BBa_K1255001">BBa_K1255001</a>), which is the CDS that is able to produce a Wintergreen aroma. For further information look at the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma module</a> in this document.</p><br />
<br />
<br><p><b>3. Aroma module</b><p><br />
<br />
<p>The use of reporters differing from the usual fluorescence proteins is one of the objectives iGEM CIDEB 2014 team is pursuing by using aromatic reporters, like banana or, in this case, wintergreen odor.</p><br />
<br />
<p>The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma module<7a> is used in order to prove the effectiveness of BSMT1 Opt CDS, for further use as an odor reporter for other teams and modules for this project. </p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/4/4c/AromaCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>BSMT1 (Salicylic Acid Carboxyl Methyltransferase I) is formed as part of a different circuit, composed by a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), a riboswitch (RNA thermometer, <a href="http://parts.igem.org/Part:BBa_K115017">BBa_K115017</a>), a CDS that, when it is induced by salicylic acid, it releases an enzymatic product (methyl salicylate), responsible of wintergreen odor (<a href="http://parts.igem.org/Part:BBa_K1255001">BBa_K1255001</a>), and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<img width=270 height=220 src="https://static.igem.org/mediawiki/2014hs/1/16/WgCIDEB.jpg" align=left hspace=12><br />
<p>This sequence will help to test its effectiveness and future usage as an odor reporter, since other teams (<a href="https://2006.igem.org/wiki/index.php/MIT_2006">MIT 2006</a>) have just analyzed it theoretically. <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico">IGEM CIDEB 2013</a> uses a riboswitch to induce the gene expression at high temperatures.</p><br />
<br />
<p>This piece (BSMT1 Opt) can replace RFP on capture module, or be added on union module; as wintergreen odor to demonstrate the presence of bacteria in silica beads or the capture of sodium ions on salty environments.</p><br />
<br />
<p>This module will be tested on a culture medium, and induced by salicylic acid to produce WG (WinterGreen) odor.</p><br />
<br />
<br><p><b>4. Union module</b><p><br />
<br />
<p>The main objective for iGEM CIDEB 2014 team is the construction of a biological circuit capable to capture sodium ions, and to remove them by using a silica-beads based bio-filter. In this module, the outer membrane of the bacteria is modified so it can bind silica or glass surfaces.</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/7/79/UnionCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<img width=130 height=210 src="https://static.igem.org/mediawiki/2014hs/8/88/BiofilterCIDEB.jpg" align=right hspace=12><br />
<br />
<p>This device is composed by a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), a common RBS (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), a fusion protein that of a set which includes the CDS L2 with its peptide signal and AIDA, in order to make the protein for binding silica; a membrane protein L2 (<a href="http://parts.igem.org/Part:BBa_K888000">BBa_K888000</a>); AIDA (<a href="http://parts.igem.org/Part:BBa_K888001">BBa_K888001</a>), and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<p>This module was available and proportionated by UANL iGEM 2013 team, however, iGEM CIDEB 2014 made some modifications to it, ligating the peptide signal and L2.</p><br />
<br />
<p>A silica bio-filter will be used to remove <i>E. coli</i> from the water, but, in order to have also qualitative evidence of <i>E. coli’s</i> attachment to silica beads, the aroma module’s function as reporter will indicate its presence in the silica.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Potential Risks</h2></b></p><br />
<br />
<p>The project uses <i>E. coli</i> K-12 as the host bacteria, causing it to be resistant to saline water, capture sodium ions, getting attached to silica surfaces and releasing the winter-green aroma as reporter.</p><br />
<br />
<p>Potential Risks with the bacteria are minimum because, as previously mentioned in the organism’s description, the strain used is a non-pathogenic type. <I>E. coli</i> K12 has no known survival mechanism in living tissues, nor any of the health affecting symptoms that some varieties have.</p><br />
<br />
<p><i>E. coli</i> is absolutely safe, as P Kunhert states: “They are [<i>E. coli</i> K 12] classified as biologically safe vehicles for the propagation of many efficient gene cloning and expression vectors in all major national and international guidelines on biological safety for work with recombinant DNA technology” (1995).</p><br />
<br />
<p>K-12 strain is defective in its cell wall components relevant to the ability to reorganize and adhere to the mucosal surface of colonic cells (Curtiss 1978). It does not have the type of glycocalyx required for attachment to the mucosal surface of the human colon.</p><br />
<br />
<p>Performing genetic modifications in the project was not dangerous because the materials were handled carefully, in accordance with the “Laboratory Category One” guidelines published by the World Health Organization (WHO).</p><br />
<br />
<p>The modified <i>E. coli</i> parts are safe for the environment and for human use. Variables are controlled by the team, as in the case of Capture module (NhaS) which is controlled by a UV promoter.</p><br />
<br />
<p>Similarly, the Aroma module is controlled by a Riboswitch regulated by temperature in order to decide when and how is going to be activated, besides adding salicylic acid, which is only harmful in high doses for humans, and in the project it is used in very small amounts (2mm) to activate it.</p><br />
<br />
<p>The resistance module is also safe, since it gives the bacteria the ability to resist adverse conditions that would normally kill it, like high temperatures, high saline levels and high UV radiation, and nevertheless the bacteria would die in a normal environment.</p><br />
<br />
<p>The Union module gives E. CARU the ability to bind glass and silica surfaces, which we will use in beads form with the presentation that is used commercially. No direct risks are related to the module itself, but Silica gel beads may contain toxic and potentially carcinogenic cobalt (II) chloride, which is added as a moisture indicator in commercially available product. This point is analyzed further in the “Union as a safety measurement” section.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Lab Methods</h2></b></p><br />
<br />
<p>IGEM CIDEB 2014 had to take in consideration some aspects about biosafety when working in the project. At all times an instructor was present as a supervisor during the practices.</p><br />
<p>The team followed what the WHO’s category 1 laboratory guidelines indicated. The use of lab coat, long jeans, closed shoes and, if needed, tied hair was performed at all times while working on the lab. When managing dangerous substances gloves and/or special glasses were used depending on the situation.</p><br />
<p>When working with the trans-illuminator, the team took care of not looking directly the UV rays, instead a plastic UV protective shield and glasses were used while working with UV.</p><br />
<p>The laboratory was kept perfectly clean and dry, especially the place in which the instruments were located nearby electrical outputs. Glassware were reviewed and checked for cracks, before each usage; especially before applying under vacuum or pressure on them.</p><br />
<p>The generated waste was always placed in a properly labeled waste container, placed handily to avoid spills.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Hazardous Substances</h2></b></p><br />
<p>While working in the E.CARU project, specifically in the laboratory, the team was exposed to different substances that, if managed incorrectly, could cause harmful effects.</p><br />
<p>The main substances used in the project were the following (click for further information):</p><br />
<p>● <a href="https://static.igem.org/mediawiki/2014hs/d/de/EthidiumBromideCIDEB.pdf">Ethidium bromide</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/9e/NaOHCIDEB.pdf">NaOH</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/4/44/AceticAcidCIDEB.pdf">Acetic acid</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f9/MethylSalicylateCIDEB.pdf">Methyl salicylate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/a/a6/UV1CIDEB.pdf">UV radiation</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/74/TRIS_HCLCIDEB.pdf">Tris HCl</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/72/EDTACIDEB.pdf">EDTA (Ethylenediamineetetraacetic acid)</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/e3/DSSCIDEB.pdf">DSS (Dodecyl-sodium sulfate)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7c/PotassiumAcetateCIDEB.pdf">Potassium acetate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/6b/AgaroseCIDEB.pdf">Agarose</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/d/df/CaCl2CIDEB.pdf">Calcium Chloride (CaCl)<br></a><br />
● <a href="https://static.igem.org/mediawiki/2014hs/0/06/EthanolCIDEB.pdf">Ethanol (Ethyl Alcohol)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7a/AgarCIDEB.pdf">&ldquo;Lysogenic Broth&rdquo; (LB) broth and agar</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/ee/BuffersCIDEB.pdf">Buffers</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/97/RNaseCIDEB.pdf">RNase</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f8/RestrictionCIDEB.pdf">Restriction enzymes</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/69/SalineCIDEB.pdf">Saline water</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/c/c0/MilliQCIDEB.pdf">Milli-Q water</a></p><br />
<br />
<br><br />
<br />
<p><b><h2>Union as a safety measurement</h2></b></p><br />
<p>The Union module in the project has a genetic device that gives the bacteria the ability to anchor itself to silica surfaces. The team used this ability to use the bacteria as a biological filter. This biological filter would clean the water free of <i>Escherichia coli</i> to meet a solution for salty water. </p><br />
<p>Why silica pearls? Because silica pearls are very common to find, and even though that they are known for being harmful for humans if ingested, it’s not the silica gel that is toxic, what is toxic are the substances that the silica pearl can absorb (silica gel is known for its characteristic of having a great ability for absorbing humidity). Silica is, for example, used as a safe food additive, this means no permit is needed when added.</p><br />
<p>If people are not comfortable with using silica gel pearls for the biological filter, glass pearls can also be used, as the genetic device permits anchorage to glass surfaces, and glass has the advantage of not releasing any kind of substance if introduced in water, even for long periods of time, for the bacterium to attach. Also, for more efficiency in the de-contamination, glass recipients could be used, that way it would be easier for the anchorage of the bacterium.</p><br />
<p>The functioning of the biological filter is very simple: due to the reason that after the first three modules of the project, salt water would still have the genetically modified bacteria, which will have sodium ions within its cellular membrane, a filtration process will be carried out by silica pearls, which will result in desalinized water without the before mentioned bacteria.</p><br />
<p>For the filtration process to happen, no modification was used besides the genetic information that gives <i>Escherichia coli</i> the ability to adhere to the silica gel or to glass surfaces. Thus, when bacteria have already captured the desired amount of sodium ions, by adding silica or glass beads, the bacteria will attach in these and this will help remove the GMO (Genetically Modified Organism) in the water by an easy filtration of the water to be free of silica or glass beads containing the bacteria.</p><br />
<p>The risks considered in the use of silica beads are minimal since "The silica gel is inert and considered a non-toxic product," according to CITUC (UC Toxicological Information Centre for its acronym in Spanish). Actually, if the pearls are not correctly removed, there is only one risk: choking hazard, which is prevented by the safety guidelines that are followed in the laboratory and warns that under no circumstance water should be ingested with or without the silica beads before being tested and approved.</p><br />
<p>The biological filter, besides being the main purpose of our project, is one of the team’s safety measurements, because it prevents the bacterium from contaminating and reproducing in water by being removed.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Contention Method</h2></b></p><br />
<p>When treating with GMOs there’s no such thing as “overprotection”. iGEM CIDEB 2014 takes safety seriously and decided that the project should include at least one method to shut off <i>E. coli</i> in case of an unexpected emergency situation, at least in a theoretical way.</p><br />
<p>The method proposed is simple, increasing the intensity of the UV light already used in the Project to turn off the organism.</p><br />
<p>First of all, Ultraviolet or UV light is light with wavelengths from 100 to 400 nm. According to Meulemans in 1986, its spectrum is divided into 4 different categories, as the following table shows:</p><br><br />
<br />
<style><br />
.data-table {<br />
border-collapse: collapse;<br />
}<br />
.border-top {<br />
border-top: 1px solid #000;<br />
}<br />
.border-bottom {<br />
border-bottom: 1px solid #000;<br />
}<br />
.border-left {<br />
border-left: 1px solid #000;<br />
}<br />
.border-right {<br />
border-right: 1px solid #000;<br />
}<br />
</style><br />
<img width=410 height=180 src="https://static.igem.org/mediawiki/2014hs/7/7e/Light-spectrumCIDEB.jpg" align=right hspace=12><br />
<table class="data-table" align="center"><br />
<tr><br />
<th class="border-top border-bottom border-left border-right">&nbsp;Type of UV&nbsp;</th><br />
<th class="border-top border-bottom border-right">&nbsp; Wavelenght&nbsp;</th><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;Vacuum UV&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;100 to 200nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-C&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;200 to 280nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-B&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;280 to 315nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-A&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;315 to 400nm&nbsp;</td><br />
</tr><br />
</table><br><br />
<br />
<p>EPA (United States Environmental Protection Agency) states that disinfection by UV primarily occurs due to the germicidal action of UV-B and UV-C light on microorganisms. And that the germicidal action of UV-A light is small relative to UV-B and UV-C light. So, in order for UV-A light to cause a “shut off” effect in the organism, very long exposure times are necessary.</p><br />
<p>What UV light does to microorganisms is that, once absorbed, it modifies and damages irreparably the DNA of the organism on the matters of question, in this case <i>E. coli</i> K12, by causing a photochemical damage. Therefore, RNA and DNA, molecules in charge of storing and carrying genetic information, can’t function properly, causing it to lose the ability to reproduce.</i><br />
<p>As Wolfe in 1990 states, and with the information from EPA, 254 nm is the most potent wavelength that can cause damage in DNA. 254 nm belongs to the UV-C light category and the team is planning to use it that way to deactivate E. CARU in extreme situations.</p><br />
<p>The UV light already used in the project is a promoter of the Capture module. This promoter is activated by 360nm, so it belongs in the UV-A category, and as it was mentioned before, this does not cause damage to the bacteria in short periods of time.</p><br />
<p>According to our project, UV is one of the easiest methods to shut off our GMO. </p><br />
<br />
<br />
<br><br />
<br />
<p><b><h2>Conclusions</h2></b></p><br />
<br />
<p>After doing an analysis of the possible risk related to our project and the safety measures that should be taken into consideration, it can be concluded that the project itself do not represents a considerable risk for human health, due to the poor resistance of the used strain of bacteria, even with the IrrE resistance module, the bacteria is still too weak to thrive in a non-controlled environment. Even though the bacteria cannot live outside the lab, all of the safety related issues to bio-contention of the organisms were all taken into consideration to avoid any possible contamination outside the laboratory. As previously mentioned, the bacteria does not oppose a significant threat for safety, but some substances used in the lab can be a major health concern if not managed properly. Because of this, the laboratory rules were made according to the WHO level 1 laboratory guidelines, and supervision was always present to avoid threats for the team. </p><br />
<br />
<br><br />
<p><b><h2>Bibliography/References</h2></b></p><br />
<br />
<font size="2"><p align=left>● ACETIC ACID (80%, 99.5%, Glacial). Hazard Communication Sheet. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf">http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf</a>.</p><br />
<p align=left>● Agaroses Manual. Condalab. Retrieved May 12, 2014, from: <a href="http://www.condalab.com/pdf/agarose_manual_09.pdf">http://www.condalab.com/pdf/agarose_manual_09.pdf</a>.</p><br />
<p align=left>● <i> “A toxic death for ethidium bromide”</i>. (n.d.). Laboratory News. Retrieved May 13, 2014, from: <a href="http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/">http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/</a>.</p><br />
<p align=left>● <i>Boric Acid. R.E.D. Facts. </i> Retrieved May 11, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf</a>.</p><br />
<p align=left>● Calcium Chloride - MSDS. (n.d.). <i>Calcium Chloride - MSDS</i>. Retrieved May 13, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● CHEMWATCH. <i>Sodium Dodecyl Sulfate</i>. Santa Cruz Biotechnology, Inc. Retrieved May 12, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● Curtiss, R, 1978, <i>Biological containment and cloning vector transmissibility, </i> J. Infectious Dis. 137:668-675.</p><br />
<p align=left>● Don Sarah (2008). <i>Optimal Conditions for the Growth of E Coli. </i>Retrieved May 11, 2014, from: <a href="http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli">http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli</a>.</p><br />
<p align=left>● EDETIC ACID (EDTA). <i>Summary Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f">http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f</a>.</p><br />
<p align=left>● <i>Environmental Health and Safety</i> (2007-09-10). "Silica Gel". Retrieved May 29, 2014, from: <a href="http://hazard.com/msds/mf/baker/baker/files/s1610.htm">http://hazard.com/msds/mf/baker/baker/files/s1610.htm</a>.</p><br />
<p align=left>● Environmental Protection Agency. <i>Sodium Hydroxide. R.E.ED. Facts</i>. Retrieved May 1, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf</a>.</p><br />
<p align=left>● Escherichia coli K-12 Derivatives <i>Final Risk Assessment. </i> EPA. Retrieved May 6, 2014, from: <a href="http://epa.gov/biotech_rule/pubs/fra/fra004.htm">http://epa.gov/biotech_rule/pubs/fra/fra004.htm</a>.</p><br />
<p align=left>● ETHANOL. <i>Hazard Communication Sheet</i>. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf">http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf</a>.</p><br />
<p align=left>● Ethylenediaminetetraacetic acid. <i>Summary of Initial Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf">http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf</a>.</p><br />
<p align=left>● Fotadar U, Zaveloff P, Terracio L (2005). <i>"Growth of Escherichia coli at elevated temperatures"</i>. J. Basic Microbiology. 45 (5): 403–4.doi:10.1002/jobm.200410542. PMID 16187264.</p><br />
<p align=left>● EPA (2006). <i>Ultraviolet disinfection guidance manual for the final long term 2 enhanced surface water treatment rule.</i> Retrieved May 29, 2014, from: <a href="http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf">http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf</a>.</p><br />
<p align=left>● EPA Guidance Manual (1999). <i>Alternative Disinfectants and Oxidants. </i> Chapter 8. Retrieved May 29, 2014. </p><br />
<p align=left>● <i>General Information Escherichia coli (E. coli) </i>. (2012, August 3). Centers for Disease Control and Prevention. Retrieved May 6, 2014, from: <a href="http://www.cdc.gov/ecoli/general/index.html">http://www.cdc.gov/ecoli/general/index.html</a>.</p><br />
<p align=left>● UANL Mexico (2012). <i>Recovery module. </i> Retrieved on March 28, from: <a href="https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery">https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery</a>.</p><br />
<p align=left>● Helmestine Anne Marie, 2014. <i>What happens if you eat silica gel beads? </i> Retrieved May 16, 2014, from: <a href="http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm">http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm</a>.</p><br />
<p align=left>● IGEM biosafety 2013. Retrieved May 16, 2014 from: <a href="http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf">http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf</a>.</p><br />
<p align=left>● IVEY Mark, KRULWICH Terry. (1994) <i>Sodium ion binding proteins. </i> Retrieved April 1, 2014 from: <a href="http://www.google.com.mx/patents/US5346815">http://www.google.com.mx/patents/US5346815</a>.</p><br />
<p align=left>● Jin Huh (2008). <i>Part BBa_k112808</i>. Retrieved May 16, 2014, from: <a href="https://2012.igem.org/Team:METU/KillSwitchOverview">https://2012.igem.org/Team:METU/KillSwitchOverview</a>.</p><br />
<p align=left>● Jones, T. F. (2007). <i>Investigation of Foodborne and Waterborne Disease Outbreaks. </i> In P. R. Murray, E. J. Baron, J. H. Jorgensen, M. L. Landry & M. A. Pfaller (Eds.), Manual of Clinical Microbiology (9th ed., pp. 152-169). Washignton, DC: ASM press. </p><br />
<p align=left>● Kunhert, P, J Nicolet, and J Frey. "Applied and Environmental Microbiology." <i>Rapid and accurate identification of Escherichia Coli k-12 strands. </i> Ed. P Kunhert. N.P., 31 Aug. 1995. Web. Retrieved May 13, 2014, from: <a href="http://aem.asm.org/content/61/11/4135.full.pdf">http://aem.asm.org/content/61/11/4135.full.pdf</a>.</p><br />
<p align=left>● McWilliams, M. <i>Luria Broth and Luria Agar Media and Their Uses Protocol</i>. American Society for Microbiology: Microbe Library. Retrieved May 12, 2014, from: <a href="http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Material Safety Data Sheet</i>. United Biochemicals. Retrieved May 12, 2014, from: <a href="http://www.unitedbiochemicals.com/msds/tris_hcl.pdf">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Methyl salicylate overdose</i> Medline plus Medical Encyclopedia. (n.d.). U.S National Library of Medicine. Retrieved May 13, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002683.htm">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>MIT IGEM Team. </i> (2006). MIT 2006. Retrieved on March 31, 2014, from; <a href="https://2006.igem.org/wiki/index.php/MIT_2006">https://2006.igem.org/wiki/index.php/MIT_2006</a>.</p><br />
<p align=left>● <i>Normas de Seguridad Laboratorio</i> Retrieved May 16, 2014, from: <a href="http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf">http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf</a>.</p><br />
<p align=left>● Pérez, E. (n.d.). <i>Boric acid poisoning</i>: Medline Plus Medical Encyclopedia. U.S National Library of Medicine. Retrieved May 12, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002485.html">http://www.nlm.nih.gov/medlineplus/ency/article/002485.html</a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). - <i>Worthington Enzyme Manual. </i> Retrieved May 12, 2014, from: <a href="http://www.worthington-biochem.com/RNASE/"></a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). <i>RCSB PDB-101. </i> Retrieved May 12, 2014, from: <a href="http://www.rcsb.org/pdb/101/motm.do?momID=105">http://www.rcsb.org/pdb/101/motm.do?momID=105</a>.</p><br />
<p align=left>● <i>"Silica Gel." </i> Centro De Información Toxicológica. CITUC. Red Salud UC Facultad De Medicina. Web. Retrieved May 30, 2014, from: <a href="http://www.cituc.cl/temas/ficha1.php?id=22">http://www.cituc.cl/temas/ficha1.php?id=22</a>.</p><br />
<p align=left>● <i>The known health effects of UV</i>. (n.d.). WHO. Retrieved May 13, 2014, from: <a href="http://www.who.int/uv/faq/uvhealtfac/en/">http://www.who.int/uv/faq/uvhealtfac/en/</a>.</p><br />
<p align=left>● <i>Type 1 Water, Milli-Q and Ultrapure Water System</i>. (n.d.). Retrieved May 12, 2014, from: <a href="http://www.millipore.com/lab_water/clw4/type1">http://www.millipore.com/lab_water/clw4/type1</a>.</p><br />
<p align=left>● UCL iGEM Team. (2012). <i>irrE module</i>. Retrieved March 31, 2014, from: <a href="https://2012.igem.org/Team:University_College_London/Module_5">https://2012.igem.org/Team:University_College_London/Module_5</a>.</p><br />
<p align=left>● Zubieta, Chole et al. (2003). <i>Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family. </i> Manuscript submitted for publication. Retrieved from <a href="www.plantcell.org; American Society of Plant Biologists">www.plantcell.org; American Society of Plant Biologists</a>.</p><br />
</font><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysis#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</li><br />
</ul><br />
<br></td><br />
</tr><br />
</table><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysisTeam:CIDEB-UANL Mexico/safety riskanalysis2014-06-18T19:59:29Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_safety}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Risk Analysis</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b>You can see and download the PDF version of this document, <a href="https://static.igem.org/mediawiki/2014hs/5/5f/SafetyRiskAnalysisCIDEB.pdf">Right Here!</a></b></p><br />
<br />
<br />
<p><b><h2>Overview</h2></b></p><br />
<br />
<p align="justify">IGEM CIDEB 2014 considers biosafety as important as every other points of the iGEM competition. Because of this reason, the team decided to perform a <a href="https://static.igem.org/mediawiki/2014hs/5/5f/SafetyRiskAnalysisCIDEB.pdf">Safety Risk Assessment</a> focused on the project and in the lab practices needed to accomplish it. <br />
In this assessment, a description of our host organism is made, along with the genetic modifications that were applied to it, including preventive measures to avoid its dissemination and appropriate identification and containment measures, in the case it was released into the environment. Also the overall potential risks of the project were included, taking in consideration all of the possible risks of working in our laboratory, along with preventive measures to reduce risk to a minimum.</p><br />
<br />
<br />
<p><b><h2>Organism's Description</h2></b></p><br />
<br />
<p><i>Escherichia coli (E. coli)</i> is a large and diverse genus of bacteria belonging to the <i>Enterobacteriaceae.</i> Although most strains of <i>E. coli</i> are relatively harmless, some can potentially affect humans and animals. Pathogenic kinds of <i>E. coli</i> can cause diarrhea, along with urinary tract infections, respiratory illness and pneumonia, among other symptoms. <i>E. coli</i> can be commonly found in the digestive tract of humans and many animals. It plays an important role in the decomposition and absorption of certain nutrients in the intestine that the body cannot break down by itself and to also prevent the digestive track to be colonized by other harmful bacteria.</p><br />
<p><i>E. coli</i> are capable of both aerobic and anaerobic cellular respiration, which is a characteristic that allows them to live in both oxygen rich and oxygen poor environments, which has allowed them to thrive in a wide variety of ecosystems.</p><br />
<br />
<img width=250 height=200 src="https://static.igem.org/mediawiki/2014hs/f/f3/EcoliCIDEB.jpg" align=left hspace=12><br />
<p>As a prokaryote, <i>E. coli</i> bacterium has no organelles, and its genetic information is not enclosed in a nucleus. <i>E. coli</i> protective layer consists on a cell wall and a capsule that protects it from the outside, potentially harmful environment. <i>E. coli</i> goes through binary fusion on a regular basis if given the right conditions, usually at 37° Celsius, and it is able to thrive and reproduce at a very fast rate.</p><br />
<br />
<p>As previously mentioned, <i>E. coli</i> is one of the most diverse genera of bacteria, probably due to its adaptive abilities. Although there is a wide variety of different <i>E. coli</i> strains to choose from, not all of them have the same characteristics; some of them are pathogenic and are not safe to work with, which is the main reason why during the practices at the team’s laboratory, the <i>E. coli</i>’s strain that was used is the K12 DH5-α strain, which is one of the safest strains to work with, and one of the most used in biotechnology research. The K12 DH5-α strain is characterized by its poor abilities to colonize plant and animal tissue, and a low resistance to outside-lab environment, temperature fluctuation and different media composition causing the organism to die.</p><br />
<br />
<p><i>E. coli</i>’s K12 DH5-α inability to colonize intestinal tissue was experimented in 1978 in a work made by R. Curtiss “Biological containment and cloning vector transmissibility” showing that the K12 DH5-α strain is not likely to behave as a pathogen in mammal tissue. Due to these previous mentioned characteristics, it is classified as a Class 1 Containment under the European Federation of Biotechnology guidelines, and according to the United States Environmental Control Agency (EPA) <i>E. coli</i> K12 DH5-α strain opposes a very low risk for other organisms and under contained conditions of fermentation and are safe to work with.</p><br />
<br />
<br><br />
<p><b><h2>Genetic Modifications</h2></b></p><br />
<p>In order to accomplish the iGEM CIDEB 2014 project’s objective, <i>E. coli</i> went through some genetic modifications. The E. CARU project is divided into four different modules, each one of them adding a different characteristic to the bacterium. The four modules are:</p><br />
<p> 1. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance</a></p><br />
<p> 2. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture</a></p><br />
<p> 3. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma</a></p><br />
<p> 4. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union</a></p><br />
<br />
<br><p><b>1. Resistance module</b><p><br />
<br />
<img width=260 height=210 src="https://static.igem.org/mediawiki/2014hs/0/0c/ExperimentalCIDEB.jpg" align=right hspace=12><br />
<p>Unmodified <i>E. coli</i> K-12 is able to tolerate added salt of up to 10% concentration (M. Don, 2008), however, E. CARU was tested with higher amounts than those mentioned (For further information, check the Capture module in this wiki).</p><br />
<br />
<p>In order to work with abnormal higher saline concentrations without killing the bacteria, IrrE, a gene that provides resistance to some adverse conditions for it, was introduced to <i>E. coli</i>.</p><br />
<br />
<p>The gene IrrE up regulates the production of several stress responsive proteins, protein kinases, metabolic proteins, and detoxification proteins. It also down-regulates glycerol degradation. With this global regulatory effect, <i>E. coli</i> becomes more salt tolerant (UCL, 2012).</p> <br />
<br />
<p>The module’s sequence is as follows:</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/f/ff/ResistanceCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>The sequence begins with a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), followed by an RBS (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), the gene IrrE (<a href="http://parts.igem.org/Part:BBa_K729001">BBa_K729001</a>) and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<br><p><b>2. Capture module</b><p><br />
<br />
<p>One of the most important genetic modifications in the project is the capture of sodium ions in order to desalinize water. This was made possible by taking advantage of NhaS, a putative gene which is characterized after its expression, “by its corresponding protein ability to bind and sequestering sodium ions.” (Ivey, Krulwich, 1994).</p><br />
<br />
<p>The project’s circuit sequence is:<p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/8/82/ProjectCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>Since NhaS is putative, iGEM CIDEB 2014 decided to test the module with a red fluorescence protein, which is simpler than the original reporter idea for the module, and this allowed us to test one gene at a time in each module.</p><br />
<br />
<p>The sequence used for the NhaS experimentation is:</p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/5/54/ExperimentCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>An UV Promoter (<a href="http://parts.igem.org/Part:BBa_I765001">BBa_I765001</a>) was chosen to begin the circuit in order to control the NhaS gene’s expression in E. CARU. The promoter is followed by (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), the NhaS gene (<a href="http://parts.igem.org/Part:BBa_K1255000">BBa_K1255000</a>), then the same RBS, an RFP reporter (<a href="http://parts.igem.org/Part:BBa_E1010">BBa_E1010</a>) and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<p>Basically the same, just changing the RFP reporter for BSMT1 Opt (<a href="http://parts.igem.org/Part:BBa_K1255001">BBa_K1255001</a>), which is the CDS that is able to produce a Wintergreen aroma. For further information look at the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma module</a> in this document.</p><br />
<br />
<br><p><b>3. Aroma module</b><p><br />
<br />
<p>The use of reporters differing from the usual fluorescence proteins is one of the objectives iGEM CIDEB 2014 team is pursuing by using aromatic reporters, like banana or, in this case, wintergreen odor.</p><br />
<br />
<p>The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma module<7a> is used in order to prove the effectiveness of BSMT1 Opt CDS, for further use as an odor reporter for other teams and modules for this project. </p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/4/4c/AromaCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>BSMT1 (Salicylic Acid Carboxyl Methyltransferase I) is formed as part of a different circuit, composed by a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), a riboswitch (RNA thermometer, <a href="http://parts.igem.org/Part:BBa_K115017">BBa_K115017</a>), a CDS that, when it is induced by salicylic acid, it releases an enzymatic product (methyl salicylate), responsible of wintergreen odor (<a href="http://parts.igem.org/Part:BBa_K1255001">BBa_K1255001</a>), and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<img width=270 height=220 src="https://static.igem.org/mediawiki/2014hs/1/16/WgCIDEB.jpg" align=left hspace=12><br />
<p>This sequence will help to test its effectiveness and future usage as an odor reporter, since other teams (MIT 2006) have just analyzed it theoretically. IGEM CIDEB 2013 uses a riboswitch to induce the gene expression at high temperatures.</p><br />
<br />
<p>This piece (BSMT1 Opt) can replace RFP on capture module, or be added on union module; as wintergreen odor to demonstrate the presence of bacteria in silica beads or the capture of sodium ions on salty environments.</p><br />
<br />
<p>This module will be tested on a culture medium, and induced by salicylic acid to produce WG (WinterGreen) odor.</p><br />
<br />
<br><p><b>4. Union module</b><p><br />
<br />
<p>The main objective for iGEM CIDEB 2014 team is the construction of a biological circuit capable to capture sodium ions, and to remove them by using a silica-beads based bio-filter. In this module, the outer membrane of the bacteria is modified so it can bind silica or glass surfaces.</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/7/79/UnionCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<img width=130 height=210 src="https://static.igem.org/mediawiki/2014hs/8/88/BiofilterCIDEB.jpg" align=right hspace=12><br />
<br />
<p>This device is composed by a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), a common RBS (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), a fusion protein that of a set which includes the CDS L2 with its peptide signal and AIDA, in order to make the protein for binding silica; a membrane protein L2 (<a href="http://parts.igem.org/Part:BBa_K888000">BBa_K888000</a>); AIDA (<a href="http://parts.igem.org/Part:BBa_K888001">BBa_K888001</a>), and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<p>This module was available and proportionated by UANL iGEM 2013 team, however, iGEM CIDEB 2014 made some modifications to it, ligating the peptide signal and L2.</p><br />
<br />
<p>A silica bio-filter will be used to remove <i>E. coli</i> from the water, but, in order to have also qualitative evidence of <i>E. coli’s</i> attachment to silica beads, the aroma module’s function as reporter will indicate its presence in the silica.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Potential Risks</h2></b></p><br />
<br />
<p>The project uses <i>E. coli</i> K-12 as the host bacteria, causing it to be resistant to saline water, capture sodium ions, getting attached to silica surfaces and releasing the winter-green aroma as reporter.</p><br />
<br />
<p>Potential Risks with the bacteria are minimum because, as previously mentioned in the organism’s description, the strain used is a non-pathogenic type. <I>E. coli</i> K12 has no known survival mechanism in living tissues, nor any of the health affecting symptoms that some varieties have.</p><br />
<br />
<p><i>E. coli</i> is absolutely safe, as P Kunhert states: “They are [<i>E. coli</i> K 12] classified as biologically safe vehicles for the propagation of many efficient gene cloning and expression vectors in all major national and international guidelines on biological safety for work with recombinant DNA technology” (1995).</p><br />
<br />
<p>K-12 strain is defective in its cell wall components relevant to the ability to reorganize and adhere to the mucosal surface of colonic cells (Curtiss 1978). It does not have the type of glycocalyx required for attachment to the mucosal surface of the human colon.</p><br />
<br />
<p>Performing genetic modifications in the project was not dangerous because the materials were handled carefully, in accordance with the “Laboratory Category One” guidelines published by the World Health Organization (WHO).</p><br />
<br />
<p>The modified <i>E. coli</i> parts are safe for the environment and for human use. Variables are controlled by the team, as in the case of Capture module (NhaS) which is controlled by a UV promoter.</p><br />
<br />
<p>Similarly, the Aroma module is controlled by a Riboswitch regulated by temperature in order to decide when and how is going to be activated, besides adding salicylic acid, which is only harmful in high doses for humans, and in the project it is used in very small amounts (2mm) to activate it.</p><br />
<br />
<p>The resistance module is also safe, since it gives the bacteria the ability to resist adverse conditions that would normally kill it, like high temperatures, high saline levels and high UV radiation, and nevertheless the bacteria would die in a normal environment.</p><br />
<br />
<p>The Union module gives E. CARU the ability to bind glass and silica surfaces, which we will use in beads form with the presentation that is used commercially. No direct risks are related to the module itself, but Silica gel beads may contain toxic and potentially carcinogenic cobalt (II) chloride, which is added as a moisture indicator in commercially available product. This point is analyzed further in the “Union as a safety measurement” section.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Lab Methods</h2></b></p><br />
<br />
<p>IGEM CIDEB 2014 had to take in consideration some aspects about biosafety when working in the project. At all times an instructor was present as a supervisor during the practices.</p><br />
<p>The team followed what the WHO’s category 1 laboratory guidelines indicated. The use of lab coat, long jeans, closed shoes and, if needed, tied hair was performed at all times while working on the lab. When managing dangerous substances gloves and/or special glasses were used depending on the situation.</p><br />
<p>When working with the trans-illuminator, the team took care of not looking directly the UV rays, instead a plastic UV protective shield and glasses were used while working with UV.</p><br />
<p>The laboratory was kept perfectly clean and dry, especially the place in which the instruments were located nearby electrical outputs. Glassware were reviewed and checked for cracks, before each usage; especially before applying under vacuum or pressure on them.</p><br />
<p>The generated waste was always placed in a properly labeled waste container, placed handily to avoid spills.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Hazardous Substances</h2></b></p><br />
<p>While working in the E.CARU project, specifically in the laboratory, the team was exposed to different substances that, if managed incorrectly, could cause harmful effects.</p><br />
<p>The main substances used in the project were the following (click for further information):</p><br />
<p>● <a href="https://static.igem.org/mediawiki/2014hs/d/de/EthidiumBromideCIDEB.pdf">Ethidium bromide</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/9e/NaOHCIDEB.pdf">NaOH</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/4/44/AceticAcidCIDEB.pdf">Acetic acid</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f9/MethylSalicylateCIDEB.pdf">Methyl salicylate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/a/a6/UV1CIDEB.pdf">UV radiation</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/74/TRIS_HCLCIDEB.pdf">Tris HCl</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/72/EDTACIDEB.pdf">EDTA (Ethylenediamineetetraacetic acid)</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/e3/DSSCIDEB.pdf">DSS (Dodecyl-sodium sulfate)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7c/PotassiumAcetateCIDEB.pdf">Potassium acetate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/6b/AgaroseCIDEB.pdf">Agarose</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/d/df/CaCl2CIDEB.pdf">Calcium Chloride (CaCl)<br></a><br />
● <a href="https://static.igem.org/mediawiki/2014hs/0/06/EthanolCIDEB.pdf">Ethanol (Ethyl Alcohol)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7a/AgarCIDEB.pdf">&ldquo;Lysogenic Broth&rdquo; (LB) broth and agar</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/ee/BuffersCIDEB.pdf">Buffers</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/97/RNaseCIDEB.pdf">RNase</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f8/RestrictionCIDEB.pdf">Restriction enzymes</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/69/SalineCIDEB.pdf">Saline water</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/c/c0/MilliQCIDEB.pdf">Milli-Q water</a></p><br />
<br />
<br><br />
<br />
<p><b><h2>Union as a safety measurement</h2></b></p><br />
<p>The Union module in the project has a genetic device that gives the bacteria the ability to anchor itself to silica surfaces. The team used this ability to use the bacteria as a biological filter. This biological filter would clean the water free of <i>Escherichia coli</i> to meet a solution for salty water. </p><br />
<p>Why silica pearls? Because silica pearls are very common to find, and even though that they are known for being harmful for humans if ingested, it’s not the silica gel that is toxic, what is toxic are the substances that the silica pearl can absorb (silica gel is known for its characteristic of having a great ability for absorbing humidity). Silica is, for example, used as a safe food additive, this means no permit is needed when added.</p><br />
<p>If people are not comfortable with using silica gel pearls for the biological filter, glass pearls can also be used, as the genetic device permits anchorage to glass surfaces, and glass has the advantage of not releasing any kind of substance if introduced in water, even for long periods of time, for the bacterium to attach. Also, for more efficiency in the de-contamination, glass recipients could be used, that way it would be easier for the anchorage of the bacterium.</p><br />
<p>The functioning of the biological filter is very simple: due to the reason that after the first three modules of the project, salt water would still have the genetically modified bacteria, which will have sodium ions within its cellular membrane, a filtration process will be carried out by silica pearls, which will result in desalinized water without the before mentioned bacteria.</p><br />
<p>For the filtration process to happen, no modification was used besides the genetic information that gives <i>Escherichia coli</i> the ability to adhere to the silica gel or to glass surfaces. Thus, when bacteria have already captured the desired amount of sodium ions, by adding silica or glass beads, the bacteria will attach in these and this will help remove the GMO (Genetically Modified Organism) in the water by an easy filtration of the water to be free of silica or glass beads containing the bacteria.</p><br />
<p>The risks considered in the use of silica beads are minimal since "The silica gel is inert and considered a non-toxic product," according to CITUC (UC Toxicological Information Centre for its acronym in Spanish). Actually, if the pearls are not correctly removed, there is only one risk: choking hazard, which is prevented by the safety guidelines that are followed in the laboratory and warns that under no circumstance water should be ingested with or without the silica beads before being tested and approved.</p><br />
<p>The biological filter, besides being the main purpose of our project, is one of the team’s safety measurements, because it prevents the bacterium from contaminating and reproducing in water by being removed.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Contention Method</h2></b></p><br />
<p>When treating with GMOs there’s no such thing as “overprotection”. iGEM CIDEB 2014 takes safety seriously and decided that the project should include at least one method to shut off <i>E. coli</i> in case of an unexpected emergency situation, at least in a theoretical way.</p><br />
<p>The method proposed is simple, increasing the intensity of the UV light already used in the Project to turn off the organism.</p><br />
<p>First of all, Ultraviolet or UV light is light with wavelengths from 100 to 400 nm. According to Meulemans in 1986, its spectrum is divided into 4 different categories, as the following table shows:</p><br><br />
<br />
<style><br />
.data-table {<br />
border-collapse: collapse;<br />
}<br />
.border-top {<br />
border-top: 1px solid #000;<br />
}<br />
.border-bottom {<br />
border-bottom: 1px solid #000;<br />
}<br />
.border-left {<br />
border-left: 1px solid #000;<br />
}<br />
.border-right {<br />
border-right: 1px solid #000;<br />
}<br />
</style><br />
<img width=410 height=180 src="https://static.igem.org/mediawiki/2014hs/7/7e/Light-spectrumCIDEB.jpg" align=right hspace=12><br />
<table class="data-table" align="center"><br />
<tr><br />
<th class="border-top border-bottom border-left border-right">&nbsp;Type of UV&nbsp;</th><br />
<th class="border-top border-bottom border-right">&nbsp; Wavelenght&nbsp;</th><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;Vacuum UV&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;100 to 200nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-C&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;200 to 280nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-B&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;280 to 315nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-A&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;315 to 400nm&nbsp;</td><br />
</tr><br />
</table><br><br />
<br />
<p>EPA (United States Environmental Protection Agency) states that disinfection by UV primarily occurs due to the germicidal action of UV-B and UV-C light on microorganisms. And that the germicidal action of UV-A light is small relative to UV-B and UV-C light. So, in order for UV-A light to cause a “shut off” effect in the organism, very long exposure times are necessary.</p><br />
<p>What UV light does to microorganisms is that, once absorbed, it modifies and damages irreparably the DNA of the organism on the matters of question, in this case <i>E. coli</i> K12, by causing a photochemical damage. Therefore, RNA and DNA, molecules in charge of storing and carrying genetic information, can’t function properly, causing it to lose the ability to reproduce.</i><br />
<p>As Wolfe in 1990 states, and with the information from EPA, 254 nm is the most potent wavelength that can cause damage in DNA. 254 nm belongs to the UV-C light category and the team is planning to use it that way to deactivate E. CARU in extreme situations.</p><br />
<p>The UV light already used in the project is a promoter of the Capture module. This promoter is activated by 360nm, so it belongs in the UV-A category, and as it was mentioned before, this does not cause damage to the bacteria in short periods of time.</p><br />
<p>According to our project, UV is one of the easiest methods to shut off our GMO. </p><br />
<br />
<br />
<br><br />
<br />
<p><b><h2>Conclusions</h2></b></p><br />
<br />
<p>After doing an analysis of the possible risk related to our project and the safety measures that should be taken into consideration, it can be concluded that the project itself do not represents a considerable risk for human health, due to the poor resistance of the used strain of bacteria, even with the IrrE resistance module, the bacteria is still too weak to thrive in a non-controlled environment. Even though the bacteria cannot live outside the lab, all of the safety related issues to bio-contention of the organisms were all taken into consideration to avoid any possible contamination outside the laboratory. As previously mentioned, the bacteria does not oppose a significant threat for safety, but some substances used in the lab can be a major health concern if not managed properly. Because of this, the laboratory rules were made according to the WHO level 1 laboratory guidelines, and supervision was always present to avoid threats for the team. </p><br />
<br />
<br><br />
<p><b><h2>Bibliography/References</h2></b></p><br />
<br />
<font size="2"><p align=left>● ACETIC ACID (80%, 99.5%, Glacial). Hazard Communication Sheet. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf">http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf</a>.</p><br />
<p align=left>● Agaroses Manual. Condalab. Retrieved May 12, 2014, from: <a href="http://www.condalab.com/pdf/agarose_manual_09.pdf">http://www.condalab.com/pdf/agarose_manual_09.pdf</a>.</p><br />
<p align=left>● <i> “A toxic death for ethidium bromide”</i>. (n.d.). Laboratory News. Retrieved May 13, 2014, from: <a href="http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/">http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/</a>.</p><br />
<p align=left>● <i>Boric Acid. R.E.D. Facts. </i> Retrieved May 11, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf</a>.</p><br />
<p align=left>● Calcium Chloride - MSDS. (n.d.). <i>Calcium Chloride - MSDS</i>. Retrieved May 13, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● CHEMWATCH. <i>Sodium Dodecyl Sulfate</i>. Santa Cruz Biotechnology, Inc. Retrieved May 12, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● Curtiss, R, 1978, <i>Biological containment and cloning vector transmissibility, </i> J. Infectious Dis. 137:668-675.</p><br />
<p align=left>● Don Sarah (2008). <i>Optimal Conditions for the Growth of E Coli. </i>Retrieved May 11, 2014, from: <a href="http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli">http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli</a>.</p><br />
<p align=left>● EDETIC ACID (EDTA). <i>Summary Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f">http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f</a>.</p><br />
<p align=left>● <i>Environmental Health and Safety</i> (2007-09-10). "Silica Gel". Retrieved May 29, 2014, from: <a href="http://hazard.com/msds/mf/baker/baker/files/s1610.htm">http://hazard.com/msds/mf/baker/baker/files/s1610.htm</a>.</p><br />
<p align=left>● Environmental Protection Agency. <i>Sodium Hydroxide. R.E.ED. Facts</i>. Retrieved May 1, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf</a>.</p><br />
<p align=left>● Escherichia coli K-12 Derivatives <i>Final Risk Assessment. </i> EPA. Retrieved May 6, 2014, from: <a href="http://epa.gov/biotech_rule/pubs/fra/fra004.htm">http://epa.gov/biotech_rule/pubs/fra/fra004.htm</a>.</p><br />
<p align=left>● ETHANOL. <i>Hazard Communication Sheet</i>. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf">http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf</a>.</p><br />
<p align=left>● Ethylenediaminetetraacetic acid. <i>Summary of Initial Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf">http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf</a>.</p><br />
<p align=left>● Fotadar U, Zaveloff P, Terracio L (2005). <i>"Growth of Escherichia coli at elevated temperatures"</i>. J. Basic Microbiology. 45 (5): 403–4.doi:10.1002/jobm.200410542. PMID 16187264.</p><br />
<p align=left>● EPA (2006). <i>Ultraviolet disinfection guidance manual for the final long term 2 enhanced surface water treatment rule.</i> Retrieved May 29, 2014, from: <a href="http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf">http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf</a>.</p><br />
<p align=left>● EPA Guidance Manual (1999). <i>Alternative Disinfectants and Oxidants. </i> Chapter 8. Retrieved May 29, 2014. </p><br />
<p align=left>● <i>General Information Escherichia coli (E. coli) </i>. (2012, August 3). Centers for Disease Control and Prevention. Retrieved May 6, 2014, from: <a href="http://www.cdc.gov/ecoli/general/index.html">http://www.cdc.gov/ecoli/general/index.html</a>.</p><br />
<p align=left>● UANL Mexico (2012). <i>Recovery module. </i> Retrieved on March 28, from: <a href="https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery">https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery</a>.</p><br />
<p align=left>● Helmestine Anne Marie, 2014. <i>What happens if you eat silica gel beads? </i> Retrieved May 16, 2014, from: <a href="http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm">http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm</a>.</p><br />
<p align=left>● IGEM biosafety 2013. Retrieved May 16, 2014 from: <a href="http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf">http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf</a>.</p><br />
<p align=left>● IVEY Mark, KRULWICH Terry. (1994) <i>Sodium ion binding proteins. </i> Retrieved April 1, 2014 from: <a href="http://www.google.com.mx/patents/US5346815">http://www.google.com.mx/patents/US5346815</a>.</p><br />
<p align=left>● Jin Huh (2008). <i>Part BBa_k112808</i>. Retrieved May 16, 2014, from: <a href="https://2012.igem.org/Team:METU/KillSwitchOverview">https://2012.igem.org/Team:METU/KillSwitchOverview</a>.</p><br />
<p align=left>● Jones, T. F. (2007). <i>Investigation of Foodborne and Waterborne Disease Outbreaks. </i> In P. R. Murray, E. J. Baron, J. H. Jorgensen, M. L. Landry & M. A. Pfaller (Eds.), Manual of Clinical Microbiology (9th ed., pp. 152-169). Washignton, DC: ASM press. </p><br />
<p align=left>● Kunhert, P, J Nicolet, and J Frey. "Applied and Environmental Microbiology." <i>Rapid and accurate identification of Escherichia Coli k-12 strands. </i> Ed. P Kunhert. N.P., 31 Aug. 1995. Web. Retrieved May 13, 2014, from: <a href="http://aem.asm.org/content/61/11/4135.full.pdf">http://aem.asm.org/content/61/11/4135.full.pdf</a>.</p><br />
<p align=left>● McWilliams, M. <i>Luria Broth and Luria Agar Media and Their Uses Protocol</i>. American Society for Microbiology: Microbe Library. Retrieved May 12, 2014, from: <a href="http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Material Safety Data Sheet</i>. United Biochemicals. Retrieved May 12, 2014, from: <a href="http://www.unitedbiochemicals.com/msds/tris_hcl.pdf">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Methyl salicylate overdose</i> Medline plus Medical Encyclopedia. (n.d.). U.S National Library of Medicine. Retrieved May 13, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002683.htm">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>MIT IGEM Team. </i> (2006). MIT 2006. Retrieved on March 31, 2014, from; <a href="https://2006.igem.org/wiki/index.php/MIT_2006">https://2006.igem.org/wiki/index.php/MIT_2006</a>.</p><br />
<p align=left>● <i>Normas de Seguridad Laboratorio</i> Retrieved May 16, 2014, from: <a href="http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf">http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf</a>.</p><br />
<p align=left>● Pérez, E. (n.d.). <i>Boric acid poisoning</i>: Medline Plus Medical Encyclopedia. U.S National Library of Medicine. Retrieved May 12, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002485.html">http://www.nlm.nih.gov/medlineplus/ency/article/002485.html</a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). - <i>Worthington Enzyme Manual. </i> Retrieved May 12, 2014, from: <a href="http://www.worthington-biochem.com/RNASE/"></a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). <i>RCSB PDB-101. </i> Retrieved May 12, 2014, from: <a href="http://www.rcsb.org/pdb/101/motm.do?momID=105">http://www.rcsb.org/pdb/101/motm.do?momID=105</a>.</p><br />
<p align=left>● <i>"Silica Gel." </i> Centro De Información Toxicológica. CITUC. Red Salud UC Facultad De Medicina. Web. Retrieved May 30, 2014, from: <a href="http://www.cituc.cl/temas/ficha1.php?id=22">http://www.cituc.cl/temas/ficha1.php?id=22</a>.</p><br />
<p align=left>● <i>The known health effects of UV</i>. (n.d.). WHO. Retrieved May 13, 2014, from: <a href="http://www.who.int/uv/faq/uvhealtfac/en/">http://www.who.int/uv/faq/uvhealtfac/en/</a>.</p><br />
<p align=left>● <i>Type 1 Water, Milli-Q and Ultrapure Water System</i>. (n.d.). Retrieved May 12, 2014, from: <a href="http://www.millipore.com/lab_water/clw4/type1">http://www.millipore.com/lab_water/clw4/type1</a>.</p><br />
<p align=left>● UCL iGEM Team. (2012). <i>irrE module</i>. Retrieved March 31, 2014, from: <a href="https://2012.igem.org/Team:University_College_London/Module_5">https://2012.igem.org/Team:University_College_London/Module_5</a>.</p><br />
<p align=left>● Zubieta, Chole et al. (2003). <i>Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family. </i> Manuscript submitted for publication. Retrieved from <a href="www.plantcell.org; American Society of Plant Biologists">www.plantcell.org; American Society of Plant Biologists</a>.</p><br />
</font><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysis#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</li><br />
</ul><br />
<br></td><br />
</tr><br />
</table><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysisTeam:CIDEB-UANL Mexico/safety riskanalysis2014-06-18T19:58:38Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_safety}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Risk Analysis</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b>You can see and download the PDF version of this document, <a href="https://static.igem.org/mediawiki/2014hs/5/5f/SafetyRiskAnalysisCIDEB.pdf">Right Here!</a></b></p><br />
<br />
<br />
<p><b><h2>Overview</h2></b></p><br />
<br />
<p align="justify">IGEM CIDEB 2014 considers biosafety as important as every other points of the iGEM competition. Because of this reason, the team decided to perform a <a href="https://static.igem.org/mediawiki/2014hs/5/5f/SafetyRiskAnalysisCIDEB.pdf">Safety Risk Assessment</a> focused on the project and in the lab practices needed to accomplish it. <br />
In this assessment, a description of our host organism is made, along with the genetic modifications that were applied to it, including preventive measures to avoid its dissemination and appropriate identification and containment measures, in the case it was released into the environment. Also the overall potential risks of the project were included, taking in consideration all of the possible risks of working in our laboratory, along with preventive measures to reduce risk to a minimum.</p><br />
<br />
<br />
<p><b><h2>Organism's Description</h2></b></p><br />
<br />
<p><i>Escherichia coli (E. coli)</i> is a large and diverse genus of bacteria belonging to the <i>Enterobacteriaceae.</i> Although most strains of <i>E. coli</i> are relatively harmless, some can potentially affect humans and animals. Pathogenic kinds of <i>E. coli</i> can cause diarrhea, along with urinary tract infections, respiratory illness and pneumonia, among other symptoms. <i>E. coli</i> can be commonly found in the digestive tract of humans and many animals. It plays an important role in the decomposition and absorption of certain nutrients in the intestine that the body cannot break down by itself and to also prevent the digestive track to be colonized by other harmful bacteria.</p><br />
<p><i>E. coli</i> are capable of both aerobic and anaerobic cellular respiration, which is a characteristic that allows them to live in both oxygen rich and oxygen poor environments, which has allowed them to thrive in a wide variety of ecosystems.</p><br />
<br />
<img width=250 height=200 src="https://static.igem.org/mediawiki/2014hs/f/f3/EcoliCIDEB.jpg" align=left hspace=12><br />
<p>As a prokaryote, <i>E. coli</i> bacterium has no organelles, and its genetic information is not enclosed in a nucleus. <i>E. coli</i> protective layer consists on a cell wall and a capsule that protects it from the outside, potentially harmful environment. <i>E. coli</i> goes through binary fusion on a regular basis if given the right conditions, usually at 37° Celsius, and it is able to thrive and reproduce at a very fast rate.</p><br />
<br />
<p>As previously mentioned, <i>E. coli</i> is one of the most diverse genera of bacteria, probably due to its adaptive abilities. Although there is a wide variety of different <i>E. coli</i> strains to choose from, not all of them have the same characteristics; some of them are pathogenic and are not safe to work with, which is the main reason why during the practices at the team’s laboratory, the <i>E. coli</i>’s strain that was used is the K12 DH5-α strain, which is one of the safest strains to work with, and one of the most used in biotechnology research. The K12 DH5-α strain is characterized by its poor abilities to colonize plant and animal tissue, and a low resistance to outside-lab environment, temperature fluctuation and different media composition causing the organism to die.</p><br />
<br />
<p><i>E. coli</i>’s K12 DH5-α inability to colonize intestinal tissue was experimented in 1978 in a work made by R. Curtiss “Biological containment and cloning vector transmissibility” showing that the K12 DH5-α strain is not likely to behave as a pathogen in mammal tissue. Due to these previous mentioned characteristics, it is classified as a Class 1 Containment under the European Federation of Biotechnology guidelines, and according to the United States Environmental Control Agency (EPA) <i>E. coli</i> K12 DH5-α strain opposes a very low risk for other organisms and under contained conditions of fermentation and are safe to work with.</p><br />
<br />
<br><br />
<p><b><h2>Genetic Modifications</h2></b></p><br />
<p>In order to accomplish the iGEM CIDEB 2014 project’s objective, <i>E. coli</i> went through some genetic modifications. The E. CARU project is divided into four different modules, each one of them adding a different characteristic to the bacterium. The four modules are:</p><br />
<p> 1. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance</a></p><br />
<p> 2. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture</a></p><br />
<p> 3. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma</a></p><br />
<p> 4. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union</a></p><br />
<br />
<br><p><b>1. Resistance module</b><p><br />
<br />
<img width=260 height=210 src="https://static.igem.org/mediawiki/2014hs/0/0c/ExperimentalCIDEB.jpg" align=right hspace=12><br />
<p>Unmodified <i>E. coli</i> K-12 is able to tolerate added salt of up to 10% concentration (M. Don, 2008), however, E. CARU was tested with higher amounts than those mentioned (For further information, check the Capture module in this wiki).</p><br />
<br />
<p>In order to work with abnormal higher saline concentrations without killing the bacteria, IrrE, a gene that provides resistance to some adverse conditions for it, was introduced to <i>E. coli</i>.</p><br />
<br />
<p>The gene IrrE up regulates the production of several stress responsive proteins, protein kinases, metabolic proteins, and detoxification proteins. It also down-regulates glycerol degradation. With this global regulatory effect, <i>E. coli</i> becomes more salt tolerant (UCL, 2012).</p> <br />
<br />
<p>The module’s sequence is as follows:</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/f/ff/ResistanceCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>The sequence begins with a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), followed by an RBS (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), the gene IrrE (<a href="http://parts.igem.org/Part:BBa_K729001">BBa_K729001</a>) and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<br><p><b>2. Capture module</b><p><br />
<br />
<p>One of the most important genetic modifications in the project is the capture of sodium ions in order to desalinize water. This was made possible by taking advantage of NhaS, a putative gene which is characterized after its expression, “by its corresponding protein ability to bind and sequestering sodium ions.” (Ivey, Krulwich, 1994).</p><br />
<br />
<p>The project’s circuit sequence is:<p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/8/82/ProjectCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>Since NhaS is putative, iGEM CIDEB 2014 decided to test the module with a red fluorescence protein, which is simpler than the original reporter idea for the module, and this allowed us to test one gene at a time in each module.</p><br />
<br />
<p>The sequence used for the NhaS experimentation is:</p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/5/54/ExperimentCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>An UV Promoter (<a href="http://parts.igem.org/Part:BBa_I765001">BBa_I765001</a>) was chosen to begin the circuit in order to control the NhaS gene’s expression in E. CARU. The promoter is followed by (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), the NhaS gene (<a href="http://parts.igem.org/Part:BBa_K1255000">BBa_K1255000</a>), then the same RBS, an RFP reporter (<a href="http://parts.igem.org/Part:BBa_E1010">BBa_E1010</a>) and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<p>Basically the same, just changing the RFP reporter for BSMT1 Opt (<a href="http://parts.igem.org/Part:BBa_K1255001">BBa_K1255001</a>), which is the CDS that is able to produce a Wintergreen aroma. For further information look at the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma module</a> in this document.</p><br />
<br />
<br><p><b>3. Aroma module</b><p><br />
<br />
<p>The use of reporters differing from the usual fluorescence proteins is one of the objectives iGEM CIDEB 2014 team is pursuing by using aromatic reporters, like banana or, in this case, wintergreen odor.</p><br />
<br />
<p>The aroma module is used in order to prove the effectiveness of BSMT1 Opt CDS, for further use as an odor reporter for other teams and modules for this project. </p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/4/4c/AromaCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>BSMT1 (Salicylic Acid Carboxyl Methyltransferase I) is formed as part of a different circuit, composed by a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), a riboswitch (RNA thermometer, <a href="http://parts.igem.org/Part:BBa_K115017">BBa_K115017</a>), a CDS that, when it is induced by salicylic acid, it releases an enzymatic product (methyl salicylate), responsible of wintergreen odor (<a href="http://parts.igem.org/Part:BBa_K1255001">BBa_K1255001</a>), and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<img width=270 height=220 src="https://static.igem.org/mediawiki/2014hs/1/16/WgCIDEB.jpg" align=left hspace=12><br />
<p>This sequence will help to test its effectiveness and future usage as an odor reporter, since other teams (MIT 2006) have just analyzed it theoretically. IGEM CIDEB 2013 uses a riboswitch to induce the gene expression at high temperatures.</p><br />
<br />
<p>This piece (BSMT1 Opt) can replace RFP on capture module, or be added on union module; as wintergreen odor to demonstrate the presence of bacteria in silica beads or the capture of sodium ions on salty environments.</p><br />
<br />
<p>This module will be tested on a culture medium, and induced by salicylic acid to produce WG (WinterGreen) odor.</p><br />
<br />
<br><p><b>4. Union module</b><p><br />
<br />
<p>The main objective for iGEM CIDEB 2014 team is the construction of a biological circuit capable to capture sodium ions, and to remove them by using a silica-beads based bio-filter. In this module, the outer membrane of the bacteria is modified so it can bind silica or glass surfaces.</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/7/79/UnionCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<img width=130 height=210 src="https://static.igem.org/mediawiki/2014hs/8/88/BiofilterCIDEB.jpg" align=right hspace=12><br />
<br />
<p>This device is composed by a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), a common RBS (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), a fusion protein that of a set which includes the CDS L2 with its peptide signal and AIDA, in order to make the protein for binding silica; a membrane protein L2 (<a href="http://parts.igem.org/Part:BBa_K888000">BBa_K888000</a>); AIDA (<a href="http://parts.igem.org/Part:BBa_K888001">BBa_K888001</a>), and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<p>This module was available and proportionated by UANL iGEM 2013 team, however, iGEM CIDEB 2014 made some modifications to it, ligating the peptide signal and L2.</p><br />
<br />
<p>A silica bio-filter will be used to remove <i>E. coli</i> from the water, but, in order to have also qualitative evidence of <i>E. coli’s</i> attachment to silica beads, the aroma module’s function as reporter will indicate its presence in the silica.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Potential Risks</h2></b></p><br />
<br />
<p>The project uses <i>E. coli</i> K-12 as the host bacteria, causing it to be resistant to saline water, capture sodium ions, getting attached to silica surfaces and releasing the winter-green aroma as reporter.</p><br />
<br />
<p>Potential Risks with the bacteria are minimum because, as previously mentioned in the organism’s description, the strain used is a non-pathogenic type. <I>E. coli</i> K12 has no known survival mechanism in living tissues, nor any of the health affecting symptoms that some varieties have.</p><br />
<br />
<p><i>E. coli</i> is absolutely safe, as P Kunhert states: “They are [<i>E. coli</i> K 12] classified as biologically safe vehicles for the propagation of many efficient gene cloning and expression vectors in all major national and international guidelines on biological safety for work with recombinant DNA technology” (1995).</p><br />
<br />
<p>K-12 strain is defective in its cell wall components relevant to the ability to reorganize and adhere to the mucosal surface of colonic cells (Curtiss 1978). It does not have the type of glycocalyx required for attachment to the mucosal surface of the human colon.</p><br />
<br />
<p>Performing genetic modifications in the project was not dangerous because the materials were handled carefully, in accordance with the “Laboratory Category One” guidelines published by the World Health Organization (WHO).</p><br />
<br />
<p>The modified <i>E. coli</i> parts are safe for the environment and for human use. Variables are controlled by the team, as in the case of Capture module (NhaS) which is controlled by a UV promoter.</p><br />
<br />
<p>Similarly, the Aroma module is controlled by a Riboswitch regulated by temperature in order to decide when and how is going to be activated, besides adding salicylic acid, which is only harmful in high doses for humans, and in the project it is used in very small amounts (2mm) to activate it.</p><br />
<br />
<p>The resistance module is also safe, since it gives the bacteria the ability to resist adverse conditions that would normally kill it, like high temperatures, high saline levels and high UV radiation, and nevertheless the bacteria would die in a normal environment.</p><br />
<br />
<p>The Union module gives E. CARU the ability to bind glass and silica surfaces, which we will use in beads form with the presentation that is used commercially. No direct risks are related to the module itself, but Silica gel beads may contain toxic and potentially carcinogenic cobalt (II) chloride, which is added as a moisture indicator in commercially available product. This point is analyzed further in the “Union as a safety measurement” section.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Lab Methods</h2></b></p><br />
<br />
<p>IGEM CIDEB 2014 had to take in consideration some aspects about biosafety when working in the project. At all times an instructor was present as a supervisor during the practices.</p><br />
<p>The team followed what the WHO’s category 1 laboratory guidelines indicated. The use of lab coat, long jeans, closed shoes and, if needed, tied hair was performed at all times while working on the lab. When managing dangerous substances gloves and/or special glasses were used depending on the situation.</p><br />
<p>When working with the trans-illuminator, the team took care of not looking directly the UV rays, instead a plastic UV protective shield and glasses were used while working with UV.</p><br />
<p>The laboratory was kept perfectly clean and dry, especially the place in which the instruments were located nearby electrical outputs. Glassware were reviewed and checked for cracks, before each usage; especially before applying under vacuum or pressure on them.</p><br />
<p>The generated waste was always placed in a properly labeled waste container, placed handily to avoid spills.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Hazardous Substances</h2></b></p><br />
<p>While working in the E.CARU project, specifically in the laboratory, the team was exposed to different substances that, if managed incorrectly, could cause harmful effects.</p><br />
<p>The main substances used in the project were the following (click for further information):</p><br />
<p>● <a href="https://static.igem.org/mediawiki/2014hs/d/de/EthidiumBromideCIDEB.pdf">Ethidium bromide</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/9e/NaOHCIDEB.pdf">NaOH</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/4/44/AceticAcidCIDEB.pdf">Acetic acid</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f9/MethylSalicylateCIDEB.pdf">Methyl salicylate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/a/a6/UV1CIDEB.pdf">UV radiation</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/74/TRIS_HCLCIDEB.pdf">Tris HCl</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/72/EDTACIDEB.pdf">EDTA (Ethylenediamineetetraacetic acid)</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/e3/DSSCIDEB.pdf">DSS (Dodecyl-sodium sulfate)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7c/PotassiumAcetateCIDEB.pdf">Potassium acetate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/6b/AgaroseCIDEB.pdf">Agarose</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/d/df/CaCl2CIDEB.pdf">Calcium Chloride (CaCl)<br></a><br />
● <a href="https://static.igem.org/mediawiki/2014hs/0/06/EthanolCIDEB.pdf">Ethanol (Ethyl Alcohol)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7a/AgarCIDEB.pdf">&ldquo;Lysogenic Broth&rdquo; (LB) broth and agar</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/ee/BuffersCIDEB.pdf">Buffers</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/97/RNaseCIDEB.pdf">RNase</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f8/RestrictionCIDEB.pdf">Restriction enzymes</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/69/SalineCIDEB.pdf">Saline water</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/c/c0/MilliQCIDEB.pdf">Milli-Q water</a></p><br />
<br />
<br><br />
<br />
<p><b><h2>Union as a safety measurement</h2></b></p><br />
<p>The Union module in the project has a genetic device that gives the bacteria the ability to anchor itself to silica surfaces. The team used this ability to use the bacteria as a biological filter. This biological filter would clean the water free of <i>Escherichia coli</i> to meet a solution for salty water. </p><br />
<p>Why silica pearls? Because silica pearls are very common to find, and even though that they are known for being harmful for humans if ingested, it’s not the silica gel that is toxic, what is toxic are the substances that the silica pearl can absorb (silica gel is known for its characteristic of having a great ability for absorbing humidity). Silica is, for example, used as a safe food additive, this means no permit is needed when added.</p><br />
<p>If people are not comfortable with using silica gel pearls for the biological filter, glass pearls can also be used, as the genetic device permits anchorage to glass surfaces, and glass has the advantage of not releasing any kind of substance if introduced in water, even for long periods of time, for the bacterium to attach. Also, for more efficiency in the de-contamination, glass recipients could be used, that way it would be easier for the anchorage of the bacterium.</p><br />
<p>The functioning of the biological filter is very simple: due to the reason that after the first three modules of the project, salt water would still have the genetically modified bacteria, which will have sodium ions within its cellular membrane, a filtration process will be carried out by silica pearls, which will result in desalinized water without the before mentioned bacteria.</p><br />
<p>For the filtration process to happen, no modification was used besides the genetic information that gives <i>Escherichia coli</i> the ability to adhere to the silica gel or to glass surfaces. Thus, when bacteria have already captured the desired amount of sodium ions, by adding silica or glass beads, the bacteria will attach in these and this will help remove the GMO (Genetically Modified Organism) in the water by an easy filtration of the water to be free of silica or glass beads containing the bacteria.</p><br />
<p>The risks considered in the use of silica beads are minimal since "The silica gel is inert and considered a non-toxic product," according to CITUC (UC Toxicological Information Centre for its acronym in Spanish). Actually, if the pearls are not correctly removed, there is only one risk: choking hazard, which is prevented by the safety guidelines that are followed in the laboratory and warns that under no circumstance water should be ingested with or without the silica beads before being tested and approved.</p><br />
<p>The biological filter, besides being the main purpose of our project, is one of the team’s safety measurements, because it prevents the bacterium from contaminating and reproducing in water by being removed.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Contention Method</h2></b></p><br />
<p>When treating with GMOs there’s no such thing as “overprotection”. iGEM CIDEB 2014 takes safety seriously and decided that the project should include at least one method to shut off <i>E. coli</i> in case of an unexpected emergency situation, at least in a theoretical way.</p><br />
<p>The method proposed is simple, increasing the intensity of the UV light already used in the Project to turn off the organism.</p><br />
<p>First of all, Ultraviolet or UV light is light with wavelengths from 100 to 400 nm. According to Meulemans in 1986, its spectrum is divided into 4 different categories, as the following table shows:</p><br><br />
<br />
<style><br />
.data-table {<br />
border-collapse: collapse;<br />
}<br />
.border-top {<br />
border-top: 1px solid #000;<br />
}<br />
.border-bottom {<br />
border-bottom: 1px solid #000;<br />
}<br />
.border-left {<br />
border-left: 1px solid #000;<br />
}<br />
.border-right {<br />
border-right: 1px solid #000;<br />
}<br />
</style><br />
<img width=410 height=180 src="https://static.igem.org/mediawiki/2014hs/7/7e/Light-spectrumCIDEB.jpg" align=right hspace=12><br />
<table class="data-table" align="center"><br />
<tr><br />
<th class="border-top border-bottom border-left border-right">&nbsp;Type of UV&nbsp;</th><br />
<th class="border-top border-bottom border-right">&nbsp; Wavelenght&nbsp;</th><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;Vacuum UV&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;100 to 200nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-C&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;200 to 280nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-B&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;280 to 315nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-A&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;315 to 400nm&nbsp;</td><br />
</tr><br />
</table><br><br />
<br />
<p>EPA (United States Environmental Protection Agency) states that disinfection by UV primarily occurs due to the germicidal action of UV-B and UV-C light on microorganisms. And that the germicidal action of UV-A light is small relative to UV-B and UV-C light. So, in order for UV-A light to cause a “shut off” effect in the organism, very long exposure times are necessary.</p><br />
<p>What UV light does to microorganisms is that, once absorbed, it modifies and damages irreparably the DNA of the organism on the matters of question, in this case <i>E. coli</i> K12, by causing a photochemical damage. Therefore, RNA and DNA, molecules in charge of storing and carrying genetic information, can’t function properly, causing it to lose the ability to reproduce.</i><br />
<p>As Wolfe in 1990 states, and with the information from EPA, 254 nm is the most potent wavelength that can cause damage in DNA. 254 nm belongs to the UV-C light category and the team is planning to use it that way to deactivate E. CARU in extreme situations.</p><br />
<p>The UV light already used in the project is a promoter of the Capture module. This promoter is activated by 360nm, so it belongs in the UV-A category, and as it was mentioned before, this does not cause damage to the bacteria in short periods of time.</p><br />
<p>According to our project, UV is one of the easiest methods to shut off our GMO. </p><br />
<br />
<br />
<br><br />
<br />
<p><b><h2>Conclusions</h2></b></p><br />
<br />
<p>After doing an analysis of the possible risk related to our project and the safety measures that should be taken into consideration, it can be concluded that the project itself do not represents a considerable risk for human health, due to the poor resistance of the used strain of bacteria, even with the IrrE resistance module, the bacteria is still too weak to thrive in a non-controlled environment. Even though the bacteria cannot live outside the lab, all of the safety related issues to bio-contention of the organisms were all taken into consideration to avoid any possible contamination outside the laboratory. As previously mentioned, the bacteria does not oppose a significant threat for safety, but some substances used in the lab can be a major health concern if not managed properly. Because of this, the laboratory rules were made according to the WHO level 1 laboratory guidelines, and supervision was always present to avoid threats for the team. </p><br />
<br />
<br><br />
<p><b><h2>Bibliography/References</h2></b></p><br />
<br />
<font size="2"><p align=left>● ACETIC ACID (80%, 99.5%, Glacial). Hazard Communication Sheet. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf">http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf</a>.</p><br />
<p align=left>● Agaroses Manual. Condalab. Retrieved May 12, 2014, from: <a href="http://www.condalab.com/pdf/agarose_manual_09.pdf">http://www.condalab.com/pdf/agarose_manual_09.pdf</a>.</p><br />
<p align=left>● <i> “A toxic death for ethidium bromide”</i>. (n.d.). Laboratory News. Retrieved May 13, 2014, from: <a href="http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/">http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/</a>.</p><br />
<p align=left>● <i>Boric Acid. R.E.D. Facts. </i> Retrieved May 11, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf</a>.</p><br />
<p align=left>● Calcium Chloride - MSDS. (n.d.). <i>Calcium Chloride - MSDS</i>. Retrieved May 13, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● CHEMWATCH. <i>Sodium Dodecyl Sulfate</i>. Santa Cruz Biotechnology, Inc. Retrieved May 12, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● Curtiss, R, 1978, <i>Biological containment and cloning vector transmissibility, </i> J. Infectious Dis. 137:668-675.</p><br />
<p align=left>● Don Sarah (2008). <i>Optimal Conditions for the Growth of E Coli. </i>Retrieved May 11, 2014, from: <a href="http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli">http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli</a>.</p><br />
<p align=left>● EDETIC ACID (EDTA). <i>Summary Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f">http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f</a>.</p><br />
<p align=left>● <i>Environmental Health and Safety</i> (2007-09-10). "Silica Gel". Retrieved May 29, 2014, from: <a href="http://hazard.com/msds/mf/baker/baker/files/s1610.htm">http://hazard.com/msds/mf/baker/baker/files/s1610.htm</a>.</p><br />
<p align=left>● Environmental Protection Agency. <i>Sodium Hydroxide. R.E.ED. Facts</i>. Retrieved May 1, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf</a>.</p><br />
<p align=left>● Escherichia coli K-12 Derivatives <i>Final Risk Assessment. </i> EPA. Retrieved May 6, 2014, from: <a href="http://epa.gov/biotech_rule/pubs/fra/fra004.htm">http://epa.gov/biotech_rule/pubs/fra/fra004.htm</a>.</p><br />
<p align=left>● ETHANOL. <i>Hazard Communication Sheet</i>. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf">http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf</a>.</p><br />
<p align=left>● Ethylenediaminetetraacetic acid. <i>Summary of Initial Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf">http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf</a>.</p><br />
<p align=left>● Fotadar U, Zaveloff P, Terracio L (2005). <i>"Growth of Escherichia coli at elevated temperatures"</i>. J. Basic Microbiology. 45 (5): 403–4.doi:10.1002/jobm.200410542. PMID 16187264.</p><br />
<p align=left>● EPA (2006). <i>Ultraviolet disinfection guidance manual for the final long term 2 enhanced surface water treatment rule.</i> Retrieved May 29, 2014, from: <a href="http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf">http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf</a>.</p><br />
<p align=left>● EPA Guidance Manual (1999). <i>Alternative Disinfectants and Oxidants. </i> Chapter 8. Retrieved May 29, 2014. </p><br />
<p align=left>● <i>General Information Escherichia coli (E. coli) </i>. (2012, August 3). Centers for Disease Control and Prevention. Retrieved May 6, 2014, from: <a href="http://www.cdc.gov/ecoli/general/index.html">http://www.cdc.gov/ecoli/general/index.html</a>.</p><br />
<p align=left>● UANL Mexico (2012). <i>Recovery module. </i> Retrieved on March 28, from: <a href="https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery">https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery</a>.</p><br />
<p align=left>● Helmestine Anne Marie, 2014. <i>What happens if you eat silica gel beads? </i> Retrieved May 16, 2014, from: <a href="http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm">http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm</a>.</p><br />
<p align=left>● IGEM biosafety 2013. Retrieved May 16, 2014 from: <a href="http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf">http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf</a>.</p><br />
<p align=left>● IVEY Mark, KRULWICH Terry. (1994) <i>Sodium ion binding proteins. </i> Retrieved April 1, 2014 from: <a href="http://www.google.com.mx/patents/US5346815">http://www.google.com.mx/patents/US5346815</a>.</p><br />
<p align=left>● Jin Huh (2008). <i>Part BBa_k112808</i>. Retrieved May 16, 2014, from: <a href="https://2012.igem.org/Team:METU/KillSwitchOverview">https://2012.igem.org/Team:METU/KillSwitchOverview</a>.</p><br />
<p align=left>● Jones, T. F. (2007). <i>Investigation of Foodborne and Waterborne Disease Outbreaks. </i> In P. R. Murray, E. J. Baron, J. H. Jorgensen, M. L. Landry & M. A. Pfaller (Eds.), Manual of Clinical Microbiology (9th ed., pp. 152-169). Washignton, DC: ASM press. </p><br />
<p align=left>● Kunhert, P, J Nicolet, and J Frey. "Applied and Environmental Microbiology." <i>Rapid and accurate identification of Escherichia Coli k-12 strands. </i> Ed. P Kunhert. N.P., 31 Aug. 1995. Web. Retrieved May 13, 2014, from: <a href="http://aem.asm.org/content/61/11/4135.full.pdf">http://aem.asm.org/content/61/11/4135.full.pdf</a>.</p><br />
<p align=left>● McWilliams, M. <i>Luria Broth and Luria Agar Media and Their Uses Protocol</i>. American Society for Microbiology: Microbe Library. Retrieved May 12, 2014, from: <a href="http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Material Safety Data Sheet</i>. United Biochemicals. Retrieved May 12, 2014, from: <a href="http://www.unitedbiochemicals.com/msds/tris_hcl.pdf">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Methyl salicylate overdose</i> Medline plus Medical Encyclopedia. (n.d.). U.S National Library of Medicine. Retrieved May 13, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002683.htm">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>MIT IGEM Team. </i> (2006). MIT 2006. Retrieved on March 31, 2014, from; <a href="https://2006.igem.org/wiki/index.php/MIT_2006">https://2006.igem.org/wiki/index.php/MIT_2006</a>.</p><br />
<p align=left>● <i>Normas de Seguridad Laboratorio</i> Retrieved May 16, 2014, from: <a href="http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf">http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf</a>.</p><br />
<p align=left>● Pérez, E. (n.d.). <i>Boric acid poisoning</i>: Medline Plus Medical Encyclopedia. U.S National Library of Medicine. Retrieved May 12, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002485.html">http://www.nlm.nih.gov/medlineplus/ency/article/002485.html</a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). - <i>Worthington Enzyme Manual. </i> Retrieved May 12, 2014, from: <a href="http://www.worthington-biochem.com/RNASE/"></a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). <i>RCSB PDB-101. </i> Retrieved May 12, 2014, from: <a href="http://www.rcsb.org/pdb/101/motm.do?momID=105">http://www.rcsb.org/pdb/101/motm.do?momID=105</a>.</p><br />
<p align=left>● <i>"Silica Gel." </i> Centro De Información Toxicológica. CITUC. Red Salud UC Facultad De Medicina. Web. Retrieved May 30, 2014, from: <a href="http://www.cituc.cl/temas/ficha1.php?id=22">http://www.cituc.cl/temas/ficha1.php?id=22</a>.</p><br />
<p align=left>● <i>The known health effects of UV</i>. (n.d.). WHO. Retrieved May 13, 2014, from: <a href="http://www.who.int/uv/faq/uvhealtfac/en/">http://www.who.int/uv/faq/uvhealtfac/en/</a>.</p><br />
<p align=left>● <i>Type 1 Water, Milli-Q and Ultrapure Water System</i>. (n.d.). Retrieved May 12, 2014, from: <a href="http://www.millipore.com/lab_water/clw4/type1">http://www.millipore.com/lab_water/clw4/type1</a>.</p><br />
<p align=left>● UCL iGEM Team. (2012). <i>irrE module</i>. Retrieved March 31, 2014, from: <a href="https://2012.igem.org/Team:University_College_London/Module_5">https://2012.igem.org/Team:University_College_London/Module_5</a>.</p><br />
<p align=left>● Zubieta, Chole et al. (2003). <i>Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family. </i> Manuscript submitted for publication. Retrieved from <a href="www.plantcell.org; American Society of Plant Biologists">www.plantcell.org; American Society of Plant Biologists</a>.</p><br />
</font><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysis#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</li><br />
</ul><br />
<br></td><br />
</tr><br />
</table><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysisTeam:CIDEB-UANL Mexico/safety riskanalysis2014-06-18T19:53:02Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_safety}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Risk Analysis</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b>You can see and download the PDF version of this document, <a href="https://static.igem.org/mediawiki/2014hs/5/5f/SafetyRiskAnalysisCIDEB.pdf">Right Here!</a></b></p><br />
<br />
<br />
<p><b><h2>Overview</h2></b></p><br />
<br />
<p align="justify">IGEM CIDEB 2014 considers biosafety as important as every other points of the iGEM competition. Because of this reason, the team decided to perform a <a href="https://static.igem.org/mediawiki/2014hs/5/5f/SafetyRiskAnalysisCIDEB.pdf">Safety Risk Assessment</a> focused on the project and in the lab practices needed to accomplish it. <br />
In this assessment, a description of our host organism is made, along with the genetic modifications that were applied to it, including preventive measures to avoid its dissemination and appropriate identification and containment measures, in the case it was released into the environment. Also the overall potential risks of the project were included, taking in consideration all of the possible risks of working in our laboratory, along with preventive measures to reduce risk to a minimum.</p><br />
<br />
<br />
<p><b><h2>Organism's Description</h2></b></p><br />
<br />
<p><i>Escherichia coli (E. coli)</i> is a large and diverse genus of bacteria belonging to the <i>Enterobacteriaceae.</i> Although most strains of <i>E. coli</i> are relatively harmless, some can potentially affect humans and animals. Pathogenic kinds of <i>E. coli</i> can cause diarrhea, along with urinary tract infections, respiratory illness and pneumonia, among other symptoms. <i>E. coli</i> can be commonly found in the digestive tract of humans and many animals. It plays an important role in the decomposition and absorption of certain nutrients in the intestine that the body cannot break down by itself and to also prevent the digestive track to be colonized by other harmful bacteria.</p><br />
<p><i>E. coli</i> are capable of both aerobic and anaerobic cellular respiration, which is a characteristic that allows them to live in both oxygen rich and oxygen poor environments, which has allowed them to thrive in a wide variety of ecosystems.</p><br />
<br />
<img width=250 height=200 src="https://static.igem.org/mediawiki/2014hs/f/f3/EcoliCIDEB.jpg" align=left hspace=12><br />
<p>As a prokaryote, <i>E. coli</i> bacterium has no organelles, and its genetic information is not enclosed in a nucleus. <i>E. coli</i> protective layer consists on a cell wall and a capsule that protects it from the outside, potentially harmful environment. <i>E. coli</i> goes through binary fusion on a regular basis if given the right conditions, usually at 37° Celsius, and it is able to thrive and reproduce at a very fast rate.</p><br />
<br />
<p>As previously mentioned, <i>E. coli</i> is one of the most diverse genera of bacteria, probably due to its adaptive abilities. Although there is a wide variety of different <i>E. coli</i> strains to choose from, not all of them have the same characteristics; some of them are pathogenic and are not safe to work with, which is the main reason why during the practices at the team’s laboratory, the <i>E. coli</i>’s strain that was used is the K12 DH5-α strain, which is one of the safest strains to work with, and one of the most used in biotechnology research. The K12 DH5-α strain is characterized by its poor abilities to colonize plant and animal tissue, and a low resistance to outside-lab environment, temperature fluctuation and different media composition causing the organism to die.</p><br />
<br />
<p><i>E. coli</i>’s K12 DH5-α inability to colonize intestinal tissue was experimented in 1978 in a work made by R. Curtiss “Biological containment and cloning vector transmissibility” showing that the K12 DH5-α strain is not likely to behave as a pathogen in mammal tissue. Due to these previous mentioned characteristics, it is classified as a Class 1 Containment under the European Federation of Biotechnology guidelines, and according to the United States Environmental Control Agency (EPA) <i>E. coli</i> K12 DH5-α strain opposes a very low risk for other organisms and under contained conditions of fermentation and are safe to work with.</p><br />
<br />
<br><br />
<p><b><h2>Genetic Modifications</h2></b></p><br />
<p>In order to accomplish the iGEM CIDEB 2014 project’s objective, <i>E. coli</i> went through some genetic modifications. The E. CARU project is divided into four different modules, each one of them adding a different characteristic to the bacterium. The four modules are:</p><br />
<p> 1. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance</a></p><br />
<p> 2. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture</a></p><br />
<p> 3. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma</a></p><br />
<p> 4. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union</a></p><br />
<br />
<br><p><b>1. Resistance module</b><p><br />
<br />
<img width=260 height=210 src="https://static.igem.org/mediawiki/2014hs/0/0c/ExperimentalCIDEB.jpg" align=right hspace=12><br />
<p>Unmodified <i>E. coli</i> K-12 is able to tolerate added salt of up to 10% concentration (M. Don, 2008), however, E. CARU was tested with higher amounts than those mentioned (For further information, check the Capture module in this wiki).</p><br />
<br />
<p>In order to work with abnormal higher saline concentrations without killing the bacteria, IrrE, a gene that provides resistance to some adverse conditions for it, was introduced to <i>E. coli</i>.</p><br />
<br />
<p>The gene IrrE up regulates the production of several stress responsive proteins, protein kinases, metabolic proteins, and detoxification proteins. It also down-regulates glycerol degradation. With this global regulatory effect, <i>E. coli</i> becomes more salt tolerant (UCL, 2012).</p> <br />
<br />
<p>The module’s sequence is as follows:</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/f/ff/ResistanceCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>The sequence begins with a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), followed by an RBS (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), the gene IrrE (<a href="http://parts.igem.org/Part:BBa_K729001">BBa_K729001</a>) and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<br><p><b>2. Capture module</b><p><br />
<br />
<p>One of the most important genetic modifications in the project is the capture of sodium ions in order to desalinize water. This was made possible by taking advantage of NhaS, a putative gene which is characterized after its expression, “by its corresponding protein ability to bind and sequestering sodium ions.” (Ivey, Krulwich, 1994).</p><br />
<br />
<p>The project’s circuit sequence is:<p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/8/82/ProjectCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>Since NhaS is putative, iGEM CIDEB 2014 decided to test the module with a red fluorescence protein, which is simpler than the original reporter idea for the module, and this allowed us to test one gene at a time in each module.</p><br />
<br />
<p>The sequence used for the NhaS experimentation is:</p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/5/54/ExperimentCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>An UV Promoter (<a href="http://parts.igem.org/Part:BBa_I765001">BBa_I765001</a>) was chosen to begin the circuit in order to control the NhaS gene’s expression in E. CARU. The promoter is followed by (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), the NhaS gene (<a href="http://parts.igem.org/Part:BBa_K1255000">BBa_K1255000</a>), then the same RBS, an RFP reporter (<a href="http://parts.igem.org/Part:BBa_E1010">BBa_E1010</a>) and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<p>Basically the same, just changing the RFP reporter for BSMT1 Opt (<a href="http://parts.igem.org/Part:BBa_K1255001">BBa_K1255001</a>), which is the CDS that is able to produce a Wintergreen aroma. For further information look at the Aroma module in this document.</p><br />
<br />
<br><p><b>3. Aroma module</b><p><br />
<br />
<p>The use of reporters differing from the usual fluorescence proteins is one of the objectives iGEM CIDEB 2014 team is pursuing by using aromatic reporters, like banana or, in this case, wintergreen odor.</p><br />
<br />
<p>The aroma module is used in order to prove the effectiveness of BSMT1 Opt CDS, for further use as an odor reporter for other teams and modules for this project. </p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/4/4c/AromaCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>BSMT1 (Salicylic Acid Carboxyl Methyltransferase I) is formed as part of a different circuit, composed by a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), a riboswitch (RNA thermometer, <a href="http://parts.igem.org/Part:BBa_K115017">BBa_K115017</a>), a CDS that, when it is induced by salicylic acid, it releases an enzymatic product (methyl salicylate), responsible of wintergreen odor (<a href="http://parts.igem.org/Part:BBa_K1255001">BBa_K1255001</a>), and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<img width=270 height=220 src="https://static.igem.org/mediawiki/2014hs/1/16/WgCIDEB.jpg" align=left hspace=12><br />
<p>This sequence will help to test its effectiveness and future usage as an odor reporter, since other teams (MIT 2006) have just analyzed it theoretically. IGEM CIDEB 2013 uses a riboswitch to induce the gene expression at high temperatures.</p><br />
<br />
<p>This piece (BSMT1 Opt) can replace RFP on capture module, or be added on union module; as wintergreen odor to demonstrate the presence of bacteria in silica beads or the capture of sodium ions on salty environments.</p><br />
<br />
<p>This module will be tested on a culture medium, and induced by salicylic acid to produce WG (WinterGreen) odor.</p><br />
<br />
<br><p><b>4. Union module</b><p><br />
<br />
<p>The main objective for iGEM CIDEB 2014 team is the construction of a biological circuit capable to capture sodium ions, and to remove them by using a silica-beads based bio-filter. In this module, the outer membrane of the bacteria is modified so it can bind silica or glass surfaces.</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/7/79/UnionCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<img width=130 height=210 src="https://static.igem.org/mediawiki/2014hs/8/88/BiofilterCIDEB.jpg" align=right hspace=12><br />
<br />
<p>This device is composed by a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>), a common RBS (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a>), a fusion protein that of a set which includes the CDS L2 with its peptide signal and AIDA, in order to make the protein for binding silica; a membrane protein L2 (<a href="http://parts.igem.org/Part:BBa_K888000">BBa_K888000</a>); AIDA (<a href="http://parts.igem.org/Part:BBa_K888001">BBa_888001</a>), and a terminator (<a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a>).</p><br />
<br />
<p>This module was available and proportionated by UANL iGEM 2013 team, however, iGEM CIDEB 2014 made some modifications to it, ligating the peptide signal and L2.</p><br />
<br />
<p>A silica bio-filter will be used to remove <i>E. coli</i> from the water, but, in order to have also qualitative evidence of <i>E. coli’s</i> attachment to silica beads, the aroma module’s function as reporter will indicate its presence in the silica.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Potential Risks</h2></b></p><br />
<br />
<p>The project uses <i>E. coli</i> K-12 as the host bacteria, causing it to be resistant to saline water, capture sodium ions, getting attached to silica surfaces and releasing the winter-green aroma as reporter.</p><br />
<br />
<p>Potential Risks with the bacteria are minimum because, as previously mentioned in the organism’s description, the strain used is a non-pathogenic type. <I>E. coli</i> K12 has no known survival mechanism in living tissues, nor any of the health affecting symptoms that some varieties have.</p><br />
<br />
<p><i>E. coli</i> is absolutely safe, as P Kunhert states: “They are [<i>E. coli</i> K 12] classified as biologically safe vehicles for the propagation of many efficient gene cloning and expression vectors in all major national and international guidelines on biological safety for work with recombinant DNA technology” (1995).</p><br />
<br />
<p>K-12 strain is defective in its cell wall components relevant to the ability to reorganize and adhere to the mucosal surface of colonic cells (Curtiss 1978). It does not have the type of glycocalyx required for attachment to the mucosal surface of the human colon.</p><br />
<br />
<p>Performing genetic modifications in the project was not dangerous because the materials were handled carefully, in accordance with the “Laboratory Category One” guidelines published by the World Health Organization (WHO).</p><br />
<br />
<p>The modified <i>E. coli</i> parts are safe for the environment and for human use. Variables are controlled by the team, as in the case of Capture module (NhaS) which is controlled by a UV promoter.</p><br />
<br />
<p>Similarly, the Aroma module is controlled by a Riboswitch regulated by temperature in order to decide when and how is going to be activated, besides adding salicylic acid, which is only harmful in high doses for humans, and in the project it is used in very small amounts (2mm) to activate it.</p><br />
<br />
<p>The resistance module is also safe, since it gives the bacteria the ability to resist adverse conditions that would normally kill it, like high temperatures, high saline levels and high UV radiation, and nevertheless the bacteria would die in a normal environment.</p><br />
<br />
<p>The Union module gives E. CARU the ability to bind glass and silica surfaces, which we will use in beads form with the presentation that is used commercially. No direct risks are related to the module itself, but Silica gel beads may contain toxic and potentially carcinogenic cobalt (II) chloride, which is added as a moisture indicator in commercially available product. This point is analyzed further in the “Union as a safety measurement” section.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Lab Methods</h2></b></p><br />
<br />
<p>IGEM CIDEB 2014 had to take in consideration some aspects about biosafety when working in the project. At all times an instructor was present as a supervisor during the practices.</p><br />
<p>The team followed what the WHO’s category 1 laboratory guidelines indicated. The use of lab coat, long jeans, closed shoes and, if needed, tied hair was performed at all times while working on the lab. When managing dangerous substances gloves and/or special glasses were used depending on the situation.</p><br />
<p>When working with the trans-illuminator, the team took care of not looking directly the UV rays, instead a plastic UV protective shield and glasses were used while working with UV.</p><br />
<p>The laboratory was kept perfectly clean and dry, especially the place in which the instruments were located nearby electrical outputs. Glassware were reviewed and checked for cracks, before each usage; especially before applying under vacuum or pressure on them.</p><br />
<p>The generated waste was always placed in a properly labeled waste container, placed handily to avoid spills.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Hazardous Substances</h2></b></p><br />
<p>While working in the E.CARU project, specifically in the laboratory, the team was exposed to different substances that, if managed incorrectly, could cause harmful effects.</p><br />
<p>The main substances used in the project were the following (click for further information):</p><br />
<p>● <a href="https://static.igem.org/mediawiki/2014hs/d/de/EthidiumBromideCIDEB.pdf">Ethidium bromide</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/9e/NaOHCIDEB.pdf">NaOH</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/4/44/AceticAcidCIDEB.pdf">Acetic acid</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f9/MethylSalicylateCIDEB.pdf">Methyl salicylate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/a/a6/UV1CIDEB.pdf">UV radiation</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/74/TRIS_HCLCIDEB.pdf">Tris HCl</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/72/EDTACIDEB.pdf">EDTA (Ethylenediamineetetraacetic acid)</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/e3/DSSCIDEB.pdf">DSS (Dodecyl-sodium sulfate)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7c/PotassiumAcetateCIDEB.pdf">Potassium acetate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/6b/AgaroseCIDEB.pdf">Agarose</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/d/df/CaCl2CIDEB.pdf">Calcium Chloride (CaCl)<br></a><br />
● <a href="https://static.igem.org/mediawiki/2014hs/0/06/EthanolCIDEB.pdf">Ethanol (Ethyl Alcohol)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7a/AgarCIDEB.pdf">&ldquo;Lysogenic Broth&rdquo; (LB) broth and agar</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/ee/BuffersCIDEB.pdf">Buffers</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/97/RNaseCIDEB.pdf">RNase</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f8/RestrictionCIDEB.pdf">Restriction enzymes</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/69/SalineCIDEB.pdf">Saline water</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/c/c0/MilliQCIDEB.pdf">Milli-Q water</a></p><br />
<br />
<br><br />
<br />
<p><b><h2>Union as a safety measurement</h2></b></p><br />
<p>The Union module in the project has a genetic device that gives the bacteria the ability to anchor itself to silica surfaces. The team used this ability to use the bacteria as a biological filter. This biological filter would clean the water free of <i>Escherichia coli</i> to meet a solution for salty water. </p><br />
<p>Why silica pearls? Because silica pearls are very common to find, and even though that they are known for being harmful for humans if ingested, it’s not the silica gel that is toxic, what is toxic are the substances that the silica pearl can absorb (silica gel is known for its characteristic of having a great ability for absorbing humidity). Silica is, for example, used as a safe food additive, this means no permit is needed when added.</p><br />
<p>If people are not comfortable with using silica gel pearls for the biological filter, glass pearls can also be used, as the genetic device permits anchorage to glass surfaces, and glass has the advantage of not releasing any kind of substance if introduced in water, even for long periods of time, for the bacterium to attach. Also, for more efficiency in the de-contamination, glass recipients could be used, that way it would be easier for the anchorage of the bacterium.</p><br />
<p>The functioning of the biological filter is very simple: due to the reason that after the first three modules of the project, salt water would still have the genetically modified bacteria, which will have sodium ions within its cellular membrane, a filtration process will be carried out by silica pearls, which will result in desalinized water without the before mentioned bacteria.</p><br />
<p>For the filtration process to happen, no modification was used besides the genetic information that gives <i>Escherichia coli</i> the ability to adhere to the silica gel or to glass surfaces. Thus, when bacteria have already captured the desired amount of sodium ions, by adding silica or glass beads, the bacteria will attach in these and this will help remove the GMO (Genetically Modified Organism) in the water by an easy filtration of the water to be free of silica or glass beads containing the bacteria.</p><br />
<p>The risks considered in the use of silica beads are minimal since "The silica gel is inert and considered a non-toxic product," according to CITUC (UC Toxicological Information Centre for its acronym in Spanish). Actually, if the pearls are not correctly removed, there is only one risk: choking hazard, which is prevented by the safety guidelines that are followed in the laboratory and warns that under no circumstance water should be ingested with or without the silica beads before being tested and approved.</p><br />
<p>The biological filter, besides being the main purpose of our project, is one of the team’s safety measurements, because it prevents the bacterium from contaminating and reproducing in water by being removed.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Contention Method</h2></b></p><br />
<p>When treating with GMOs there’s no such thing as “overprotection”. iGEM CIDEB 2014 takes safety seriously and decided that the project should include at least one method to shut off <i>E. coli</i> in case of an unexpected emergency situation, at least in a theoretical way.</p><br />
<p>The method proposed is simple, increasing the intensity of the UV light already used in the Project to turn off the organism.</p><br />
<p>First of all, Ultraviolet or UV light is light with wavelengths from 100 to 400 nm. According to Meulemans in 1986, its spectrum is divided into 4 different categories, as the following table shows:</p><br><br />
<br />
<style><br />
.data-table {<br />
border-collapse: collapse;<br />
}<br />
.border-top {<br />
border-top: 1px solid #000;<br />
}<br />
.border-bottom {<br />
border-bottom: 1px solid #000;<br />
}<br />
.border-left {<br />
border-left: 1px solid #000;<br />
}<br />
.border-right {<br />
border-right: 1px solid #000;<br />
}<br />
</style><br />
<img width=410 height=180 src="https://static.igem.org/mediawiki/2014hs/7/7e/Light-spectrumCIDEB.jpg" align=right hspace=12><br />
<table class="data-table" align="center"><br />
<tr><br />
<th class="border-top border-bottom border-left border-right">&nbsp;Type of UV&nbsp;</th><br />
<th class="border-top border-bottom border-right">&nbsp; Wavelenght&nbsp;</th><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;Vacuum UV&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;100 to 200nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-C&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;200 to 280nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-B&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;280 to 315nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-A&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;315 to 400nm&nbsp;</td><br />
</tr><br />
</table><br><br />
<br />
<p>EPA (United States Environmental Protection Agency) states that disinfection by UV primarily occurs due to the germicidal action of UV-B and UV-C light on microorganisms. And that the germicidal action of UV-A light is small relative to UV-B and UV-C light. So, in order for UV-A light to cause a “shut off” effect in the organism, very long exposure times are necessary.</p><br />
<p>What UV light does to microorganisms is that, once absorbed, it modifies and damages irreparably the DNA of the organism on the matters of question, in this case <i>E. coli</i> K12, by causing a photochemical damage. Therefore, RNA and DNA, molecules in charge of storing and carrying genetic information, can’t function properly, causing it to lose the ability to reproduce.</i><br />
<p>As Wolfe in 1990 states, and with the information from EPA, 254 nm is the most potent wavelength that can cause damage in DNA. 254 nm belongs to the UV-C light category and the team is planning to use it that way to deactivate E. CARU in extreme situations.</p><br />
<p>The UV light already used in the project is a promoter of the Capture module. This promoter is activated by 360nm, so it belongs in the UV-A category, and as it was mentioned before, this does not cause damage to the bacteria in short periods of time.</p><br />
<p>According to our project, UV is one of the easiest methods to shut off our GMO. </p><br />
<br />
<br />
<br><br />
<br />
<p><b><h2>Conclusions</h2></b></p><br />
<br />
<p>After doing an analysis of the possible risk related to our project and the safety measures that should be taken into consideration, it can be concluded that the project itself do not represents a considerable risk for human health, due to the poor resistance of the used strain of bacteria, even with the IrrE resistance module, the bacteria is still too weak to thrive in a non-controlled environment. Even though the bacteria cannot live outside the lab, all of the safety related issues to bio-contention of the organisms were all taken into consideration to avoid any possible contamination outside the laboratory. As previously mentioned, the bacteria does not oppose a significant threat for safety, but some substances used in the lab can be a major health concern if not managed properly. Because of this, the laboratory rules were made according to the WHO level 1 laboratory guidelines, and supervision was always present to avoid threats for the team. </p><br />
<br />
<br><br />
<p><b><h2>Bibliography/References</h2></b></p><br />
<br />
<font size="2"><p align=left>● ACETIC ACID (80%, 99.5%, Glacial). Hazard Communication Sheet. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf">http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf</a>.</p><br />
<p align=left>● Agaroses Manual. Condalab. Retrieved May 12, 2014, from: <a href="http://www.condalab.com/pdf/agarose_manual_09.pdf">http://www.condalab.com/pdf/agarose_manual_09.pdf</a>.</p><br />
<p align=left>● <i> “A toxic death for ethidium bromide”</i>. (n.d.). Laboratory News. Retrieved May 13, 2014, from: <a href="http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/">http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/</a>.</p><br />
<p align=left>● <i>Boric Acid. R.E.D. Facts. </i> Retrieved May 11, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf</a>.</p><br />
<p align=left>● Calcium Chloride - MSDS. (n.d.). <i>Calcium Chloride - MSDS</i>. Retrieved May 13, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● CHEMWATCH. <i>Sodium Dodecyl Sulfate</i>. Santa Cruz Biotechnology, Inc. Retrieved May 12, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● Curtiss, R, 1978, <i>Biological containment and cloning vector transmissibility, </i> J. Infectious Dis. 137:668-675.</p><br />
<p align=left>● Don Sarah (2008). <i>Optimal Conditions for the Growth of E Coli. </i>Retrieved May 11, 2014, from: <a href="http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli">http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli</a>.</p><br />
<p align=left>● EDETIC ACID (EDTA). <i>Summary Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f">http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f</a>.</p><br />
<p align=left>● <i>Environmental Health and Safety</i> (2007-09-10). "Silica Gel". Retrieved May 29, 2014, from: <a href="http://hazard.com/msds/mf/baker/baker/files/s1610.htm">http://hazard.com/msds/mf/baker/baker/files/s1610.htm</a>.</p><br />
<p align=left>● Environmental Protection Agency. <i>Sodium Hydroxide. R.E.ED. Facts</i>. Retrieved May 1, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf</a>.</p><br />
<p align=left>● Escherichia coli K-12 Derivatives <i>Final Risk Assessment. </i> EPA. Retrieved May 6, 2014, from: <a href="http://epa.gov/biotech_rule/pubs/fra/fra004.htm">http://epa.gov/biotech_rule/pubs/fra/fra004.htm</a>.</p><br />
<p align=left>● ETHANOL. <i>Hazard Communication Sheet</i>. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf">http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf</a>.</p><br />
<p align=left>● Ethylenediaminetetraacetic acid. <i>Summary of Initial Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf">http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf</a>.</p><br />
<p align=left>● Fotadar U, Zaveloff P, Terracio L (2005). <i>"Growth of Escherichia coli at elevated temperatures"</i>. J. Basic Microbiology. 45 (5): 403–4.doi:10.1002/jobm.200410542. PMID 16187264.</p><br />
<p align=left>● EPA (2006). <i>Ultraviolet disinfection guidance manual for the final long term 2 enhanced surface water treatment rule.</i> Retrieved May 29, 2014, from: <a href="http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf">http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf</a>.</p><br />
<p align=left>● EPA Guidance Manual (1999). <i>Alternative Disinfectants and Oxidants. </i> Chapter 8. Retrieved May 29, 2014. </p><br />
<p align=left>● <i>General Information Escherichia coli (E. coli) </i>. (2012, August 3). Centers for Disease Control and Prevention. Retrieved May 6, 2014, from: <a href="http://www.cdc.gov/ecoli/general/index.html">http://www.cdc.gov/ecoli/general/index.html</a>.</p><br />
<p align=left>● UANL Mexico (2012). <i>Recovery module. </i> Retrieved on March 28, from: <a href="https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery">https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery</a>.</p><br />
<p align=left>● Helmestine Anne Marie, 2014. <i>What happens if you eat silica gel beads? </i> Retrieved May 16, 2014, from: <a href="http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm">http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm</a>.</p><br />
<p align=left>● IGEM biosafety 2013. Retrieved May 16, 2014 from: <a href="http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf">http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf</a>.</p><br />
<p align=left>● IVEY Mark, KRULWICH Terry. (1994) <i>Sodium ion binding proteins. </i> Retrieved April 1, 2014 from: <a href="http://www.google.com.mx/patents/US5346815">http://www.google.com.mx/patents/US5346815</a>.</p><br />
<p align=left>● Jin Huh (2008). <i>Part BBa_k112808</i>. Retrieved May 16, 2014, from: <a href="https://2012.igem.org/Team:METU/KillSwitchOverview">https://2012.igem.org/Team:METU/KillSwitchOverview</a>.</p><br />
<p align=left>● Jones, T. F. (2007). <i>Investigation of Foodborne and Waterborne Disease Outbreaks. </i> In P. R. Murray, E. J. Baron, J. H. Jorgensen, M. L. Landry & M. A. Pfaller (Eds.), Manual of Clinical Microbiology (9th ed., pp. 152-169). Washignton, DC: ASM press. </p><br />
<p align=left>● Kunhert, P, J Nicolet, and J Frey. "Applied and Environmental Microbiology." <i>Rapid and accurate identification of Escherichia Coli k-12 strands. </i> Ed. P Kunhert. N.P., 31 Aug. 1995. Web. Retrieved May 13, 2014, from: <a href="http://aem.asm.org/content/61/11/4135.full.pdf">http://aem.asm.org/content/61/11/4135.full.pdf</a>.</p><br />
<p align=left>● McWilliams, M. <i>Luria Broth and Luria Agar Media and Their Uses Protocol</i>. American Society for Microbiology: Microbe Library. Retrieved May 12, 2014, from: <a href="http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Material Safety Data Sheet</i>. United Biochemicals. Retrieved May 12, 2014, from: <a href="http://www.unitedbiochemicals.com/msds/tris_hcl.pdf">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Methyl salicylate overdose</i> Medline plus Medical Encyclopedia. (n.d.). U.S National Library of Medicine. Retrieved May 13, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002683.htm">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>MIT IGEM Team. </i> (2006). MIT 2006. Retrieved on March 31, 2014, from; <a href="https://2006.igem.org/wiki/index.php/MIT_2006">https://2006.igem.org/wiki/index.php/MIT_2006</a>.</p><br />
<p align=left>● <i>Normas de Seguridad Laboratorio</i> Retrieved May 16, 2014, from: <a href="http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf">http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf</a>.</p><br />
<p align=left>● Pérez, E. (n.d.). <i>Boric acid poisoning</i>: Medline Plus Medical Encyclopedia. U.S National Library of Medicine. Retrieved May 12, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002485.html">http://www.nlm.nih.gov/medlineplus/ency/article/002485.html</a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). - <i>Worthington Enzyme Manual. </i> Retrieved May 12, 2014, from: <a href="http://www.worthington-biochem.com/RNASE/"></a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). <i>RCSB PDB-101. </i> Retrieved May 12, 2014, from: <a href="http://www.rcsb.org/pdb/101/motm.do?momID=105">http://www.rcsb.org/pdb/101/motm.do?momID=105</a>.</p><br />
<p align=left>● <i>"Silica Gel." </i> Centro De Información Toxicológica. CITUC. Red Salud UC Facultad De Medicina. Web. Retrieved May 30, 2014, from: <a href="http://www.cituc.cl/temas/ficha1.php?id=22">http://www.cituc.cl/temas/ficha1.php?id=22</a>.</p><br />
<p align=left>● <i>The known health effects of UV</i>. (n.d.). WHO. Retrieved May 13, 2014, from: <a href="http://www.who.int/uv/faq/uvhealtfac/en/">http://www.who.int/uv/faq/uvhealtfac/en/</a>.</p><br />
<p align=left>● <i>Type 1 Water, Milli-Q and Ultrapure Water System</i>. (n.d.). Retrieved May 12, 2014, from: <a href="http://www.millipore.com/lab_water/clw4/type1">http://www.millipore.com/lab_water/clw4/type1</a>.</p><br />
<p align=left>● UCL iGEM Team. (2012). <i>irrE module</i>. Retrieved March 31, 2014, from: <a href="https://2012.igem.org/Team:University_College_London/Module_5">https://2012.igem.org/Team:University_College_London/Module_5</a>.</p><br />
<p align=left>● Zubieta, Chole et al. (2003). <i>Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family. </i> Manuscript submitted for publication. Retrieved from <a href="www.plantcell.org; American Society of Plant Biologists">www.plantcell.org; American Society of Plant Biologists</a>.</p><br />
</font><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysis#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</li><br />
</ul><br />
<br></td><br />
</tr><br />
</table><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysisTeam:CIDEB-UANL Mexico/safety riskanalysis2014-06-18T19:30:47Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_safety}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Risk Analysis</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b>You can see and download the PDF version of this document, <a href="https://static.igem.org/mediawiki/2014hs/5/5f/SafetyRiskAnalysisCIDEB.pdf">Right Here!</a></b></p><br />
<br />
<br />
<p><b><h2>Overview</h2></b></p><br />
<br />
<p align="justify">IGEM CIDEB 2014 considers biosafety as important as every other points of the iGEM competition. Because of this reason, the team decided to perform a <a href="https://static.igem.org/mediawiki/2014hs/5/5f/SafetyRiskAnalysisCIDEB.pdf">Safety Risk Assessment</a> focused on the project and in the lab practices needed to accomplish it. <br />
In this assessment, a description of our host organism is made, along with the genetic modifications that were applied to it, including preventive measures to avoid its dissemination and appropriate identification and containment measures, in the case it was released into the environment. Also the overall potential risks of the project were included, taking in consideration all of the possible risks of working in our laboratory, along with preventive measures to reduce risk to a minimum.</p><br />
<br />
<br />
<p><b><h2>Organism's Description</h2></b></p><br />
<br />
<p><i>Escherichia coli (E. coli)</i> is a large and diverse genus of bacteria belonging to the <i>Enterobacteriaceae.</i> Although most strains of <i>E. coli</i> are relatively harmless, some can potentially affect humans and animals. Pathogenic kinds of <i>E. coli</i> can cause diarrhea, along with urinary tract infections, respiratory illness and pneumonia, among other symptoms. <i>E. coli</i> can be commonly found in the digestive tract of humans and many animals. It plays an important role in the decomposition and absorption of certain nutrients in the intestine that the body cannot break down by itself and to also prevent the digestive track to be colonized by other harmful bacteria.</p><br />
<p><i>E. coli</i> are capable of both aerobic and anaerobic cellular respiration, which is a characteristic that allows them to live in both oxygen rich and oxygen poor environments, which has allowed them to thrive in a wide variety of ecosystems.</p><br />
<br />
<img width=250 height=200 src="https://static.igem.org/mediawiki/2014hs/f/f3/EcoliCIDEB.jpg" align=left hspace=12><br />
<p>As a prokaryote, <i>E. coli</i> bacterium has no organelles, and its genetic information is not enclosed in a nucleus. <i>E. coli</i> protective layer consists on a cell wall and a capsule that protects it from the outside, potentially harmful environment. <i>E. coli</i> goes through binary fusion on a regular basis if given the right conditions, usually at 37° Celsius, and it is able to thrive and reproduce at a very fast rate.</p><br />
<br />
<p>As previously mentioned, <i>E. coli</i> is one of the most diverse genera of bacteria, probably due to its adaptive abilities. Although there is a wide variety of different <i>E. coli</i> strains to choose from, not all of them have the same characteristics; some of them are pathogenic and are not safe to work with, which is the main reason why during the practices at the team’s laboratory, the <i>E. coli</i>’s strain that was used is the K12 DH5-α strain, which is one of the safest strains to work with, and one of the most used in biotechnology research. The K12 DH5-α strain is characterized by its poor abilities to colonize plant and animal tissue, and a low resistance to outside-lab environment, temperature fluctuation and different media composition causing the organism to die.</p><br />
<br />
<p><i>E. coli</i>’s K12 DH5-α inability to colonize intestinal tissue was experimented in 1978 in a work made by R. Curtiss “Biological containment and cloning vector transmissibility” showing that the K12 DH5-α strain is not likely to behave as a pathogen in mammal tissue. Due to these previous mentioned characteristics, it is classified as a Class 1 Containment under the European Federation of Biotechnology guidelines, and according to the United States Environmental Control Agency (EPA) <i>E. coli</i> K12 DH5-α strain opposes a very low risk for other organisms and under contained conditions of fermentation and are safe to work with.</p><br />
<br />
<br><br />
<p><b><h2>Genetic Modifications</h2></b></p><br />
<p>In order to accomplish the iGEM CIDEB 2014 project’s objective, <i>E. coli</i> went through some genetic modifications. The E. CARU project is divided into four different modules, each one of them adding a different characteristic to the bacterium. The four modules are:</p><br />
<p> 1. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance</a></p><br />
<p> 2. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture</a></p><br />
<p> 3. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma</a></p><br />
<p> 4. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union</a></p><br />
<br />
<br><p><b>1. Resistance module</b><p><br />
<br />
<img width=260 height=210 src="https://static.igem.org/mediawiki/2014hs/0/0c/ExperimentalCIDEB.jpg" align=right hspace=12><br />
<p>Unmodified <i>E. coli</i> K-12 is able to tolerate added salt of up to 10% concentration (M. Don, 2008), however, E. CARU was tested with higher amounts than those mentioned (For further information, check the Capture module in this wiki).</p><br />
<br />
<p>In order to work with abnormal higher saline concentrations without killing the bacteria, IrrE, a gene that provides resistance to some adverse conditions for it, was introduced to <i>E. coli</i>.</p><br />
<br />
<p>The gene IrrE up regulates the production of several stress responsive proteins, protein kinases, metabolic proteins, and detoxification proteins. It also down-regulates glycerol degradation. With this global regulatory effect, <i>E. coli</i> becomes more salt tolerant (UCL, 2012).</p> <br />
<br />
<p>The module’s sequence is as follows:</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/f/ff/ResistanceCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>The sequence begins with a constitutive promoter (BBa_J23119), followed by an RBS (BBa_B0034), the gene IrrE (BBa_K729001) and a terminator (BBa_B1002).</p><br />
<br />
<br><p><b>2. Capture module</b><p><br />
<br />
<p>One of the most important genetic modifications in the project is the capture of sodium ions in order to desalinize water. This was made possible by taking advantage of NhaS, a putative gene which is characterized after its expression, “by its corresponding protein ability to bind and sequestering sodium ions.” (Ivey, Krulwich, 1994).</p><br />
<br />
<p>The project’s circuit sequence is:<p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/8/82/ProjectCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>Since NhaS is putative, iGEM CIDEB 2014 decided to test the module with a red fluorescence protein (BBa_E1010), which is simpler than the original reporter idea for the module, and this allowed us to test one gene at a time in each module.</p><br />
<br />
<p>The sequence used for the NhaS experimentation is:</p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/5/54/ExperimentCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>An UV Promoter (BBa_I765001) was chosen to begin the circuit in order to control the NhaS gene’s expression in E. CARU. The promoter is followed by an RBS (BBa_B0034), the NhaS gene (BBa_K1255000), an RFP reporter (BBa_E1010) and a terminator (BBa_B1002).</p><br />
<br />
<p>Basically the same, just changing the RFP reporter for BSMT1 Opt (BBa_K1255001), which is the CDS that is able to produce a Wintergreen aroma. For further information look at the Aroma module in this document.</p><br />
<br />
<br><p><b>3. Aroma module</b><p><br />
<br />
<p>The use of reporters differing from the usual fluorescence proteins is one of the objectives iGEM CIDEB 2014 team is pursuing by using aromatic reporters, like banana or, in this case, wintergreen odor.</p><br />
<br />
<p>The aroma module is used in order to prove the effectiveness of BSMT1 Opt CDS (BBa_K1255001), for further use as an odor reporter for other teams and modules for this project. </p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/4/4c/AromaCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>BSMT1 (Salicylic Acid Carboxyl Methyltransferase I) is formed as part of a different circuit, composed by a constitutive promoter (BBa_J23119), a riboswitch (RNA thermometer, BBa_K115017), a CDS that, when it is induced by salicylic acid, it releases an enzymatic product (methyl salicylate), responsible of wintergreen odor, and a terminator (BBa_B1002).</p><br />
<br />
<img width=270 height=220 src="https://static.igem.org/mediawiki/2014hs/1/16/WgCIDEB.jpg" align=left hspace=12><br />
<p>This sequence will help to test its effectiveness and future usage as an odor reporter, since other teams (MIT 2006) have just analyzed it theoretically. IGEM CIDEB 2013 uses a riboswitch to induce the gene expression at high temperatures.</p><br />
<br />
<p>This piece (BSMT1 Opt) can replace RFP on capture module, or be added on union module; as wintergreen odor to demonstrate the presence of bacteria in silica beads or the capture of sodium ions on salty environments.</p><br />
<br />
<p>This module will be tested on a culture medium, and induced by salicylic acid to produce WG (WinterGreen) odor.</p><br />
<br />
<br><p><b>4. Union module</b><p><br />
<br />
<p>The main objective for iGEM CIDEB 2014 team is the construction of a biological circuit capable to capture sodium ions, and to remove them by using a silica-beads based bio-filter. In this module, the outer membrane of the bacteria is modified so it can bind silica or glass surfaces.</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/7/79/UnionCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<img width=130 height=210 src="https://static.igem.org/mediawiki/2014hs/8/88/BiofilterCIDEB.jpg" align=right hspace=12><br />
<br />
<p>This device is composed by a constitutive promoter (BBa_J23119), a common RBS (BBa_B0034), a fusion protein that of a set which includes the CDS L2 with its peptide signal and AIDA, in order to make the protein for binding silica; a membrane protein L2 (BBa_K888000); AIDA (BBa_888001), and a terminator (BBa_B1002).</p><br />
<br />
<p>This module was available and proportionated by UANL iGEM 2013 team, however, iGEM CIDEB 2014 made some modifications to it, ligating the peptide signal and L2.</p><br />
<br />
<p>A silica bio-filter will be used to remove <i>E. coli</i> from the water, but, in order to have also qualitative evidence of <i>E. coli’s</i> attachment to silica beads, the aroma module’s function as reporter will indicate its presence in the silica.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Potential Risks</h2></b></p><br />
<br />
<p>The project uses <i>E. coli</i> K-12 as the host bacteria, causing it to be resistant to saline water, capture sodium ions, getting attached to silica surfaces and releasing the winter-green aroma as reporter.</p><br />
<br />
<p>Potential Risks with the bacteria are minimum because, as previously mentioned in the organism’s description, the strain used is a non-pathogenic type. <I>E. coli</i> K12 has no known survival mechanism in living tissues, nor any of the health affecting symptoms that some varieties have.</p><br />
<br />
<p><i>E. coli</i> is absolutely safe, as P Kunhert states: “They are [<i>E. coli</i> K 12] classified as biologically safe vehicles for the propagation of many efficient gene cloning and expression vectors in all major national and international guidelines on biological safety for work with recombinant DNA technology” (1995).</p><br />
<br />
<p>K-12 strain is defective in its cell wall components relevant to the ability to reorganize and adhere to the mucosal surface of colonic cells (Curtiss 1978). It does not have the type of glycocalyx required for attachment to the mucosal surface of the human colon.</p><br />
<br />
<p>Performing genetic modifications in the project was not dangerous because the materials were handled carefully, in accordance with the “Laboratory Category One” guidelines published by the World Health Organization (WHO).</p><br />
<br />
<p>The modified <i>E. coli</i> parts are safe for the environment and for human use. Variables are controlled by the team, as in the case of Capture module (NhaS) which is controlled by a UV promoter.</p><br />
<br />
<p>Similarly, the Aroma module is controlled by a Riboswitch regulated by temperature in order to decide when and how is going to be activated, besides adding salicylic acid, which is only harmful in high doses for humans, and in the project it is used in very small amounts (2mm) to activate it.</p><br />
<br />
<p>The resistance module is also safe, since it gives the bacteria the ability to resist adverse conditions that would normally kill it, like high temperatures, high saline levels and high UV radiation, and nevertheless the bacteria would die in a normal environment.</p><br />
<br />
<p>The Union module gives E. CARU the ability to bind glass and silica surfaces, which we will use in beads form with the presentation that is used commercially. No direct risks are related to the module itself, but Silica gel beads may contain toxic and potentially carcinogenic cobalt (II) chloride, which is added as a moisture indicator in commercially available product. This point is analyzed further in the “Union as a safety measurement” section.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Lab Methods</h2></b></p><br />
<br />
<p>IGEM CIDEB 2014 had to take in consideration some aspects about biosafety when working in the project. At all times an instructor was present as a supervisor during the practices.</p><br />
<p>The team followed what the WHO’s category 1 laboratory guidelines indicated. The use of lab coat, long jeans, closed shoes and, if needed, tied hair was performed at all times while working on the lab. When managing dangerous substances gloves and/or special glasses were used depending on the situation.</p><br />
<p>When working with the trans-illuminator, the team took care of not looking directly the UV rays, instead a plastic UV protective shield and glasses were used while working with UV.</p><br />
<p>The laboratory was kept perfectly clean and dry, especially the place in which the instruments were located nearby electrical outputs. Glassware were reviewed and checked for cracks, before each usage; especially before applying under vacuum or pressure on them.</p><br />
<p>The generated waste was always placed in a properly labeled waste container, placed handily to avoid spills.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Hazardous Substances</h2></b></p><br />
<p>While working in the E.CARU project, specifically in the laboratory, the team was exposed to different substances that, if managed incorrectly, could cause harmful effects.</p><br />
<p>The main substances used in the project were the following (click for further information):</p><br />
<p>● <a href="https://static.igem.org/mediawiki/2014hs/d/de/EthidiumBromideCIDEB.pdf">Ethidium bromide</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/9e/NaOHCIDEB.pdf">NaOH</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/4/44/AceticAcidCIDEB.pdf">Acetic acid</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f9/MethylSalicylateCIDEB.pdf">Methyl salicylate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/a/a6/UV1CIDEB.pdf">UV radiation</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/74/TRIS_HCLCIDEB.pdf">Tris HCl</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/72/EDTACIDEB.pdf">EDTA (Ethylenediamineetetraacetic acid)</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/e3/DSSCIDEB.pdf">DSS (Dodecyl-sodium sulfate)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7c/PotassiumAcetateCIDEB.pdf">Potassium acetate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/6b/AgaroseCIDEB.pdf">Agarose</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/d/df/CaCl2CIDEB.pdf">Calcium Chloride (CaCl)<br></a><br />
● <a href="https://static.igem.org/mediawiki/2014hs/0/06/EthanolCIDEB.pdf">Ethanol (Ethyl Alcohol)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7a/AgarCIDEB.pdf">&ldquo;Lysogenic Broth&rdquo; (LB) broth and agar</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/ee/BuffersCIDEB.pdf">Buffers</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/97/RNaseCIDEB.pdf">RNase</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f8/RestrictionCIDEB.pdf">Restriction enzymes</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/69/SalineCIDEB.pdf">Saline water</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/c/c0/MilliQCIDEB.pdf">Milli-Q water</a></p><br />
<br />
<br><br />
<br />
<p><b><h2>Union as a safety measurement</h2></b></p><br />
<p>The Union module in the project has a genetic device that gives the bacteria the ability to anchor itself to silica surfaces. The team used this ability to use the bacteria as a biological filter. This biological filter would clean the water free of <i>Escherichia coli</i> to meet a solution for salty water. </p><br />
<p>Why silica pearls? Because silica pearls are very common to find, and even though that they are known for being harmful for humans if ingested, it’s not the silica gel that is toxic, what is toxic are the substances that the silica pearl can absorb (silica gel is known for its characteristic of having a great ability for absorbing humidity). Silica is, for example, used as a safe food additive, this means no permit is needed when added.</p><br />
<p>If people are not comfortable with using silica gel pearls for the biological filter, glass pearls can also be used, as the genetic device permits anchorage to glass surfaces, and glass has the advantage of not releasing any kind of substance if introduced in water, even for long periods of time, for the bacterium to attach. Also, for more efficiency in the de-contamination, glass recipients could be used, that way it would be easier for the anchorage of the bacterium.</p><br />
<p>The functioning of the biological filter is very simple: due to the reason that after the first three modules of the project, salt water would still have the genetically modified bacteria, which will have sodium ions within its cellular membrane, a filtration process will be carried out by silica pearls, which will result in desalinized water without the before mentioned bacteria.</p><br />
<p>For the filtration process to happen, no modification was used besides the genetic information that gives <i>Escherichia coli</i> the ability to adhere to the silica gel or to glass surfaces. Thus, when bacteria have already captured the desired amount of sodium ions, by adding silica or glass beads, the bacteria will attach in these and this will help remove the GMO (Genetically Modified Organism) in the water by an easy filtration of the water to be free of silica or glass beads containing the bacteria.</p><br />
<p>The risks considered in the use of silica beads are minimal since "The silica gel is inert and considered a non-toxic product," according to CITUC (UC Toxicological Information Centre for its acronym in Spanish). Actually, if the pearls are not correctly removed, there is only one risk: choking hazard, which is prevented by the safety guidelines that are followed in the laboratory and warns that under no circumstance water should be ingested with or without the silica beads before being tested and approved.</p><br />
<p>The biological filter, besides being the main purpose of our project, is one of the team’s safety measurements, because it prevents the bacterium from contaminating and reproducing in water by being removed.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Contention Method</h2></b></p><br />
<p>When treating with GMOs there’s no such thing as “overprotection”. iGEM CIDEB 2014 takes safety seriously and decided that the project should include at least one method to shut off <i>E. coli</i> in case of an unexpected emergency situation, at least in a theoretical way.</p><br />
<p>The method proposed is simple, increasing the intensity of the UV light already used in the Project to turn off the organism.</p><br />
<p>First of all, Ultraviolet or UV light is light with wavelengths from 100 to 400 nm. According to Meulemans in 1986, its spectrum is divided into 4 different categories, as the following table shows:</p><br><br />
<br />
<style><br />
.data-table {<br />
border-collapse: collapse;<br />
}<br />
.border-top {<br />
border-top: 1px solid #000;<br />
}<br />
.border-bottom {<br />
border-bottom: 1px solid #000;<br />
}<br />
.border-left {<br />
border-left: 1px solid #000;<br />
}<br />
.border-right {<br />
border-right: 1px solid #000;<br />
}<br />
</style><br />
<img width=410 height=180 src="https://static.igem.org/mediawiki/2014hs/7/7e/Light-spectrumCIDEB.jpg" align=right hspace=12><br />
<table class="data-table" align="center"><br />
<tr><br />
<th class="border-top border-bottom border-left border-right">&nbsp;Type of UV&nbsp;</th><br />
<th class="border-top border-bottom border-right">&nbsp; Wavelenght&nbsp;</th><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;Vacuum UV&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;100 to 200nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-C&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;200 to 280nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-B&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;280 to 315nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-A&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;315 to 400nm&nbsp;</td><br />
</tr><br />
</table><br><br />
<br />
<p>EPA (United States Environmental Protection Agency) states that disinfection by UV primarily occurs due to the germicidal action of UV-B and UV-C light on microorganisms. And that the germicidal action of UV-A light is small relative to UV-B and UV-C light. So, in order for UV-A light to cause a “shut off” effect in the organism, very long exposure times are necessary.</p><br />
<p>What UV light does to microorganisms is that, once absorbed, it modifies and damages irreparably the DNA of the organism on the matters of question, in this case <i>E. coli</i> K12, by causing a photochemical damage. Therefore, RNA and DNA, molecules in charge of storing and carrying genetic information, can’t function properly, causing it to lose the ability to reproduce.</i><br />
<p>As Wolfe in 1990 states, and with the information from EPA, 254 nm is the most potent wavelength that can cause damage in DNA. 254 nm belongs to the UV-C light category and the team is planning to use it that way to deactivate E. CARU in extreme situations.</p><br />
<p>The UV light already used in the project is a promoter of the Capture module. This promoter is activated by 360nm, so it belongs in the UV-A category, and as it was mentioned before, this does not cause damage to the bacteria in short periods of time.</p><br />
<p>According to our project, UV is one of the easiest methods to shut off our GMO. </p><br />
<br />
<br />
<br><br />
<br />
<p><b><h2>Conclusions</h2></b></p><br />
<br />
<p>After doing an analysis of the possible risk related to our project and the safety measures that should be taken into consideration, it can be concluded that the project itself do not represents a considerable risk for human health, due to the poor resistance of the used strain of bacteria, even with the IrrE resistance module, the bacteria is still too weak to thrive in a non-controlled environment. Even though the bacteria cannot live outside the lab, all of the safety related issues to bio-contention of the organisms were all taken into consideration to avoid any possible contamination outside the laboratory. As previously mentioned, the bacteria does not oppose a significant threat for safety, but some substances used in the lab can be a major health concern if not managed properly. Because of this, the laboratory rules were made according to the WHO level 1 laboratory guidelines, and supervision was always present to avoid threats for the team. </p><br />
<br />
<br><br />
<p><b><h2>Bibliography/References</h2></b></p><br />
<br />
<font size="2"><p align=left>● ACETIC ACID (80%, 99.5%, Glacial). Hazard Communication Sheet. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf">http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf</a>.</p><br />
<p align=left>● Agaroses Manual. Condalab. Retrieved May 12, 2014, from: <a href="http://www.condalab.com/pdf/agarose_manual_09.pdf">http://www.condalab.com/pdf/agarose_manual_09.pdf</a>.</p><br />
<p align=left>● <i> “A toxic death for ethidium bromide”</i>. (n.d.). Laboratory News. Retrieved May 13, 2014, from: <a href="http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/">http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/</a>.</p><br />
<p align=left>● <i>Boric Acid. R.E.D. Facts. </i> Retrieved May 11, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf</a>.</p><br />
<p align=left>● Calcium Chloride - MSDS. (n.d.). <i>Calcium Chloride - MSDS</i>. Retrieved May 13, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● CHEMWATCH. <i>Sodium Dodecyl Sulfate</i>. Santa Cruz Biotechnology, Inc. Retrieved May 12, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● Curtiss, R, 1978, <i>Biological containment and cloning vector transmissibility, </i> J. Infectious Dis. 137:668-675.</p><br />
<p align=left>● Don Sarah (2008). <i>Optimal Conditions for the Growth of E Coli. </i>Retrieved May 11, 2014, from: <a href="http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli">http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli</a>.</p><br />
<p align=left>● EDETIC ACID (EDTA). <i>Summary Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f">http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f</a>.</p><br />
<p align=left>● <i>Environmental Health and Safety</i> (2007-09-10). "Silica Gel". Retrieved May 29, 2014, from: <a href="http://hazard.com/msds/mf/baker/baker/files/s1610.htm">http://hazard.com/msds/mf/baker/baker/files/s1610.htm</a>.</p><br />
<p align=left>● Environmental Protection Agency. <i>Sodium Hydroxide. R.E.ED. Facts</i>. Retrieved May 1, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf</a>.</p><br />
<p align=left>● Escherichia coli K-12 Derivatives <i>Final Risk Assessment. </i> EPA. Retrieved May 6, 2014, from: <a href="http://epa.gov/biotech_rule/pubs/fra/fra004.htm">http://epa.gov/biotech_rule/pubs/fra/fra004.htm</a>.</p><br />
<p align=left>● ETHANOL. <i>Hazard Communication Sheet</i>. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf">http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf</a>.</p><br />
<p align=left>● Ethylenediaminetetraacetic acid. <i>Summary of Initial Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf">http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf</a>.</p><br />
<p align=left>● Fotadar U, Zaveloff P, Terracio L (2005). <i>"Growth of Escherichia coli at elevated temperatures"</i>. J. Basic Microbiology. 45 (5): 403–4.doi:10.1002/jobm.200410542. PMID 16187264.</p><br />
<p align=left>● EPA (2006). <i>Ultraviolet disinfection guidance manual for the final long term 2 enhanced surface water treatment rule.</i> Retrieved May 29, 2014, from: <a href="http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf">http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf</a>.</p><br />
<p align=left>● EPA Guidance Manual (1999). <i>Alternative Disinfectants and Oxidants. </i> Chapter 8. Retrieved May 29, 2014. </p><br />
<p align=left>● <i>General Information Escherichia coli (E. coli) </i>. (2012, August 3). Centers for Disease Control and Prevention. Retrieved May 6, 2014, from: <a href="http://www.cdc.gov/ecoli/general/index.html">http://www.cdc.gov/ecoli/general/index.html</a>.</p><br />
<p align=left>● UANL Mexico (2012). <i>Recovery module. </i> Retrieved on March 28, from: <a href="https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery">https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery</a>.</p><br />
<p align=left>● Helmestine Anne Marie, 2014. <i>What happens if you eat silica gel beads? </i> Retrieved May 16, 2014, from: <a href="http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm">http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm</a>.</p><br />
<p align=left>● IGEM biosafety 2013. Retrieved May 16, 2014 from: <a href="http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf">http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf</a>.</p><br />
<p align=left>● IVEY Mark, KRULWICH Terry. (1994) <i>Sodium ion binding proteins. </i> Retrieved April 1, 2014 from: <a href="http://www.google.com.mx/patents/US5346815">http://www.google.com.mx/patents/US5346815</a>.</p><br />
<p align=left>● Jin Huh (2008). <i>Part BBa_k112808</i>. Retrieved May 16, 2014, from: <a href="https://2012.igem.org/Team:METU/KillSwitchOverview">https://2012.igem.org/Team:METU/KillSwitchOverview</a>.</p><br />
<p align=left>● Jones, T. F. (2007). <i>Investigation of Foodborne and Waterborne Disease Outbreaks. </i> In P. R. Murray, E. J. Baron, J. H. Jorgensen, M. L. Landry & M. A. Pfaller (Eds.), Manual of Clinical Microbiology (9th ed., pp. 152-169). Washignton, DC: ASM press. </p><br />
<p align=left>● Kunhert, P, J Nicolet, and J Frey. "Applied and Environmental Microbiology." <i>Rapid and accurate identification of Escherichia Coli k-12 strands. </i> Ed. P Kunhert. N.P., 31 Aug. 1995. Web. Retrieved May 13, 2014, from: <a href="http://aem.asm.org/content/61/11/4135.full.pdf">http://aem.asm.org/content/61/11/4135.full.pdf</a>.</p><br />
<p align=left>● McWilliams, M. <i>Luria Broth and Luria Agar Media and Their Uses Protocol</i>. American Society for Microbiology: Microbe Library. Retrieved May 12, 2014, from: <a href="http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Material Safety Data Sheet</i>. United Biochemicals. Retrieved May 12, 2014, from: <a href="http://www.unitedbiochemicals.com/msds/tris_hcl.pdf">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Methyl salicylate overdose</i> Medline plus Medical Encyclopedia. (n.d.). U.S National Library of Medicine. Retrieved May 13, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002683.htm">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>MIT IGEM Team. </i> (2006). MIT 2006. Retrieved on March 31, 2014, from; <a href="https://2006.igem.org/wiki/index.php/MIT_2006">https://2006.igem.org/wiki/index.php/MIT_2006</a>.</p><br />
<p align=left>● <i>Normas de Seguridad Laboratorio</i> Retrieved May 16, 2014, from: <a href="http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf">http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf</a>.</p><br />
<p align=left>● Pérez, E. (n.d.). <i>Boric acid poisoning</i>: Medline Plus Medical Encyclopedia. U.S National Library of Medicine. Retrieved May 12, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002485.html">http://www.nlm.nih.gov/medlineplus/ency/article/002485.html</a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). - <i>Worthington Enzyme Manual. </i> Retrieved May 12, 2014, from: <a href="http://www.worthington-biochem.com/RNASE/"></a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). <i>RCSB PDB-101. </i> Retrieved May 12, 2014, from: <a href="http://www.rcsb.org/pdb/101/motm.do?momID=105">http://www.rcsb.org/pdb/101/motm.do?momID=105</a>.</p><br />
<p align=left>● <i>"Silica Gel." </i> Centro De Información Toxicológica. CITUC. Red Salud UC Facultad De Medicina. Web. Retrieved May 30, 2014, from: <a href="http://www.cituc.cl/temas/ficha1.php?id=22">http://www.cituc.cl/temas/ficha1.php?id=22</a>.</p><br />
<p align=left>● <i>The known health effects of UV</i>. (n.d.). WHO. Retrieved May 13, 2014, from: <a href="http://www.who.int/uv/faq/uvhealtfac/en/">http://www.who.int/uv/faq/uvhealtfac/en/</a>.</p><br />
<p align=left>● <i>Type 1 Water, Milli-Q and Ultrapure Water System</i>. (n.d.). Retrieved May 12, 2014, from: <a href="http://www.millipore.com/lab_water/clw4/type1">http://www.millipore.com/lab_water/clw4/type1</a>.</p><br />
<p align=left>● UCL iGEM Team. (2012). <i>irrE module</i>. Retrieved March 31, 2014, from: <a href="https://2012.igem.org/Team:University_College_London/Module_5">https://2012.igem.org/Team:University_College_London/Module_5</a>.</p><br />
<p align=left>● Zubieta, Chole et al. (2003). <i>Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family. </i> Manuscript submitted for publication. Retrieved from <a href="www.plantcell.org; American Society of Plant Biologists">www.plantcell.org; American Society of Plant Biologists</a>.</p><br />
</font><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysis#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</li><br />
</ul><br />
<br></td><br />
</tr><br />
</table><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysisTeam:CIDEB-UANL Mexico/safety riskanalysis2014-06-18T19:26:32Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_safety}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Risk Analysis</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b>You can see and download the PDF version of this document, <a href="https://static.igem.org/mediawiki/2014hs/5/5f/SafetyRiskAnalysisCIDEB.pdf">Right Here!</a></b></p><br />
<br />
<br />
<p><b><h2>Overview</h2></b></p><br />
<br />
<p align="justify">IGEM CIDEB 2014 considers biosafety as important as every other points of the iGEM competition. Because of this reason, the team decided to perform a Safety Risk Assessment focused on the project and in the lab practices needed to accomplish it. <br />
In this assessment, a description of our host organism is made, along with the genetic modifications that were applied to it, including preventive measures to avoid its dissemination and appropriate identification and containment measures, in the case it was released into the environment. Also the overall potential risks of the project were included, taking in consideration all of the possible risks of working in our laboratory, along with preventive measures to reduce risk to a minimum.</p><br />
<br />
<br />
<p><b><h2>Organism's Description</h2></b></p><br />
<br />
<p><i>Escherichia coli (E. coli)</i> is a large and diverse genus of bacteria belonging to the <i>Enterobacteriaceae.</i> Although most strains of <i>E. coli</i> are relatively harmless, some can potentially affect humans and animals. Pathogenic kinds of <i>E. coli</i> can cause diarrhea, along with urinary tract infections, respiratory illness and pneumonia, among other symptoms. <i>E. coli</i> can be commonly found in the digestive tract of humans and many animals. It plays an important role in the decomposition and absorption of certain nutrients in the intestine that the body cannot break down by itself and to also prevent the digestive track to be colonized by other harmful bacteria.</p><br />
<p><i>E. coli</i> are capable of both aerobic and anaerobic cellular respiration, which is a characteristic that allows them to live in both oxygen rich and oxygen poor environments, which has allowed them to thrive in a wide variety of ecosystems.</p><br />
<br />
<img width=250 height=200 src="https://static.igem.org/mediawiki/2014hs/f/f3/EcoliCIDEB.jpg" align=left hspace=12><br />
<p>As a prokaryote, <i>E. coli</i> bacterium has no organelles, and its genetic information is not enclosed in a nucleus. <i>E. coli</i> protective layer consists on a cell wall and a capsule that protects it from the outside, potentially harmful environment. <i>E. coli</i> goes through binary fusion on a regular basis if given the right conditions, usually at 37° Celsius, and it is able to thrive and reproduce at a very fast rate.</p><br />
<br />
<p>As previously mentioned, <i>E. coli</i> is one of the most diverse genera of bacteria, probably due to its adaptive abilities. Although there is a wide variety of different <i>E. coli</i> strains to choose from, not all of them have the same characteristics; some of them are pathogenic and are not safe to work with, which is the main reason why during the practices at the team’s laboratory, the <i>E. coli</i>’s strain that was used is the K12 DH5-α strain, which is one of the safest strains to work with, and one of the most used in biotechnology research. The K12 DH5-α strain is characterized by its poor abilities to colonize plant and animal tissue, and a low resistance to outside-lab environment, temperature fluctuation and different media composition causing the organism to die.</p><br />
<br />
<p><i>E. coli</i>’s K12 DH5-α inability to colonize intestinal tissue was experimented in 1978 in a work made by R. Curtiss “Biological containment and cloning vector transmissibility” showing that the K12 DH5-α strain is not likely to behave as a pathogen in mammal tissue. Due to these previous mentioned characteristics, it is classified as a Class 1 Containment under the European Federation of Biotechnology guidelines, and according to the United States Environmental Control Agency (EPA) <i>E. coli</i> K12 DH5-α strain opposes a very low risk for other organisms and under contained conditions of fermentation and are safe to work with.</p><br />
<br />
<br><br />
<p><b><h2>Genetic Modifications</h2></b></p><br />
<p>In order to accomplish the iGEM CIDEB 2014 project’s objective, <i>E. coli</i> went through some genetic modifications. The E. CARU project is divided into four different modules, each one of them adding a different characteristic to the bacterium. The four modules are:</p><br />
<p> 1. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance</a></p><br />
<p> 2. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture</a></p><br />
<p> 3. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma</a></p><br />
<p> 4. <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union</a></p><br />
<br />
<br><p><b>1. Resistance module</b><p><br />
<br />
<img width=260 height=210 src="https://static.igem.org/mediawiki/2014hs/0/0c/ExperimentalCIDEB.jpg" align=right hspace=12><br />
<p>Unmodified <i>E. coli</i> K-12 is able to tolerate added salt of up to 10% concentration (M. Don, 2008), however, E. CARU was tested with higher amounts than those mentioned (For further information, check the Capture module in this wiki).</p><br />
<br />
<p>In order to work with abnormal higher saline concentrations without killing the bacteria, IrrE, a gene that provides resistance to some adverse conditions for it, was introduced to <i>E. coli</i>.</p><br />
<br />
<p>The gene IrrE up regulates the production of several stress responsive proteins, protein kinases, metabolic proteins, and detoxification proteins. It also down-regulates glycerol degradation. With this global regulatory effect, <i>E. coli</i> becomes more salt tolerant (UCL, 2012).</p> <br />
<br />
<p>The module’s sequence is as follows:</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/f/ff/ResistanceCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>The sequence begins with a constitutive promoter (BBa_J23119), followed by an RBS (BBa_B0034), the gene IrrE (BBa_K729001) and a terminator (BBa_B1002).</p><br />
<br />
<br><p><b>2. Capture module</b><p><br />
<br />
<p>One of the most important genetic modifications in the project is the capture of sodium ions in order to desalinize water. This was made possible by taking advantage of NhaS, a putative gene which is characterized after its expression, “by its corresponding protein ability to bind and sequestering sodium ions.” (Ivey, Krulwich, 1994).</p><br />
<br />
<p>The project’s circuit sequence is:<p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/8/82/ProjectCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>Since NhaS is putative, iGEM CIDEB 2014 decided to test the module with a red fluorescence protein (BBa_E1010), which is simpler than the original reporter idea for the module, and this allowed us to test one gene at a time in each module.</p><br />
<br />
<p>The sequence used for the NhaS experimentation is:</p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/5/54/ExperimentCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>An UV Promoter (BBa_I765001) was chosen to begin the circuit in order to control the NhaS gene’s expression in E. CARU. The promoter is followed by an RBS (BBa_B0034), the NhaS gene (BBa_K1255000), an RFP reporter (BBa_E1010) and a terminator (BBa_B1002).</p><br />
<br />
<p>Basically the same, just changing the RFP reporter for BSMT1 Opt (BBa_K1255001), which is the CDS that is able to produce a Wintergreen aroma. For further information look at the Aroma module in this document.</p><br />
<br />
<br><p><b>3. Aroma module</b><p><br />
<br />
<p>The use of reporters differing from the usual fluorescence proteins is one of the objectives iGEM CIDEB 2014 team is pursuing by using aromatic reporters, like banana or, in this case, wintergreen odor.</p><br />
<br />
<p>The aroma module is used in order to prove the effectiveness of BSMT1 Opt CDS (BBa_K1255001), for further use as an odor reporter for other teams and modules for this project. </p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/4/4c/AromaCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>BSMT1 (Salicylic Acid Carboxyl Methyltransferase I) is formed as part of a different circuit, composed by a constitutive promoter (BBa_J23119), a riboswitch (RNA thermometer, BBa_K115017), a CDS that, when it is induced by salicylic acid, it releases an enzymatic product (methyl salicylate), responsible of wintergreen odor, and a terminator (BBa_B1002).</p><br />
<br />
<img width=270 height=220 src="https://static.igem.org/mediawiki/2014hs/1/16/WgCIDEB.jpg" align=left hspace=12><br />
<p>This sequence will help to test its effectiveness and future usage as an odor reporter, since other teams (MIT 2006) have just analyzed it theoretically. IGEM CIDEB 2013 uses a riboswitch to induce the gene expression at high temperatures.</p><br />
<br />
<p>This piece (BSMT1 Opt) can replace RFP on capture module, or be added on union module; as wintergreen odor to demonstrate the presence of bacteria in silica beads or the capture of sodium ions on salty environments.</p><br />
<br />
<p>This module will be tested on a culture medium, and induced by salicylic acid to produce WG (WinterGreen) odor.</p><br />
<br />
<br><p><b>4. Union module</b><p><br />
<br />
<p>The main objective for iGEM CIDEB 2014 team is the construction of a biological circuit capable to capture sodium ions, and to remove them by using a silica-beads based bio-filter. In this module, the outer membrane of the bacteria is modified so it can bind silica or glass surfaces.</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/7/79/UnionCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<img width=130 height=210 src="https://static.igem.org/mediawiki/2014hs/8/88/BiofilterCIDEB.jpg" align=right hspace=12><br />
<br />
<p>This device is composed by a constitutive promoter (BBa_J23119), a common RBS (BBa_B0034), a fusion protein that of a set which includes the CDS L2 with its peptide signal and AIDA, in order to make the protein for binding silica; a membrane protein L2 (BBa_K888000); AIDA (BBa_888001), and a terminator (BBa_B1002).</p><br />
<br />
<p>This module was available and proportionated by UANL iGEM 2013 team, however, iGEM CIDEB 2014 made some modifications to it, ligating the peptide signal and L2.</p><br />
<br />
<p>A silica bio-filter will be used to remove <i>E. coli</i> from the water, but, in order to have also qualitative evidence of <i>E. coli’s</i> attachment to silica beads, the aroma module’s function as reporter will indicate its presence in the silica.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Potential Risks</h2></b></p><br />
<br />
<p>The project uses <i>E. coli</i> K-12 as the host bacteria, causing it to be resistant to saline water, capture sodium ions, getting attached to silica surfaces and releasing the winter-green aroma as reporter.</p><br />
<br />
<p>Potential Risks with the bacteria are minimum because, as previously mentioned in the organism’s description, the strain used is a non-pathogenic type. <I>E. coli</i> K12 has no known survival mechanism in living tissues, nor any of the health affecting symptoms that some varieties have.</p><br />
<br />
<p><i>E. coli</i> is absolutely safe, as P Kunhert states: “They are [<i>E. coli</i> K 12] classified as biologically safe vehicles for the propagation of many efficient gene cloning and expression vectors in all major national and international guidelines on biological safety for work with recombinant DNA technology” (1995).</p><br />
<br />
<p>K-12 strain is defective in its cell wall components relevant to the ability to reorganize and adhere to the mucosal surface of colonic cells (Curtiss 1978). It does not have the type of glycocalyx required for attachment to the mucosal surface of the human colon.</p><br />
<br />
<p>Performing genetic modifications in the project was not dangerous because the materials were handled carefully, in accordance with the “Laboratory Category One” guidelines published by the World Health Organization (WHO).</p><br />
<br />
<p>The modified <i>E. coli</i> parts are safe for the environment and for human use. Variables are controlled by the team, as in the case of Capture module (NhaS) which is controlled by a UV promoter.</p><br />
<br />
<p>Similarly, the Aroma module is controlled by a Riboswitch regulated by temperature in order to decide when and how is going to be activated, besides adding salicylic acid, which is only harmful in high doses for humans, and in the project it is used in very small amounts (2mm) to activate it.</p><br />
<br />
<p>The resistance module is also safe, since it gives the bacteria the ability to resist adverse conditions that would normally kill it, like high temperatures, high saline levels and high UV radiation, and nevertheless the bacteria would die in a normal environment.</p><br />
<br />
<p>The Union module gives E. CARU the ability to bind glass and silica surfaces, which we will use in beads form with the presentation that is used commercially. No direct risks are related to the module itself, but Silica gel beads may contain toxic and potentially carcinogenic cobalt (II) chloride, which is added as a moisture indicator in commercially available product. This point is analyzed further in the “Union as a safety measurement” section.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Lab Methods</h2></b></p><br />
<br />
<p>IGEM CIDEB 2014 had to take in consideration some aspects about biosafety when working in the project. At all times an instructor was present as a supervisor during the practices.</p><br />
<p>The team followed what the WHO’s category 1 laboratory guidelines indicated. The use of lab coat, long jeans, closed shoes and, if needed, tied hair was performed at all times while working on the lab. When managing dangerous substances gloves and/or special glasses were used depending on the situation.</p><br />
<p>When working with the trans-illuminator, the team took care of not looking directly the UV rays, instead a plastic UV protective shield and glasses were used while working with UV.</p><br />
<p>The laboratory was kept perfectly clean and dry, especially the place in which the instruments were located nearby electrical outputs. Glassware were reviewed and checked for cracks, before each usage; especially before applying under vacuum or pressure on them.</p><br />
<p>The generated waste was always placed in a properly labeled waste container, placed handily to avoid spills.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Hazardous Substances</h2></b></p><br />
<p>While working in the E.CARU project, specifically in the laboratory, the team was exposed to different substances that, if managed incorrectly, could cause harmful effects.</p><br />
<p>The main substances used in the project were the following (click for further information):</p><br />
<p>● <a href="https://static.igem.org/mediawiki/2014hs/d/de/EthidiumBromideCIDEB.pdf">Ethidium bromide</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/9e/NaOHCIDEB.pdf">NaOH</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/4/44/AceticAcidCIDEB.pdf">Acetic acid</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f9/MethylSalicylateCIDEB.pdf">Methyl salicylate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/a/a6/UV1CIDEB.pdf">UV radiation</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/74/TRIS_HCLCIDEB.pdf">Tris HCl</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/72/EDTACIDEB.pdf">EDTA (Ethylenediamineetetraacetic acid)</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/e3/DSSCIDEB.pdf">DSS (Dodecyl-sodium sulfate)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7c/PotassiumAcetateCIDEB.pdf">Potassium acetate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/6b/AgaroseCIDEB.pdf">Agarose</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/d/df/CaCl2CIDEB.pdf">Calcium Chloride (CaCl)<br></a><br />
● <a href="https://static.igem.org/mediawiki/2014hs/0/06/EthanolCIDEB.pdf">Ethanol (Ethyl Alcohol)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7a/AgarCIDEB.pdf">&ldquo;Lysogenic Broth&rdquo; (LB) broth and agar</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/ee/BuffersCIDEB.pdf">Buffers</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/97/RNaseCIDEB.pdf">RNase</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f8/RestrictionCIDEB.pdf">Restriction enzymes</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/69/SalineCIDEB.pdf">Saline water</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/c/c0/MilliQCIDEB.pdf">Milli-Q water</a></p><br />
<br />
<br><br />
<br />
<p><b><h2>Union as a safety measurement</h2></b></p><br />
<p>The Union module in the project has a genetic device that gives the bacteria the ability to anchor itself to silica surfaces. The team used this ability to use the bacteria as a biological filter. This biological filter would clean the water free of <i>Escherichia coli</i> to meet a solution for salty water. </p><br />
<p>Why silica pearls? Because silica pearls are very common to find, and even though that they are known for being harmful for humans if ingested, it’s not the silica gel that is toxic, what is toxic are the substances that the silica pearl can absorb (silica gel is known for its characteristic of having a great ability for absorbing humidity). Silica is, for example, used as a safe food additive, this means no permit is needed when added.</p><br />
<p>If people are not comfortable with using silica gel pearls for the biological filter, glass pearls can also be used, as the genetic device permits anchorage to glass surfaces, and glass has the advantage of not releasing any kind of substance if introduced in water, even for long periods of time, for the bacterium to attach. Also, for more efficiency in the de-contamination, glass recipients could be used, that way it would be easier for the anchorage of the bacterium.</p><br />
<p>The functioning of the biological filter is very simple: due to the reason that after the first three modules of the project, salt water would still have the genetically modified bacteria, which will have sodium ions within its cellular membrane, a filtration process will be carried out by silica pearls, which will result in desalinized water without the before mentioned bacteria.</p><br />
<p>For the filtration process to happen, no modification was used besides the genetic information that gives <i>Escherichia coli</i> the ability to adhere to the silica gel or to glass surfaces. Thus, when bacteria have already captured the desired amount of sodium ions, by adding silica or glass beads, the bacteria will attach in these and this will help remove the GMO (Genetically Modified Organism) in the water by an easy filtration of the water to be free of silica or glass beads containing the bacteria.</p><br />
<p>The risks considered in the use of silica beads are minimal since "The silica gel is inert and considered a non-toxic product," according to CITUC (UC Toxicological Information Centre for its acronym in Spanish). Actually, if the pearls are not correctly removed, there is only one risk: choking hazard, which is prevented by the safety guidelines that are followed in the laboratory and warns that under no circumstance water should be ingested with or without the silica beads before being tested and approved.</p><br />
<p>The biological filter, besides being the main purpose of our project, is one of the team’s safety measurements, because it prevents the bacterium from contaminating and reproducing in water by being removed.</p><br />
<br />
<br><br />
<br />
<p><b><h2>Contention Method</h2></b></p><br />
<p>When treating with GMOs there’s no such thing as “overprotection”. iGEM CIDEB 2014 takes safety seriously and decided that the project should include at least one method to shut off <i>E. coli</i> in case of an unexpected emergency situation, at least in a theoretical way.</p><br />
<p>The method proposed is simple, increasing the intensity of the UV light already used in the Project to turn off the organism.</p><br />
<p>First of all, Ultraviolet or UV light is light with wavelengths from 100 to 400 nm. According to Meulemans in 1986, its spectrum is divided into 4 different categories, as the following table shows:</p><br><br />
<br />
<style><br />
.data-table {<br />
border-collapse: collapse;<br />
}<br />
.border-top {<br />
border-top: 1px solid #000;<br />
}<br />
.border-bottom {<br />
border-bottom: 1px solid #000;<br />
}<br />
.border-left {<br />
border-left: 1px solid #000;<br />
}<br />
.border-right {<br />
border-right: 1px solid #000;<br />
}<br />
</style><br />
<img width=410 height=180 src="https://static.igem.org/mediawiki/2014hs/7/7e/Light-spectrumCIDEB.jpg" align=right hspace=12><br />
<table class="data-table" align="center"><br />
<tr><br />
<th class="border-top border-bottom border-left border-right">&nbsp;Type of UV&nbsp;</th><br />
<th class="border-top border-bottom border-right">&nbsp; Wavelenght&nbsp;</th><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;Vacuum UV&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;100 to 200nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-C&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;200 to 280nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-B&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;280 to 315nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-A&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;315 to 400nm&nbsp;</td><br />
</tr><br />
</table><br><br />
<br />
<p>EPA (United States Environmental Protection Agency) states that disinfection by UV primarily occurs due to the germicidal action of UV-B and UV-C light on microorganisms. And that the germicidal action of UV-A light is small relative to UV-B and UV-C light. So, in order for UV-A light to cause a “shut off” effect in the organism, very long exposure times are necessary.</p><br />
<p>What UV light does to microorganisms is that, once absorbed, it modifies and damages irreparably the DNA of the organism on the matters of question, in this case <i>E. coli</i> K12, by causing a photochemical damage. Therefore, RNA and DNA, molecules in charge of storing and carrying genetic information, can’t function properly, causing it to lose the ability to reproduce.</i><br />
<p>As Wolfe in 1990 states, and with the information from EPA, 254 nm is the most potent wavelength that can cause damage in DNA. 254 nm belongs to the UV-C light category and the team is planning to use it that way to deactivate E. CARU in extreme situations.</p><br />
<p>The UV light already used in the project is a promoter of the Capture module. This promoter is activated by 360nm, so it belongs in the UV-A category, and as it was mentioned before, this does not cause damage to the bacteria in short periods of time.</p><br />
<p>According to our project, UV is one of the easiest methods to shut off our GMO. </p><br />
<br />
<br />
<br><br />
<br />
<p><b><h2>Conclusions</h2></b></p><br />
<br />
<p>After doing an analysis of the possible risk related to our project and the safety measures that should be taken into consideration, it can be concluded that the project itself do not represents a considerable risk for human health, due to the poor resistance of the used strain of bacteria, even with the IrrE resistance module, the bacteria is still too weak to thrive in a non-controlled environment. Even though the bacteria cannot live outside the lab, all of the safety related issues to bio-contention of the organisms were all taken into consideration to avoid any possible contamination outside the laboratory. As previously mentioned, the bacteria does not oppose a significant threat for safety, but some substances used in the lab can be a major health concern if not managed properly. Because of this, the laboratory rules were made according to the WHO level 1 laboratory guidelines, and supervision was always present to avoid threats for the team. </p><br />
<br />
<br><br />
<p><b><h2>Bibliography/References</h2></b></p><br />
<br />
<font size="2"><p align=left>● ACETIC ACID (80%, 99.5%, Glacial). Hazard Communication Sheet. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf">http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf</a>.</p><br />
<p align=left>● Agaroses Manual. Condalab. Retrieved May 12, 2014, from: <a href="http://www.condalab.com/pdf/agarose_manual_09.pdf">http://www.condalab.com/pdf/agarose_manual_09.pdf</a>.</p><br />
<p align=left>● <i> “A toxic death for ethidium bromide”</i>. (n.d.). Laboratory News. Retrieved May 13, 2014, from: <a href="http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/">http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/</a>.</p><br />
<p align=left>● <i>Boric Acid. R.E.D. Facts. </i> Retrieved May 11, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf</a>.</p><br />
<p align=left>● Calcium Chloride - MSDS. (n.d.). <i>Calcium Chloride - MSDS</i>. Retrieved May 13, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● CHEMWATCH. <i>Sodium Dodecyl Sulfate</i>. Santa Cruz Biotechnology, Inc. Retrieved May 12, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● Curtiss, R, 1978, <i>Biological containment and cloning vector transmissibility, </i> J. Infectious Dis. 137:668-675.</p><br />
<p align=left>● Don Sarah (2008). <i>Optimal Conditions for the Growth of E Coli. </i>Retrieved May 11, 2014, from: <a href="http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli">http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli</a>.</p><br />
<p align=left>● EDETIC ACID (EDTA). <i>Summary Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f">http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f</a>.</p><br />
<p align=left>● <i>Environmental Health and Safety</i> (2007-09-10). "Silica Gel". Retrieved May 29, 2014, from: <a href="http://hazard.com/msds/mf/baker/baker/files/s1610.htm">http://hazard.com/msds/mf/baker/baker/files/s1610.htm</a>.</p><br />
<p align=left>● Environmental Protection Agency. <i>Sodium Hydroxide. R.E.ED. Facts</i>. Retrieved May 1, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf</a>.</p><br />
<p align=left>● Escherichia coli K-12 Derivatives <i>Final Risk Assessment. </i> EPA. Retrieved May 6, 2014, from: <a href="http://epa.gov/biotech_rule/pubs/fra/fra004.htm">http://epa.gov/biotech_rule/pubs/fra/fra004.htm</a>.</p><br />
<p align=left>● ETHANOL. <i>Hazard Communication Sheet</i>. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf">http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf</a>.</p><br />
<p align=left>● Ethylenediaminetetraacetic acid. <i>Summary of Initial Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf">http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf</a>.</p><br />
<p align=left>● Fotadar U, Zaveloff P, Terracio L (2005). <i>"Growth of Escherichia coli at elevated temperatures"</i>. J. Basic Microbiology. 45 (5): 403–4.doi:10.1002/jobm.200410542. PMID 16187264.</p><br />
<p align=left>● EPA (2006). <i>Ultraviolet disinfection guidance manual for the final long term 2 enhanced surface water treatment rule.</i> Retrieved May 29, 2014, from: <a href="http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf">http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf</a>.</p><br />
<p align=left>● EPA Guidance Manual (1999). <i>Alternative Disinfectants and Oxidants. </i> Chapter 8. Retrieved May 29, 2014. </p><br />
<p align=left>● <i>General Information Escherichia coli (E. coli) </i>. (2012, August 3). Centers for Disease Control and Prevention. Retrieved May 6, 2014, from: <a href="http://www.cdc.gov/ecoli/general/index.html">http://www.cdc.gov/ecoli/general/index.html</a>.</p><br />
<p align=left>● UANL Mexico (2012). <i>Recovery module. </i> Retrieved on March 28, from: <a href="https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery">https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery</a>.</p><br />
<p align=left>● Helmestine Anne Marie, 2014. <i>What happens if you eat silica gel beads? </i> Retrieved May 16, 2014, from: <a href="http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm">http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm</a>.</p><br />
<p align=left>● IGEM biosafety 2013. Retrieved May 16, 2014 from: <a href="http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf">http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf</a>.</p><br />
<p align=left>● IVEY Mark, KRULWICH Terry. (1994) <i>Sodium ion binding proteins. </i> Retrieved April 1, 2014 from: <a href="http://www.google.com.mx/patents/US5346815">http://www.google.com.mx/patents/US5346815</a>.</p><br />
<p align=left>● Jin Huh (2008). <i>Part BBa_k112808</i>. Retrieved May 16, 2014, from: <a href="https://2012.igem.org/Team:METU/KillSwitchOverview">https://2012.igem.org/Team:METU/KillSwitchOverview</a>.</p><br />
<p align=left>● Jones, T. F. (2007). <i>Investigation of Foodborne and Waterborne Disease Outbreaks. </i> In P. R. Murray, E. J. Baron, J. H. Jorgensen, M. L. Landry & M. A. Pfaller (Eds.), Manual of Clinical Microbiology (9th ed., pp. 152-169). Washignton, DC: ASM press. </p><br />
<p align=left>● Kunhert, P, J Nicolet, and J Frey. "Applied and Environmental Microbiology." <i>Rapid and accurate identification of Escherichia Coli k-12 strands. </i> Ed. P Kunhert. N.P., 31 Aug. 1995. Web. Retrieved May 13, 2014, from: <a href="http://aem.asm.org/content/61/11/4135.full.pdf">http://aem.asm.org/content/61/11/4135.full.pdf</a>.</p><br />
<p align=left>● McWilliams, M. <i>Luria Broth and Luria Agar Media and Their Uses Protocol</i>. American Society for Microbiology: Microbe Library. Retrieved May 12, 2014, from: <a href="http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Material Safety Data Sheet</i>. United Biochemicals. Retrieved May 12, 2014, from: <a href="http://www.unitedbiochemicals.com/msds/tris_hcl.pdf">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Methyl salicylate overdose</i> Medline plus Medical Encyclopedia. (n.d.). U.S National Library of Medicine. Retrieved May 13, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002683.htm">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>MIT IGEM Team. </i> (2006). MIT 2006. Retrieved on March 31, 2014, from; <a href="https://2006.igem.org/wiki/index.php/MIT_2006">https://2006.igem.org/wiki/index.php/MIT_2006</a>.</p><br />
<p align=left>● <i>Normas de Seguridad Laboratorio</i> Retrieved May 16, 2014, from: <a href="http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf">http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf</a>.</p><br />
<p align=left>● Pérez, E. (n.d.). <i>Boric acid poisoning</i>: Medline Plus Medical Encyclopedia. U.S National Library of Medicine. Retrieved May 12, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002485.html">http://www.nlm.nih.gov/medlineplus/ency/article/002485.html</a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). - <i>Worthington Enzyme Manual. </i> Retrieved May 12, 2014, from: <a href="http://www.worthington-biochem.com/RNASE/"></a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). <i>RCSB PDB-101. </i> Retrieved May 12, 2014, from: <a href="http://www.rcsb.org/pdb/101/motm.do?momID=105">http://www.rcsb.org/pdb/101/motm.do?momID=105</a>.</p><br />
<p align=left>● <i>"Silica Gel." </i> Centro De Información Toxicológica. CITUC. Red Salud UC Facultad De Medicina. Web. Retrieved May 30, 2014, from: <a href="http://www.cituc.cl/temas/ficha1.php?id=22">http://www.cituc.cl/temas/ficha1.php?id=22</a>.</p><br />
<p align=left>● <i>The known health effects of UV</i>. (n.d.). WHO. Retrieved May 13, 2014, from: <a href="http://www.who.int/uv/faq/uvhealtfac/en/">http://www.who.int/uv/faq/uvhealtfac/en/</a>.</p><br />
<p align=left>● <i>Type 1 Water, Milli-Q and Ultrapure Water System</i>. (n.d.). Retrieved May 12, 2014, from: <a href="http://www.millipore.com/lab_water/clw4/type1">http://www.millipore.com/lab_water/clw4/type1</a>.</p><br />
<p align=left>● UCL iGEM Team. (2012). <i>irrE module</i>. Retrieved March 31, 2014, from: <a href="https://2012.igem.org/Team:University_College_London/Module_5">https://2012.igem.org/Team:University_College_London/Module_5</a>.</p><br />
<p align=left>● Zubieta, Chole et al. (2003). <i>Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family. </i> Manuscript submitted for publication. Retrieved from <a href="www.plantcell.org; American Society of Plant Biologists">www.plantcell.org; American Society of Plant Biologists</a>.</p><br />
</font><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysis#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</li><br />
</ul><br />
<br></td><br />
</tr><br />
</table><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_questionsTeam:CIDEB-UANL Mexico/safety questions2014-06-18T19:15:18Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_safety}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;a<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
b<br />
{<br />
font-size: 14pt;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Safety Questions</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<p style="font-size: 14p;"><b>1. Would any of your project ideas raise safety issues in terms of:</p><br />
<br />
<font size=3"><br />
<p>● researcher safety,</p><br />
<p>● public safety, or</p><br />
<p>● environmental safety</p></b></font><br />
<br />
<span style="color:#DF0101"><b>▪ </b></span>IGEM CIDEB 2014’s Project does not raise any safety issues in either researcher, public or environmental safety. The chassis used is <i>Escherichia coli</i> K12 DH5α, which belongs to the Risk Group 1, meaning that the organism is unlikely to cause human or animal disease. According to the WHO, “<i>E. coli</i> K12 is a non-pathogenic strain that cannot permanently colonize the gut of healthy humans or animals.”</p><br />
<br />
<p>The following table shows the main parts used in the project, as well as safety related information:</p><br />
<br />
<center><br />
<br><br />
<table class=MsoTable15Grid6ColorfulAccent5 border=1 cellspacing=0<br />
cellpadding=0 width=623 style='width:467.55pt;border-collapse:collapse;<br />
border:none;mso-border-alt:solid #8EAADB .5pt;mso-border-themecolor:accent5;<br />
mso-border-themetint:153;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt'><br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes'><br />
<td width=104 style='width:77.75pt;border:solid #8EAADB 1.0pt;mso-border-themecolor:<br />
accent5;mso-border-themetint:153;border-bottom:solid #8EAADB 1.5pt;<br />
mso-border-bottom-themecolor:accent5;mso-border-bottom-themetint:153;<br />
mso-border-alt:solid #8EAADB .5pt;mso-border-themecolor:accent5;mso-border-themetint:<br />
153;mso-border-bottom-alt:solid #8EAADB 1.5pt;mso-border-bottom-themecolor:<br />
accent5;mso-border-bottom-themetint:153;background:#F7CAAC;mso-background-themecolor:<br />
accent2;mso-background-themetint:102;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:6.0pt;text-align:center;<br />
line-height:19.2pt;mso-yfti-cnfc:5'><b><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-fareast-language:ES-MX'>Gene<o:p></o:p></span></b></p><br />
</td><br />
<td width=94 style='width:70.85pt;border-top:solid #8EAADB 1.0pt;mso-border-top-themecolor:<br />
accent5;mso-border-top-themetint:153;border-left:none;border-bottom:solid #8EAADB 1.5pt;<br />
mso-border-bottom-themecolor:accent5;mso-border-bottom-themetint:153;<br />
border-right:solid #8EAADB 1.0pt;mso-border-right-themecolor:accent5;<br />
mso-border-right-themetint:153;mso-border-left-alt:solid #8EAADB .5pt;<br />
mso-border-left-themecolor:accent5;mso-border-left-themetint:153;mso-border-alt:<br />
solid #8EAADB .5pt;mso-border-themecolor:accent5;mso-border-themetint:153;<br />
mso-border-bottom-alt:solid #8EAADB 1.5pt;mso-border-bottom-themecolor:accent5;<br />
mso-border-bottom-themetint:153;background:#F7CAAC;mso-background-themecolor:<br />
accent2;mso-background-themetint:102;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:6.0pt;text-align:center;<br />
line-height:19.2pt;mso-yfti-cnfc:1'><span class=SpellE><b><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'>Used</span></b></span><b><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'><br />
in<o:p></o:p></span></b></p><br />
</td><br />
<td width=170 style='width:127.6pt;border-top:solid #8EAADB 1.0pt;mso-border-top-themecolor:<br />
accent5;mso-border-top-themetint:153;border-left:none;border-bottom:solid #8EAADB 1.5pt;<br />
mso-border-bottom-themecolor:accent5;mso-border-bottom-themetint:153;<br />
border-right:solid #8EAADB 1.0pt;mso-border-right-themecolor:accent5;<br />
mso-border-right-themetint:153;mso-border-left-alt:solid #8EAADB .5pt;<br />
mso-border-left-themecolor:accent5;mso-border-left-themetint:153;mso-border-alt:<br />
solid #8EAADB .5pt;mso-border-themecolor:accent5;mso-border-themetint:153;<br />
mso-border-bottom-alt:solid #8EAADB 1.5pt;mso-border-bottom-themecolor:accent5;<br />
mso-border-bottom-themetint:153;background:#F7CAAC;mso-background-themecolor:<br />
accent2;mso-background-themetint:102;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:6.0pt;text-align:center;<br />
line-height:19.2pt;mso-yfti-cnfc:1'><b><span lang=EN-US style='font-size:<br />
12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-ansi-language:EN-US;<br />
mso-fareast-language:ES-MX'>Organism from which is derived<o:p></o:p></span></b></p><br />
</td><br />
<td width=255 style='width:191.35pt;border-top:solid #8EAADB 1.0pt;<br />
mso-border-top-themecolor:accent5;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:solid #8EAADB 1.5pt;mso-border-bottom-themecolor:accent5;<br />
mso-border-bottom-themetint:153;border-right:solid #8EAADB 1.0pt;mso-border-right-themecolor:<br />
accent5;mso-border-right-themetint:153;mso-border-left-alt:solid #8EAADB .5pt;<br />
mso-border-left-themecolor:accent5;mso-border-left-themetint:153;mso-border-alt:<br />
solid #8EAADB .5pt;mso-border-themecolor:accent5;mso-border-themetint:153;<br />
mso-border-bottom-alt:solid #8EAADB 1.5pt;mso-border-bottom-themecolor:accent5;<br />
mso-border-bottom-themetint:153;background:#F7CAAC;mso-background-themecolor:<br />
accent2;mso-background-themetint:102;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:6.0pt;text-align:center;<br />
line-height:19.2pt;mso-yfti-cnfc:1'><span class=SpellE><b><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'>Risk</span></b></span><b><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'><br />
<span class=SpellE>group</span> <span class=SpellE>level</span><o:p></o:p></span></b></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:0'><br />
<td width=104 style='width:77.75pt;border:solid #8EAADB 1.0pt;mso-border-themecolor:<br />
accent5;mso-border-themetint:153;border-top:none;mso-border-top-alt:solid #8EAADB .5pt;<br />
mso-border-top-themecolor:accent5;mso-border-top-themetint:153;mso-border-alt:<br />
solid #8EAADB .5pt;mso-border-themecolor:accent5;mso-border-themetint:153;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:6.0pt;text-align:center;<br />
line-height:19.2pt;mso-yfti-cnfc:68'><span class=SpellE><b><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'>NhaS</span></b></span><b><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'><o:p></o:p></span></b></p><br />
</td><br />
<td width=94 style='width:70.85pt;border-top:none;border-left:none;<br />
border-bottom:solid #8EAADB 1.0pt;mso-border-bottom-themecolor:accent5;<br />
mso-border-bottom-themetint:153;border-right:solid #8EAADB 1.0pt;mso-border-right-themecolor:<br />
accent5;mso-border-right-themetint:153;mso-border-top-alt:solid #8EAADB .5pt;<br />
mso-border-top-themecolor:accent5;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #8EAADB .5pt;mso-border-left-themecolor:accent5;mso-border-left-themetint:<br />
153;mso-border-alt:solid #8EAADB .5pt;mso-border-themecolor:accent5;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:22.85pt;mso-yfti-cnfc:64'><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'>Capture<br />
module<o:p></o:p></span></p><br />
</td><br />
<td width=170 style='width:127.6pt;border-top:none;border-left:none;<br />
border-bottom:solid #8EAADB 1.0pt;mso-border-bottom-themecolor:accent5;<br />
mso-border-bottom-themetint:153;border-right:solid #8EAADB 1.0pt;mso-border-right-themecolor:<br />
accent5;mso-border-right-themetint:153;mso-border-top-alt:solid #8EAADB .5pt;<br />
mso-border-top-themecolor:accent5;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #8EAADB .5pt;mso-border-left-themecolor:accent5;mso-border-left-themetint:<br />
153;mso-border-alt:solid #8EAADB .5pt;mso-border-themecolor:accent5;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:22.85pt;mso-yfti-cnfc:64'><span class=SpellE><i><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'>Bacillus</span></i></span><i><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'><br />
<span class=SpellE>Firmus</span> OF4</span></i><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-fareast-language:ES-MX'><o:p></o:p></span></p><br />
</td><br />
<td width=255 style='width:191.35pt;border-top:none;border-left:none;<br />
border-bottom:solid #8EAADB 1.0pt;mso-border-bottom-themecolor:accent5;<br />
mso-border-bottom-themetint:153;border-right:solid #8EAADB 1.0pt;mso-border-right-themecolor:<br />
accent5;mso-border-right-themetint:153;mso-border-top-alt:solid #8EAADB .5pt;<br />
mso-border-top-themecolor:accent5;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #8EAADB .5pt;mso-border-left-themecolor:accent5;mso-border-left-themetint:<br />
153;mso-border-alt:solid #8EAADB .5pt;mso-border-themecolor:accent5;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:22.85pt;mso-yfti-cnfc:64'><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'>1,<br />
<span class=SpellE>according</span> to German TRBA (Technical Rules for Biological Agents).<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:1'><br />
<td width=104 style='width:77.75pt;border:solid #8EAADB 1.0pt;mso-border-themecolor:<br />
accent5;mso-border-themetint:153;border-top:none;mso-border-top-alt:solid #8EAADB .5pt;<br />
mso-border-top-themecolor:accent5;mso-border-top-themetint:153;mso-border-alt:<br />
solid #8EAADB .5pt;mso-border-themecolor:accent5;mso-border-themetint:153;<br />
background:#D9E2F3;mso-background-themecolor:accent5;mso-background-themetint:<br />
51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:6.0pt;text-align:center;<br />
line-height:19.2pt;mso-yfti-cnfc:4'><b><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-fareast-language:ES-MX'>BSMT1 Opt.<o:p></o:p></span></b></p><br />
</td><br />
<td width=94 style='width:70.85pt;border-top:none;border-left:none;<br />
border-bottom:solid #8EAADB 1.0pt;mso-border-bottom-themecolor:accent5;<br />
mso-border-bottom-themetint:153;border-right:solid #8EAADB 1.0pt;mso-border-right-themecolor:<br />
accent5;mso-border-right-themetint:153;mso-border-top-alt:solid #8EAADB .5pt;<br />
mso-border-top-themecolor:accent5;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #8EAADB .5pt;mso-border-left-themecolor:accent5;mso-border-left-themetint:<br />
153;mso-border-alt:solid #8EAADB .5pt;mso-border-themecolor:accent5;<br />
mso-border-themetint:153;background:#D9E2F3;mso-background-themecolor:accent5;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:22.85pt'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-fareast-language:ES-MX'>Aroma module<o:p></o:p></span></p><br />
</td><br />
<td width=170 style='width:127.6pt;border-top:none;border-left:none;<br />
border-bottom:solid #8EAADB 1.0pt;mso-border-bottom-themecolor:accent5;<br />
mso-border-bottom-themetint:153;border-right:solid #8EAADB 1.0pt;mso-border-right-themecolor:<br />
accent5;mso-border-right-themetint:153;mso-border-top-alt:solid #8EAADB .5pt;<br />
mso-border-top-themecolor:accent5;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #8EAADB .5pt;mso-border-left-themecolor:accent5;mso-border-left-themetint:<br />
153;mso-border-alt:solid #8EAADB .5pt;mso-border-themecolor:accent5;<br />
mso-border-themetint:153;background:#D9E2F3;mso-background-themecolor:accent5;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:22.85pt'><i><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-fareast-language:ES-MX'>Petunia x <span<br />
class=SpellE>hybrida</span></span></i><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-fareast-language:ES-MX'><o:p></o:p></span></p><br />
</td><br />
<td width=255 style='width:191.35pt;border-top:none;border-left:none;<br />
border-bottom:solid #8EAADB 1.0pt;mso-border-bottom-themecolor:accent5;<br />
mso-border-bottom-themetint:153;border-right:solid #8EAADB 1.0pt;mso-border-right-themecolor:<br />
accent5;mso-border-right-themetint:153;mso-border-top-alt:solid #8EAADB .5pt;<br />
mso-border-top-themecolor:accent5;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #8EAADB .5pt;mso-border-left-themecolor:accent5;mso-border-left-themetint:<br />
153;mso-border-alt:solid #8EAADB .5pt;mso-border-themecolor:accent5;<br />
mso-border-themetint:153;background:#D9E2F3;mso-background-themecolor:accent5;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:22.85pt'><span lang=EN-US style='font-size:<br />
12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-ansi-language:EN-US;<br />
mso-fareast-language:ES-MX'>It can’t be classified in a risk group since it<br />
comes from a plant, however, it is only used to produce a fresh aroma and it<br />
can be used in a Level 1 laboratory<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:2'><br />
<td width=104 style='width:77.75pt;border:solid #8EAADB 1.0pt;mso-border-themecolor:<br />
accent5;mso-border-themetint:153;border-top:none;mso-border-top-alt:solid #8EAADB .5pt;<br />
mso-border-top-themecolor:accent5;mso-border-top-themetint:153;mso-border-alt:<br />
solid #8EAADB .5pt;mso-border-themecolor:accent5;mso-border-themetint:153;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:6.0pt;text-align:center;<br />
line-height:19.2pt;mso-yfti-cnfc:68'><b><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-fareast-language:ES-MX'>IRRE<o:p></o:p></span></b></p><br />
</td><br />
<td width=94 style='width:70.85pt;border-top:none;border-left:none;<br />
border-bottom:solid #8EAADB 1.0pt;mso-border-bottom-themecolor:accent5;<br />
mso-border-bottom-themetint:153;border-right:solid #8EAADB 1.0pt;mso-border-right-themecolor:<br />
accent5;mso-border-right-themetint:153;mso-border-top-alt:solid #8EAADB .5pt;<br />
mso-border-top-themecolor:accent5;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #8EAADB .5pt;mso-border-left-themecolor:accent5;mso-border-left-themetint:<br />
153;mso-border-alt:solid #8EAADB .5pt;mso-border-themecolor:accent5;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:22.85pt;mso-yfti-cnfc:64'><span class=SpellE><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'>Resistance</span></span><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'><br />
module<o:p></o:p></span></p><br />
</td><br />
<td width=170 style='width:127.6pt;border-top:none;border-left:none;<br />
border-bottom:solid #8EAADB 1.0pt;mso-border-bottom-themecolor:accent5;<br />
mso-border-bottom-themetint:153;border-right:solid #8EAADB 1.0pt;mso-border-right-themecolor:<br />
accent5;mso-border-right-themetint:153;mso-border-top-alt:solid #8EAADB .5pt;<br />
mso-border-top-themecolor:accent5;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #8EAADB .5pt;mso-border-left-themecolor:accent5;mso-border-left-themetint:<br />
153;mso-border-alt:solid #8EAADB .5pt;mso-border-themecolor:accent5;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:22.85pt;mso-yfti-cnfc:64'><span class=SpellE><i><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'>Deinococcus</span></i></span><i><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'><br />
<span class=SpellE>radiodurans</span></span></i><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-fareast-language:ES-MX'><o:p></o:p></span></p><br />
</td><br />
<td width=255 style='width:191.35pt;border-top:none;border-left:none;<br />
border-bottom:solid #8EAADB 1.0pt;mso-border-bottom-themecolor:accent5;<br />
mso-border-bottom-themetint:153;border-right:solid #8EAADB 1.0pt;mso-border-right-themecolor:<br />
accent5;mso-border-right-themetint:153;mso-border-top-alt:solid #8EAADB .5pt;<br />
mso-border-top-themecolor:accent5;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #8EAADB .5pt;mso-border-left-themecolor:accent5;mso-border-left-themetint:<br />
153;mso-border-alt:solid #8EAADB .5pt;mso-border-themecolor:accent5;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:22.85pt;mso-yfti-cnfc:64'><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'>1,<br />
<span class=SpellE>according</span> to German TRBA.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes'><br />
<td width=104 style='width:77.75pt;border:solid #8EAADB 1.0pt;mso-border-themecolor:<br />
accent5;mso-border-themetint:153;border-top:none;mso-border-top-alt:solid #8EAADB .5pt;<br />
mso-border-top-themecolor:accent5;mso-border-top-themetint:153;mso-border-alt:<br />
solid #8EAADB .5pt;mso-border-themecolor:accent5;mso-border-themetint:153;<br />
background:#D9E2F3;mso-background-themecolor:accent5;mso-background-themetint:<br />
51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:6.0pt;text-align:center;<br />
line-height:19.2pt;mso-yfti-cnfc:4'><b><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-fareast-language:ES-MX'>L2 and AIDA<o:p></o:p></span></b></p><br />
</td><br />
<td width=94 style='width:70.85pt;border-top:none;border-left:none;<br />
border-bottom:solid #8EAADB 1.0pt;mso-border-bottom-themecolor:accent5;<br />
mso-border-bottom-themetint:153;border-right:solid #8EAADB 1.0pt;mso-border-right-themecolor:<br />
accent5;mso-border-right-themetint:153;mso-border-top-alt:solid #8EAADB .5pt;<br />
mso-border-top-themecolor:accent5;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #8EAADB .5pt;mso-border-left-themecolor:accent5;mso-border-left-themetint:<br />
153;mso-border-alt:solid #8EAADB .5pt;mso-border-themecolor:accent5;<br />
mso-border-themetint:153;background:#D9E2F3;mso-background-themecolor:accent5;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:22.85pt'><span class=SpellE><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'>Union</span></span><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'><br />
module<o:p></o:p></span></p><br />
</td><br />
<td width=170 style='width:127.6pt;border-top:none;border-left:none;<br />
border-bottom:solid #8EAADB 1.0pt;mso-border-bottom-themecolor:accent5;<br />
mso-border-bottom-themetint:153;border-right:solid #8EAADB 1.0pt;mso-border-right-themecolor:<br />
accent5;mso-border-right-themetint:153;mso-border-top-alt:solid #8EAADB .5pt;<br />
mso-border-top-themecolor:accent5;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #8EAADB .5pt;mso-border-left-themecolor:accent5;mso-border-left-themetint:<br />
153;mso-border-alt:solid #8EAADB .5pt;mso-border-themecolor:accent5;<br />
mso-border-themetint:153;background:#D9E2F3;mso-background-themecolor:accent5;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:22.85pt'><span class=SpellE><i><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'>Escherichia</span></i></span><i><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'><br />
<span class=SpellE>coli</span></span></i><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-fareast-language:ES-MX'><o:p></o:p></span></p><br />
</td><br />
<td width=255 style='width:191.35pt;border-top:none;border-left:none;<br />
border-bottom:solid #8EAADB 1.0pt;mso-border-bottom-themecolor:accent5;<br />
mso-border-bottom-themetint:153;border-right:solid #8EAADB 1.0pt;mso-border-right-themecolor:<br />
accent5;mso-border-right-themetint:153;mso-border-top-alt:solid #8EAADB .5pt;<br />
mso-border-top-themecolor:accent5;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #8EAADB .5pt;mso-border-left-themecolor:accent5;mso-border-left-themetint:<br />
153;mso-border-alt:solid #8EAADB .5pt;mso-border-themecolor:accent5;<br />
mso-border-themetint:153;background:#D9E2F3;mso-background-themecolor:accent5;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:22.85pt'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-fareast-language:ES-MX'>1, <span<br />
class=SpellE>according</span> to WHO<o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br><br />
</center><br />
<br />
<p>If the project goes according to plan neither team members, publics or environment could or would be harmed, since the project acts in water and the bacteria used would not survive normal environmental conditions.</p><br />
<br />
<p>The most dangerous substances used while working in the laboratory were the following (You can see further information by clicking on their names, and see more substances used and their respective information in the risk analysis section in this wiki):</p><br />
<br />
<font size=3"><br />
<p>● <a href="https://static.igem.org/mediawiki/2014hs/d/de/EthidiumBromideCIDEB.pdf">Ethidium bromide</a> </p><br />
<p>● <a href="https://static.igem.org/mediawiki/2014hs/9/9e/NaOHCIDEB.pdf">NaOH</a> </p><br />
<p>● <a href="https://static.igem.org/mediawiki/2014hs/4/44/AceticAcidCIDEB.pdf">Acetic acid</a> </p><br />
<p>● <a href="https://static.igem.org/mediawiki/2014hs/f/f9/MethylSalicylateCIDEB.pdf">Methyl salicylate</a> </p></font><br />
<br />
<p>However, this substances, as well as the laboratory equipment and the biological parts, were used with extreme caution and following the safety guidelines for each one.</p><br />
<br />
<p>The whole team received a training laboratory workshop given by our instructors and advisors before the project started. We learned the different laboratory protocols needed for the project and safety measurements for working on it. Besides, all members were given a laboratory manual including all the protocols that could be used.</p><br />
<br />
<p>If the project does not go according to plan and organisms or parts were released there would be no real danger either for team members, publics or environment since the chassis would not bear the conditions outside of the laboratory.</p><br />
<br />
<br><br />
<p><b>2. Do any of the new BioBrick parts (or devices) that you made this year raise safety issues? If yes,</p><br />
<br />
<font size=3"><br />
<p>● Did you document these issues in the Registry?</p><br />
<p>●How did you manage to handle the safety issue?</p><br />
<p>●How could other teams learn from your experience?</p></b></font><br />
<br />
<p><span style="color:#DF0101"><b>▪ </b></span>No, most of the parts used in the project were taken from the parts registry, assuring its safety, and the ones that we built all proceed from organisms from risk group 1 levels.</p><br />
<br />
<p>However, any detail related to safety, if existent, was included in the specific page of the part or device submitted.</p><br />
<br />
<br><p><b>3. Is there a local biosafety group, committee, or review board at your institution?</p><br />
<br />
<font size=3"><br />
<p>● If yes, what does your local biosafety group think about your project?</p><br />
<p>● If no, which specific biosafety rules or guidelines do you have to consider in your country?</p></b></font><br />
<br />
<p><span style="color:#DF0101"><b>▪ </b></span>There is a group in our school that is in charge of the different laboratories and their safety. This group was in frequent contact with the team, ensuring that the safety guidelines were being fulfilled. They approved our project.</p><br />
<br />
<p>The team worked with organisms and parts of BSL 1 in a level 1 laboratory, and safety was respected at all times. The project is in compliance with national regulations and university requirements.</p><br />
<br />
<p>The following is an official national document containing biosafety information:</p><br />
<br />
<p>-<a href="http://www.diputados.gob.mx/LeyesBiblio/pdf/LBOGM.pdf">Biosafety law of Genetically Modified Organisms</a></p><br><br />
<br />
<br><p><b>4. Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering?</b></p><br />
<br />
<p><span style="color:#DF0101"><b>▪ </b></span>If the E. CARU project succeeded and became widely used it could only be managed by industries or qualified people, for the organism is delicate and the project is regulated by certain aspects, like UV and temperature.</p><br />
<br />
<p>In case something unexpected happen, a safety measurement the team thought of was incrementing the UV needed for activating one of the modules in our project, this would result in the bacteria dying.</p><br />
<br />
<p>Also, most of the devices are activated by regulated promoters, assuring the system would activate only on certain conditions controlled by us.</p><br />
<br />
<p>Future teams could consider similar ideas on mind. Ideas like this are simple and easy to perform in iGEM projects and contribute to the project’s safety as a whole.</p><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_questions#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysisTeam:CIDEB-UANL Mexico/safety riskanalysis2014-06-18T18:58:18Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_safety}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Risk Analysis</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b>You can see and download the PDF version of this document, <a href="https://static.igem.org/mediawiki/2014hs/5/5f/SafetyRiskAnalysisCIDEB.pdf">Right Here!</a></b></p><br />
<br />
<br />
<br><font color="#0080FF"><p><b>Overview</b></font></p><br />
<p align="justify">IGEM CIDEB 2014 considers biosafety as important as every other points of the iGEM competition. Because of this reason, the team decided to perform a Safety Risk Assessment focused on the project and in the lab practices needed to accomplish it. <br />
In this assessment, a description of our host organism is made, along with the genetic modifications that were applied to it, including preventive measures to avoid its dissemination and appropriate identification and containment measures, in the case it was released into the environment. Also the overall potential risks of the project were included, taking in consideration all of the possible risks of working in our laboratory, along with preventive measures to reduce risk to a minimum.</p><br />
<br />
<br />
<br><font color="#0080FF"><p><b>Organism's description</b></font></p><br />
<p><i>Escherichia coli (E. coli)</i> is a large and diverse genus of bacteria belonging to the <i>Enterobacteriaceae.</i> Although most strains of <i>E. coli</i> are relatively harmless, some can potentially affect humans and animals. Pathogenic kinds of <i>E. coli</i> can cause diarrhea, along with urinary tract infections, respiratory illness and pneumonia, among other symptoms. <i>E. coli</i> can be commonly found in the digestive tract of humans and many animals. It plays an important role in the decomposition and absorption of certain nutrients in the intestine that the body cannot break down by itself and to also prevent the digestive track to be colonized by other harmful bacteria.</p><br />
<p><i>E. coli</i> are capable of both aerobic and anaerobic cellular respiration, which is a characteristic that allows them to live in both oxygen rich and oxygen poor environments, which has allowed them to thrive in a wide variety of ecosystems.</p><br />
<br />
<img width=250 height=200 src="https://static.igem.org/mediawiki/2014hs/f/f3/EcoliCIDEB.jpg" align=left hspace=12><br />
<p>As a prokaryote, <i>E. coli</i> bacterium has no organelles, and its genetic information is not enclosed in a nucleus. <i>E. coli</i> protective layer consists on a cell wall and a capsule that protects it from the outside, potentially harmful environment. <i>E. coli</i> goes through binary fusion on a regular basis if given the right conditions, usually at 37° Celsius, and it is able to thrive and reproduce at a very fast rate.</p><br />
<br />
<p>As previously mentioned, <i>E. coli</i> is one of the most diverse genera of bacteria, probably due to its adaptive abilities. Although there is a wide variety of different <i>E. coli</i> strains to choose from, not all of them have the same characteristics; some of them are pathogenic and are not safe to work with, which is the main reason why during the practices at the team’s laboratory, the <i>E. coli</i>’s strain that was used is the K12 DH5-α strain, which is one of the safest strains to work with, and one of the most used in biotechnology research. The K12 DH5-α strain is characterized by its poor abilities to colonize plant and animal tissue, and a low resistance to outside-lab environment, temperature fluctuation and different media composition causing the organism to die.</p><br />
<br />
<p><i>E. coli</i>’s K12 DH5-α inability to colonize intestinal tissue was experimented in 1978 in a work made by R. Curtiss “Biological containment and cloning vector transmissibility” showing that the K12 DH5-α strain is not likely to behave as a pathogen in mammal tissue. Due to these previous mentioned characteristics, it is classified as a Class 1 Containment under the European Federation of Biotechnology guidelines, and according to the United States Environmental Control Agency (EPA) <i>E. coli</i> K12 DH5-α strain opposes a very low risk for other organisms and under contained conditions of fermentation and are safe to work with.</p><br />
<br />
<br><font color="#0080FF"><p><b>Genetic modifications</b></font></p><br />
<br />
<p>In order to accomplish the iGEM CIDEB 2014 project’s objective, <i>E. coli</i> went through some genetic modifications. The E. CARU project is divided into four different modules, each one of them adding a different characteristic to the bacterium. The four modules are:</p><br />
<p> 1. Resistance</p><br />
<p> 2. Capture</p><br />
<p> 3. Aroma</p><br />
<p> 4. Union</p><br />
<br />
<br><p><b>1. Resistance module</b><p><br />
<br />
<img width=260 height=210 src="https://static.igem.org/mediawiki/2014hs/0/0c/ExperimentalCIDEB.jpg" align=right hspace=12><br />
<p>Unmodified <i>E. coli</i> K-12 is able to tolerate added salt of up to 10% concentration (M. Don, 2008), however, E. CARU was tested with higher amounts than those mentioned (For further information, check the Capture module in this wiki).</p><br />
<br />
<p>In order to work with abnormal higher saline concentrations without killing the bacteria, IrrE, a gene that provides resistance to some adverse conditions for it, was introduced to <i>E. coli</i>.</p><br />
<br />
<p>The gene IrrE up regulates the production of several stress responsive proteins, protein kinases, metabolic proteins, and detoxification proteins. It also down-regulates glycerol degradation. With this global regulatory effect, <i>E. coli</i> becomes more salt tolerant (UCL, 2012).</p> <br />
<br />
<p>The module’s sequence is as follows:</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/f/ff/ResistanceCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>The sequence begins with a constitutive promoter (BBa_J23119), followed by an RBS (BBa_B0034), the gene IrrE (BBa_K729001) and a terminator (BBa_B1002).</p><br />
<br />
<br><p><b>2. Capture module</b><p><br />
<br />
<p>One of the most important genetic modifications in the project is the capture of sodium ions in order to desalinize water. This was made possible by taking advantage of NhaS, a putative gene which is characterized after its expression, “by its corresponding protein ability to bind and sequestering sodium ions.” (Ivey, Krulwich, 1994).</p><br />
<br />
<p>The project’s circuit sequence is:<p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/8/82/ProjectCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>Since NhaS is putative, iGEM CIDEB 2014 decided to test the module with a red fluorescence protein (BBa_E1010), which is simpler than the original reporter idea for the module, and this allowed us to test one gene at a time in each module.</p><br />
<br />
<p>The sequence used for the NhaS experimentation is:</p><br />
<br />
<center><img width=310 height=130 src="https://static.igem.org/mediawiki/2014hs/5/54/ExperimentCaptureCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>An UV Promoter (BBa_I765001) was chosen to begin the circuit in order to control the NhaS gene’s expression in E. CARU. The promoter is followed by an RBS (BBa_B0034), the NhaS gene (BBa_K1255000), an RFP reporter (BBa_E1010) and a terminator (BBa_B1002).</p><br />
<br />
<p>Basically the same, just changing the RFP reporter for BSMT1 Opt (BBa_K1255001), which is the CDS that is able to produce a Wintergreen aroma. For further information look at the Aroma module in this document.</p><br />
<br />
<br><p><b>3. Aroma module</b><p><br />
<br />
<p>The use of reporters differing from the usual fluorescence proteins is one of the objectives iGEM CIDEB 2014 team is pursuing by using aromatic reporters, like banana or, in this case, wintergreen odor.</p><br />
<br />
<p>The aroma module is used in order to prove the effectiveness of BSMT1 Opt CDS (BBa_K1255001), for further use as an odor reporter for other teams and modules for this project. </p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/4/4c/AromaCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<p>BSMT1 (Salicylic Acid Carboxyl Methyltransferase I) is formed as part of a different circuit, composed by a constitutive promoter (BBa_J23119), a riboswitch (RNA thermometer, BBa_K115017), a CDS that, when it is induced by salicylic acid, it releases an enzymatic product (methyl salicylate), responsible of wintergreen odor, and a terminator (BBa_B1002).</p><br />
<br />
<img width=270 height=220 src="https://static.igem.org/mediawiki/2014hs/1/16/WgCIDEB.jpg" align=left hspace=12><br />
<p>This sequence will help to test its effectiveness and future usage as an odor reporter, since other teams (MIT 2006) have just analyzed it theoretically. IGEM CIDEB 2013 uses a riboswitch to induce the gene expression at high temperatures.</p><br />
<br />
<p>This piece (BSMT1 Opt) can replace RFP on capture module, or be added on union module; as wintergreen odor to demonstrate the presence of bacteria in silica beads or the capture of sodium ions on salty environments.</p><br />
<br />
<p>This module will be tested on a culture medium, and induced by salicylic acid to produce WG (WinterGreen) odor.</p><br />
<br />
<br><p><b>4. Union module</b><p><br />
<br />
<p>The main objective for iGEM CIDEB 2014 team is the construction of a biological circuit capable to capture sodium ions, and to remove them by using a silica-beads based bio-filter. In this module, the outer membrane of the bacteria is modified so it can bind silica or glass surfaces.</p><br />
<br />
<center><img width=290 height=130 src="https://static.igem.org/mediawiki/2014hs/7/79/UnionCIDEB.jpg" align=center hspace=12></center><br><br />
<br />
<img width=130 height=210 src="https://static.igem.org/mediawiki/2014hs/8/88/BiofilterCIDEB.jpg" align=right hspace=12><br />
<br />
<p>This device is composed by a constitutive promoter (BBa_J23119), a common RBS (BBa_B0034), a fusion protein that of a set which includes the CDS L2 with its peptide signal and AIDA, in order to make the protein for binding silica; a membrane protein L2 (BBa_K888000); AIDA (BBa_888001), and a terminator (BBa_B1002).</p><br />
<br />
<p>This module was available and proportionated by UANL iGEM 2013 team, however, iGEM CIDEB 2014 made some modifications to it, ligating the peptide signal and L2.</p><br />
<br />
<p>A silica bio-filter will be used to remove <i>E. coli</i> from the water, but, in order to have also qualitative evidence of <i>E. coli’s</i> attachment to silica beads, the aroma module’s function as reporter will indicate its presence in the silica.</p><br />
<br />
<br><font color="#0080FF"><p><b>Potential Risks</b></font></p><br />
<br />
<p>The project uses <i>E. coli</i> K-12 as the host bacteria, causing it to be resistant to saline water, capture sodium ions, getting attached to silica surfaces and releasing the winter-green aroma as reporter.</p><br />
<br />
<p>Potential Risks with the bacteria are minimum because, as previously mentioned in the organism’s description, the strain used is a non-pathogenic type. <I>E. coli</i> K12 has no known survival mechanism in living tissues, nor any of the health affecting symptoms that some varieties have.</p><br />
<br />
<p><i>E. coli</i> is absolutely safe, as P Kunhert states: “They are [<i>E. coli</i> K 12] classified as biologically safe vehicles for the propagation of many efficient gene cloning and expression vectors in all major national and international guidelines on biological safety for work with recombinant DNA technology” (1995).</p><br />
<br />
<p>K-12 strain is defective in its cell wall components relevant to the ability to reorganize and adhere to the mucosal surface of colonic cells (Curtiss 1978). It does not have the type of glycocalyx required for attachment to the mucosal surface of the human colon.</p><br />
<br />
<p>Performing genetic modifications in the project was not dangerous because the materials were handled carefully, in accordance with the “Laboratory Category One” guidelines published by the World Health Organization (WHO).</p><br />
<br />
<p>The modified <i>E. coli</i> parts are safe for the environment and for human use. Variables are controlled by the team, as in the case of Capture module (NhaS) which is controlled by a UV promoter.</p><br />
<br />
<p>Similarly, the Aroma module is controlled by a Riboswitch regulated by temperature in order to decide when and how is going to be activated, besides adding salicylic acid, which is only harmful in high doses for humans, and in the project it is used in very small amounts (2mm) to activate it.</p><br />
<br />
<p>The resistance module is also safe, since it gives the bacteria the ability to resist adverse conditions that would normally kill it, like high temperatures, high saline levels and high UV radiation, and nevertheless the bacteria would die in a normal environment.</p><br />
<br />
<p>The Union module gives E. CARU the ability to bind glass and silica surfaces, which we will use in beads form with the presentation that is used commercially. No direct risks are related to the module itself, but Silica gel beads may contain toxic and potentially carcinogenic cobalt (II) chloride, which is added as a moisture indicator in commercially available product. This point is analyzed further in the “Union as a safety measurement” section.</p><br />
<br />
<br><font color="#0080FF"><p><b>Lab methods</b></font></p><br />
<br />
<p>IGEM CIDEB 2014 had to take in consideration some aspects about biosafety when working in the project. At all times an instructor was present as a supervisor during the practices.</p><br />
<p>The team followed what the WHO’s category 1 laboratory guidelines indicated. The use of lab coat, long jeans, closed shoes and, if needed, tied hair was performed at all times while working on the lab. When managing dangerous substances gloves and/or special glasses were used depending on the situation.</p><br />
<p>When working with the trans-illuminator, the team took care of not looking directly the UV rays, instead a plastic UV protective shield and glasses were used while working with UV.</p><br />
<p>The laboratory was kept perfectly clean and dry, especially the place in which the instruments were located nearby electrical outputs. Glassware were reviewed and checked for cracks, before each usage; especially before applying under vacuum or pressure on them.</p><br />
<p>The generated waste was always placed in a properly labeled waste container, placed handily to avoid spills.</p><br />
<br />
<br><font color="#0080FF"><p><b>Hazardous substances</b></font></p><br />
<p>While working in the E.CARU project, specifically in the laboratory, the team was exposed to different substances that, if managed incorrectly, could cause harmful effects.</p><br />
<p>The main substances used in the project were the following (click for further information):</p><br />
<p>● <a href="https://static.igem.org/mediawiki/2014hs/d/de/EthidiumBromideCIDEB.pdf">Ethidium bromide</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/9e/NaOHCIDEB.pdf">NaOH</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/4/44/AceticAcidCIDEB.pdf">Acetic acid</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f9/MethylSalicylateCIDEB.pdf">Methyl salicylate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/a/a6/UV1CIDEB.pdf">UV radiation</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/74/TRIS_HCLCIDEB.pdf">Tris HCl</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/72/EDTACIDEB.pdf">EDTA (Ethylenediamineetetraacetic acid)</a><br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/e3/DSSCIDEB.pdf">DSS (Dodecyl-sodium sulfate)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7c/PotassiumAcetateCIDEB.pdf">Potassium acetate</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/6b/AgaroseCIDEB.pdf">Agarose</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/d/df/CaCl2CIDEB.pdf">Calcium Chloride (CaCl)<br></a><br />
● <a href="https://static.igem.org/mediawiki/2014hs/0/06/EthanolCIDEB.pdf">Ethanol (Ethyl Alcohol)</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/7/7a/AgarCIDEB.pdf">&ldquo;Lysogenic Broth&rdquo; (LB) broth and agar</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/e/ee/BuffersCIDEB.pdf">Buffers</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/9/97/RNaseCIDEB.pdf">RNase</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/f/f8/RestrictionCIDEB.pdf">Restriction enzymes</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/6/69/SalineCIDEB.pdf">Saline water</a> <br><br />
● <a href="https://static.igem.org/mediawiki/2014hs/c/c0/MilliQCIDEB.pdf">Milli-Q water</a></p><br />
<br />
<br><font color="#0080FF"><p><b>Union as a safety measurement</b></font></p><br />
<p>The Union module in the project has a genetic device that gives the bacteria the ability to anchor itself to silica surfaces. The team used this ability to use the bacteria as a biological filter. This biological filter would clean the water free of <i>Escherichia coli</i> to meet a solution for salty water. </p><br />
<p>Why silica pearls? Because silica pearls are very common to find, and even though that they are known for being harmful for humans if ingested, it’s not the silica gel that is toxic, what is toxic are the substances that the silica pearl can absorb (silica gel is known for its characteristic of having a great ability for absorbing humidity). Silica is, for example, used as a safe food additive, this means no permit is needed when added.</p><br />
<p>If people are not comfortable with using silica gel pearls for the biological filter, glass pearls can also be used, as the genetic device permits anchorage to glass surfaces, and glass has the advantage of not releasing any kind of substance if introduced in water, even for long periods of time, for the bacterium to attach. Also, for more efficiency in the de-contamination, glass recipients could be used, that way it would be easier for the anchorage of the bacterium.</p><br />
<p>The functioning of the biological filter is very simple: due to the reason that after the first three modules of the project, salt water would still have the genetically modified bacteria, which will have sodium ions within its cellular membrane, a filtration process will be carried out by silica pearls, which will result in desalinized water without the before mentioned bacteria.</p><br />
<p>For the filtration process to happen, no modification was used besides the genetic information that gives <i>Escherichia coli</i> the ability to adhere to the silica gel or to glass surfaces. Thus, when bacteria have already captured the desired amount of sodium ions, by adding silica or glass beads, the bacteria will attach in these and this will help remove the GMO (Genetically Modified Organism) in the water by an easy filtration of the water to be free of silica or glass beads containing the bacteria.</p><br />
<p>The risks considered in the use of silica beads are minimal since "The silica gel is inert and considered a non-toxic product," according to CITUC (UC Toxicological Information Centre for its acronym in Spanish). Actually, if the pearls are not correctly removed, there is only one risk: choking hazard, which is prevented by the safety guidelines that are followed in the laboratory and warns that under no circumstance water should be ingested with or without the silica beads before being tested and approved.</p><br />
<p>The biological filter, besides being the main purpose of our project, is one of the team’s safety measurements, because it prevents the bacterium from contaminating and reproducing in water by being removed.</p><br />
<br />
<br><font color="#0080FF"><p><b>Contention method</b></font></p><br />
<p>When treating with GMOs there’s no such thing as “overprotection”. iGEM CIDEB 2014 takes safety seriously and decided that the project should include at least one method to shut off <i>E. coli</i> in case of an unexpected emergency situation, at least in a theoretical way.</p><br />
<p>The method proposed is simple, increasing the intensity of the UV light already used in the Project to turn off the organism.</p><br />
<p>First of all, Ultraviolet or UV light is light with wavelengths from 100 to 400 nm. According to Meulemans in 1986, its spectrum is divided into 4 different categories, as the following table shows:</p><br><br />
<br />
<style><br />
.data-table {<br />
border-collapse: collapse;<br />
}<br />
.border-top {<br />
border-top: 1px solid #000;<br />
}<br />
.border-bottom {<br />
border-bottom: 1px solid #000;<br />
}<br />
.border-left {<br />
border-left: 1px solid #000;<br />
}<br />
.border-right {<br />
border-right: 1px solid #000;<br />
}<br />
</style><br />
<img width=410 height=180 src="https://static.igem.org/mediawiki/2014hs/7/7e/Light-spectrumCIDEB.jpg" align=right hspace=12><br />
<table class="data-table" align="center"><br />
<tr><br />
<th class="border-top border-bottom border-left border-right">&nbsp;Type of UV&nbsp;</th><br />
<th class="border-top border-bottom border-right">&nbsp; Wavelenght&nbsp;</th><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;Vacuum UV&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;100 to 200nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-C&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;200 to 280nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-B&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;280 to 315nm&nbsp;</td><br />
</tr><br />
<tr><br />
<td class="border-bottom border-left border-right">&nbsp;UV-A&nbsp;</td><br />
<td class="border-bottom border-right">&nbsp;315 to 400nm&nbsp;</td><br />
</tr><br />
</table><br><br />
<br />
<p>EPA (United States Environmental Protection Agency) states that disinfection by UV primarily occurs due to the germicidal action of UV-B and UV-C light on microorganisms. And that the germicidal action of UV-A light is small relative to UV-B and UV-C light. So, in order for UV-A light to cause a “shut off” effect in the organism, very long exposure times are necessary.</p><br />
<p>What UV light does to microorganisms is that, once absorbed, it modifies and damages irreparably the DNA of the organism on the matters of question, in this case <i>E. coli</i> K12, by causing a photochemical damage. Therefore, RNA and DNA, molecules in charge of storing and carrying genetic information, can’t function properly, causing it to lose the ability to reproduce.</i><br />
<p>As Wolfe in 1990 states, and with the information from EPA, 254 nm is the most potent wavelength that can cause damage in DNA. 254 nm belongs to the UV-C light category and the team is planning to use it that way to deactivate E. CARU in extreme situations.</p><br />
<p>The UV light already used in the project is a promoter of the Capture module. This promoter is activated by 360nm, so it belongs in the UV-A category, and as it was mentioned before, this does not cause damage to the bacteria in short periods of time.</p><br />
<p>According to our project, UV is one of the easiest methods to shut off our GMO. </p><br />
<br />
<br />
<br><font color="#0080FF"><p><b>Conclusions</b></font></p><br />
<br />
<p>After doing an analysis of the possible risk related to our project and the safety measures that should be taken into consideration, it can be concluded that the project itself do not represents a considerable risk for human health, due to the poor resistance of the used strain of bacteria, even with the IrrE resistance module, the bacteria is still too weak to thrive in a non-controlled environment. Even though the bacteria cannot live outside the lab, all of the safety related issues to bio-contention of the organisms were all taken into consideration to avoid any possible contamination outside the laboratory. As previously mentioned, the bacteria does not oppose a significant threat for safety, but some substances used in the lab can be a major health concern if not managed properly. Because of this, the laboratory rules were made according to the WHO level 1 laboratory guidelines, and supervision was always present to avoid threats for the team. </p><br />
<br />
<br><font color="#0080FF"><p><b>Bibliography</b></font></p><br />
<br />
<font size="2"><p align=left>● ACETIC ACID (80%, 99.5%, Glacial). Hazard Communication Sheet. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf">http://www.riskassessmentservices.co.uk/HazCom/Acetic%20Acid.pdf</a>.</p><br />
<p align=left>● Agaroses Manual. Condalab. Retrieved May 12, 2014, from: <a href="http://www.condalab.com/pdf/agarose_manual_09.pdf">http://www.condalab.com/pdf/agarose_manual_09.pdf</a>.</p><br />
<p align=left>● <i> “A toxic death for ethidium bromide”</i>. (n.d.). Laboratory News. Retrieved May 13, 2014, from: <a href="http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/">http://www.labnews.co.uk/features/a-toxic-death-for-ethidium-bromide/</a>.</p><br />
<p align=left>● <i>Boric Acid. R.E.D. Facts. </i> Retrieved May 11, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/0024fact.pdf</a>.</p><br />
<p align=left>● Calcium Chloride - MSDS. (n.d.). <i>Calcium Chloride - MSDS</i>. Retrieved May 13, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● CHEMWATCH. <i>Sodium Dodecyl Sulfate</i>. Santa Cruz Biotechnology, Inc. Retrieved May 12, 2014, from: <a href="http://www.calciumchloride.co.uk/calcium_chloride_msds.html">http://www.calciumchloride.co.uk/calcium_chloride_msds.html</a>.</p><br />
<p align=left>● Curtiss, R, 1978, <i>Biological containment and cloning vector transmissibility, </i> J. Infectious Dis. 137:668-675.</p><br />
<p align=left>● Don Sarah (2008). <i>Optimal Conditions for the Growth of E Coli. </i>Retrieved May 11, 2014, from: <a href="http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli">http://es.scribd.com/doc/11337868/Optimal-Conditions-for-the-Growth-of-E-Coli</a>.</p><br />
<p align=left>● EDETIC ACID (EDTA). <i>Summary Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f">http://echa.europa.eu/documents/10162/5ed7db13-e932-4999-8514-378ce88ca51f</a>.</p><br />
<p align=left>● <i>Environmental Health and Safety</i> (2007-09-10). "Silica Gel". Retrieved May 29, 2014, from: <a href="http://hazard.com/msds/mf/baker/baker/files/s1610.htm">http://hazard.com/msds/mf/baker/baker/files/s1610.htm</a>.</p><br />
<p align=left>● Environmental Protection Agency. <i>Sodium Hydroxide. R.E.ED. Facts</i>. Retrieved May 1, 2014, from: <a href="http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf">http://www.epa.gov/oppsrrd1/REDs/factsheets/4065fact.pdf</a>.</p><br />
<p align=left>● Escherichia coli K-12 Derivatives <i>Final Risk Assessment. </i> EPA. Retrieved May 6, 2014, from: <a href="http://epa.gov/biotech_rule/pubs/fra/fra004.htm">http://epa.gov/biotech_rule/pubs/fra/fra004.htm</a>.</p><br />
<p align=left>● ETHANOL. <i>Hazard Communication Sheet</i>. Retrieved May 12, 2014, from: <a href="http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf">http://www.riskassessmentservices.co.uk/HazCom/Ethanol.pdf</a>.</p><br />
<p align=left>● Ethylenediaminetetraacetic acid. <i>Summary of Initial Risk Assessment Report. </i> Retrieved May 12, 2014, from: <a href="http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf">http://www.safe.nite.go.jp/english/risk/pdf/03_summary/047sum.pdf</a>.</p><br />
<p align=left>● Fotadar U, Zaveloff P, Terracio L (2005). <i>"Growth of Escherichia coli at elevated temperatures"</i>. J. Basic Microbiology. 45 (5): 403–4.doi:10.1002/jobm.200410542. PMID 16187264.</p><br />
<p align=left>● EPA (2006). <i>Ultraviolet disinfection guidance manual for the final long term 2 enhanced surface water treatment rule.</i> Retrieved May 29, 2014, from: <a href="http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf">http://www.epa.gov/ogwdw/disinfection/lt2/pdfs/guide_lt2_uvguidance.pdf</a>.</p><br />
<p align=left>● EPA Guidance Manual (1999). <i>Alternative Disinfectants and Oxidants. </i> Chapter 8. Retrieved May 29, 2014. </p><br />
<p align=left>● <i>General Information Escherichia coli (E. coli) </i>. (2012, August 3). Centers for Disease Control and Prevention. Retrieved May 6, 2014, from: <a href="http://www.cdc.gov/ecoli/general/index.html">http://www.cdc.gov/ecoli/general/index.html</a>.</p><br />
<p align=left>● UANL Mexico (2012). <i>Recovery module. </i> Retrieved on March 28, from: <a href="https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery">https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery</a>.</p><br />
<p align=left>● Helmestine Anne Marie, 2014. <i>What happens if you eat silica gel beads? </i> Retrieved May 16, 2014, from: <a href="http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm">http://chemistry.about.com/od/medicalhealth/f/What-Happens-If-You-Eat-Silica-Gel-Beads.htm</a>.</p><br />
<p align=left>● IGEM biosafety 2013. Retrieved May 16, 2014 from: <a href="http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf">http://www.biofaction.com/wp-content/uploads/2012/04/igem-biosafety-2013.pdf</a>.</p><br />
<p align=left>● IVEY Mark, KRULWICH Terry. (1994) <i>Sodium ion binding proteins. </i> Retrieved April 1, 2014 from: <a href="http://www.google.com.mx/patents/US5346815">http://www.google.com.mx/patents/US5346815</a>.</p><br />
<p align=left>● Jin Huh (2008). <i>Part BBa_k112808</i>. Retrieved May 16, 2014, from: <a href="https://2012.igem.org/Team:METU/KillSwitchOverview">https://2012.igem.org/Team:METU/KillSwitchOverview</a>.</p><br />
<p align=left>● Jones, T. F. (2007). <i>Investigation of Foodborne and Waterborne Disease Outbreaks. </i> In P. R. Murray, E. J. Baron, J. H. Jorgensen, M. L. Landry & M. A. Pfaller (Eds.), Manual of Clinical Microbiology (9th ed., pp. 152-169). Washignton, DC: ASM press. </p><br />
<p align=left>● Kunhert, P, J Nicolet, and J Frey. "Applied and Environmental Microbiology." <i>Rapid and accurate identification of Escherichia Coli k-12 strands. </i> Ed. P Kunhert. N.P., 31 Aug. 1995. Web. Retrieved May 13, 2014, from: <a href="http://aem.asm.org/content/61/11/4135.full.pdf">http://aem.asm.org/content/61/11/4135.full.pdf</a>.</p><br />
<p align=left>● McWilliams, M. <i>Luria Broth and Luria Agar Media and Their Uses Protocol</i>. American Society for Microbiology: Microbe Library. Retrieved May 12, 2014, from: <a href="http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Material Safety Data Sheet</i>. United Biochemicals. Retrieved May 12, 2014, from: <a href="http://www.unitedbiochemicals.com/msds/tris_hcl.pdf">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>Methyl salicylate overdose</i> Medline plus Medical Encyclopedia. (n.d.). U.S National Library of Medicine. Retrieved May 13, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002683.htm">http://www.microbelibrary.org/component/resource/laboratory-test/3031-luria-broth-lb-and-luria-agar-la-media-and-their-uses-protocol</a>.</p><br />
<p align=left>● <i>MIT IGEM Team. </i> (2006). MIT 2006. Retrieved on March 31, 2014, from; <a href="https://2006.igem.org/wiki/index.php/MIT_2006">https://2006.igem.org/wiki/index.php/MIT_2006</a>.</p><br />
<p align=left>● <i>Normas de Seguridad Laboratorio</i> Retrieved May 16, 2014, from: <a href="http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf">http://www.uv.es/gammmm/Subsitio%20Operaciones/7%20normas%20de%20seguridad_archivos/NORMAS%20SEGURIDAD%20LABORATO RIO.pdf</a>.</p><br />
<p align=left>● Pérez, E. (n.d.). <i>Boric acid poisoning</i>: Medline Plus Medical Encyclopedia. U.S National Library of Medicine. Retrieved May 12, 2014, from: <a href="http://www.nlm.nih.gov/medlineplus/ency/article/002485.html">http://www.nlm.nih.gov/medlineplus/ency/article/002485.html</a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). - <i>Worthington Enzyme Manual. </i> Retrieved May 12, 2014, from: <a href="http://www.worthington-biochem.com/RNASE/"></a>.</p><br />
<p align=left>● Ribonuclease A. (n.d.). <i>RCSB PDB-101. </i> Retrieved May 12, 2014, from: <a href="http://www.rcsb.org/pdb/101/motm.do?momID=105">http://www.rcsb.org/pdb/101/motm.do?momID=105</a>.</p><br />
<p align=left>● <i>"Silica Gel." </i> Centro De Información Toxicológica. CITUC. Red Salud UC Facultad De Medicina. Web. Retrieved May 30, 2014, from: <a href="http://www.cituc.cl/temas/ficha1.php?id=22">http://www.cituc.cl/temas/ficha1.php?id=22</a>.</p><br />
<p align=left>● <i>The known health effects of UV</i>. (n.d.). WHO. Retrieved May 13, 2014, from: <a href="http://www.who.int/uv/faq/uvhealtfac/en/">http://www.who.int/uv/faq/uvhealtfac/en/</a>.</p><br />
<p align=left>● <i>Type 1 Water, Milli-Q and Ultrapure Water System</i>. (n.d.). Retrieved May 12, 2014, from: <a href="http://www.millipore.com/lab_water/clw4/type1">http://www.millipore.com/lab_water/clw4/type1</a>.</p><br />
<p align=left>● UCL iGEM Team. (2012). <i>irrE module</i>. Retrieved March 31, 2014, from: <a href="https://2012.igem.org/Team:University_College_London/Module_5">https://2012.igem.org/Team:University_College_London/Module_5</a>.</p><br />
<p align=left>● Zubieta, Chole et al. (2003). <i>Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family. </i> Manuscript submitted for publication. Retrieved from <a href="www.plantcell.org; American Society of Plant Biologists">www.plantcell.org; American Society of Plant Biologists</a>.</p><br />
</font><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_riskanalysis#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</li><br />
</ul><br />
<br></td><br />
</tr><br />
</table><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_unionTeam:CIDEB-UANL Mexico/math union2014-06-18T15:40:15Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_math}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<!-- MathJax (LaTeX for the web) --><br />
<script type="text/x-mathjax-config"><br />
MathJax.Hub.Config({tex2jax: {inlineMath: [['$','$'], ['\\(','\\)']]}});<br />
MathJax.Hub.Config({<br />
TeX: { <br />
equationNumbers: { autoNumber: "AMS" }<br />
}<br />
});<br />
</script><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Union Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p>The union module is based on the use of a fusion protein composed by L2 and AIDA. L2+AIDA is a protein which is not affected by external factors during its transcription, as well as its translation, so the established parameters was used with the data obtained by the team:</p><br />
<br />
<br><br />
\begin{equation}<br />
\large \frac{d\left [ mRNA \right ]}{dt}= \alpha_{1}-d_{1}\left [ mRNA \right ]<br />
\end{equation}<br />
</p><br><br />
<br />
<p>The parameters for both, the translation and transcription rate from Singapore 2008 iGEM team, were used, as well as the speeds at which <i>E. coli</i> carries out the transcription and translation, assuming a transcription speed of <i>70nt/s</i> and a translation speed of <i>40aa/s</i>. These data were used in the equations below with the L2+AIDA gene length of <i>2620nt</i> and protein length of 856aa:<br><br />
<br />
<br><br />
\begin{equation}<br />
\large \alpha_{1} = \frac{transcription speed}{gene length (nt)}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2} = \frac{translation speed}{protein length (aa)}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{1} = \frac{(70)(60)}{2620} = 1.6 <br />
\end{equation}<br><br />
<br />
\begin{equation} <br />
\large \alpha_{2} = \frac{(40)(60)}{856} = 2.8<br />
\end{equation}<br><br />
<br />
<p>Then, the parameters for degradation rates for proteins and mRNAs from Beijing PKU 2009 iGEM team were used:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large d_{1} = \frac{1}{half-life} + \frac{1}{30} min<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large d_{2} = \frac{1}{half-life} + \frac{1}{30} min<br />
\end{equation}<br><br />
<br />
<p>Since the protein was the fusion of two, a research was needed to find out the half-life each protein separately. The half-life of membrane proteins range between 2 to 20 hours in <i>E. coli</i> (Hare, 1991), and as AIDA-I is a membrane protein its half-life must be between that range, for the specific half-life of AIDA is not determined. To find the half-life of L2, based on previous research, it was assumed that it was 7.8 hours (Bergant, 2010). Bergant’s team made a test with a homologous protein, but found in the minor capsid of the Human Papillomavirus (HPV). Although the function of the L2 strand in HPV is viral and in <i>E. coli</i> is ribosomal, both share similar structures and sequences. Once it was decided to use the half-life from the homologous L2, it was used as the half-life for the fusion protein because it was between the range of AIDA-I and also because it was the lower half-life, assuming <i>E. coli</i> starts the degradation of L2, the whole protein would be degraded. </p><br />
<p>To determine the degradation rate of average mRNA, the information from Selinger’s team (2003) was used. They carried several experiments to find out the average mRNA half-life in <i>E. coli</i>. They used mRNAs about <i>1100nt</i>, concluding they have an average half-life of 5min. So with this, the average mRNA half-life of L2+AIDA was found to be 11.9min.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large HL = \frac{1100(nt)}{5 min}<br />
\end{equation}<br><br />
<br />
<br><br />
<p>With all these information, the degradation rates for both transcription and translation of L2+AIDA were found:<br />
<br><br />
<br><br />
\begin{equation}<br />
\large d_{1} = \frac{1}{11.9} + \frac{1}{30} = 0.11<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large d_{2} = \frac{1}{468} + \frac{1}{30} = 0.035<br />
\end{equation}<br />
</p><br><br />
<br />
<p>Simbiology was used for the simulation. The previous data from the equations were used to calculate the amount of proteins <i>E. coli</i> would produce at certain times. The results obtained are shown in the following graph:</p><br />
<br />
<br><center><p><img width=535 src="https://static.igem.org/mediawiki/2014hs/0/05/Aida_total.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<br><br />
<p>For translation there was another factor that was needed to be taken into consideration, the <b><i>“f<sub>post</sub>”</i></b>, which were the posttranslational variables affecting the production of the functional protein:<br><br />
<br />
\begin{equation}<br />
\large \frac{d[P]}{dt} = \alpha_{2} \cdot[mRNA] - d_{2}[P] - f_{post}<br />
\end{equation}<br />
</p><br><br />
<br />
<p>Since the fusion protein needs to be expressed in the membrane of <i>E. coli</i>, the average velocity at which <i>E. coli</i> exports its proteins to the membrane was needed. The process by which bacteria exports its proteins are divided into three phases: the “breathing” between translation and the second phase, which is movement of a protein to the membrane, and translocation (in this phase the protein attaches to the membrane of the bacteria (Peskin, 1991)). Using this information, it was determined that <i>E. coli</i> completes these phases in an average of 5 to 6 min, depending on the protein size (Driessen, 1990). The time used was 5.5min because L2+AIDA are not too small or too big in length <i>(2620nt)</i>.</p><br />
<br />
<p>According to Ikeda y Kuroda (2011), L2 carries out an unfolding process to become functional. It was found out that the 50S ribosomal proteins L2, L3, L14, L23, L24, and L32, as well as the 30S ribosomal proteins, S12 and S18, were native premolten globules in their free forms, but adopted rigid well-folded conformations during the formation of a functional ribosome. They exhibit several amounts of ordered secondary structures; the unfolding of a protein molecule results in an essential increase in its hydrodynamic volume. For instance, there is a well-documented 15–20% increase in the hydrodynamic radius of globular proteins upon their transformation into the molten globule state (Unversky, 2002). Also, the equation from Unversky to find the L2 unfolding rate in <i>E. coli</i> was used, with the results shown below:<br />
<br />
<br><br />
<br>\begin{equation}<br />
\large [H]boundary = \frac{[R]+1.51}{2.785}<br />
\end{equation}<br />
</p><br><br />
<br />
<p>This equation gives the estimation of the "boundary" mean hydrophobicity value, <b><i>“[H]boundary”</i></b>, below which a polypeptide chain with a given net charge <b><i>“[R]”</i></b> will most probably be unfolded. Thus, sequences of natively unfolded proteins may be characterized by a low sequence complexity and/or high net charge coupled with low mean hydrophobicity (the values are specified for globular proteins). According to Ikeda and Kuroda (2011) the net charge <b><i>“[R]”</i></b> of L2 is 10.9, so we substituted it in the equation below:</p><br />
<br />
<br><br />
\begin{equation}<br />
\large [H]boundary = \frac{10.9 + 1.51}{2.785} = 4.45<br />
\end{equation}<br />
</p><br><br />
<br />
<p>With the unfolding value and the rate of membrane transport in <i>E. coli</i> we could use it in Simbiology for modelling the functional L2+AIDA production. The results obtained were the following:</p><br />
<br />
<center><p><img width=490 src="https://static.igem.org/mediawiki/2014hs/9/99/Aida_y_l2.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<center><p><img width=540 src="https://static.igem.org/mediawiki/2014hs/1/16/Nonfunctional_irre.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br><br />
<br />
<p>Comparing both graphs (<b>Graph 1</b> and <b>Graph 2</b>) we realize that although <i>E. coli</i> needs to transport the L2+AIDA proteins to its membrane, the rate at which <i>E. coli</i> does it is slower than the production of the fusion protein, but something that was noticed (and was great) is that according to Simbiology, almost all the proteins, once they are inserted in the membrane, unfold correctly leaving less than 25 nonfunctional proteins.</p><br />
<br />
<br><p><b><h2>Bibliography/References</h2></b></p><br />
<br />
<font size="2"><br />
<p>● Arnold Driessen, W. W. (1990). Proton transfer rate-limiting for translocation of precursor proteins by the Escherichia coli translocase. <i></i>Biochemistry, 2471-2475.</p><br />
<p>● Charles Peskin, S. S. (1991). What drives the translocation of proteins. <i>Biophysics</i>, 3770-3774.</p><br />
<p>● Douglas Selinger, R. M. (2003). Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. <i>Genome Research</i>, 216-223.</p><br />
<p>● James Hare, K. T. (1991). Mechanisms of plasma membrane protein degradation: Recycling proteins are degraded more rapidly than those confined to the cell surface. <i>PNAS</i>, 5902-5906.</p><br />
<p>● Martina Bergant, N. M. (2010). Modification of Human Papillomavirus Minor Capsid Protein L2 by Sumoylation. <i>Journal of Virology</i>, 11585-11589.</p><br />
<p>● Takeshi Ikeda, A. K. (2011). Why does the silica-binding protein "Si-tag" bind strongly to silica surfaces? Implications of conformational adaptation of the intrinsically disordered polypeptide to soli surfaces. <i>Colloids and Surfaces</i>, 359-363.</p><br />
<p>● Uversky, V. (2002). Natively unfolded proteins: A point where biology waits for physics. <i>Protein Science</i>, 739-756.</p><br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_union#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_resistanceTeam:CIDEB-UANL Mexico/math resistance2014-06-18T14:57:45Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_math}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<!-- MathJax (LaTeX for the web) --><br />
<script type="text/x-mathjax-config"><br />
MathJax.Hub.Config({tex2jax: {inlineMath: [['$','$'], ['\\(','\\)']]}});<br />
MathJax.Hub.Config({<br />
TeX: { <br />
equationNumbers: { autoNumber: "AMS" }<br />
}<br />
});<br />
</script><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Resistance Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p>The resistance module is based in the use of the IrrE gene. IrrE is a protein which is not affected by external factors during its transcription or in its translation, so established parameters were needed to use in the obtained from IrrE.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \frac{d\left [ mRNA \right ]}{dt}=\alpha_{1}-d_{1}\left [ mRNA \right ]<br />
\end{equation}<br />
<br />
<br><br />
<p>The parameters for translation and transcription rate from Singapore 2008 iGEM team were used, as well as the transcription and translation speeds carried out by <i>E. coli;</i> assuming a transcription speed of <i>70nt/s</i> and a translation speed of <i>40aa/s</i>. So we used them in the equations below with the IrrE gene length <i>(986nt)</i> and protein length <i>(311aa)</i> respectively.</p><br />
<br><br />
<br />
<br />
\begin{equation}<br />
\large \alpha_{1}=\frac{transcription speed}{gen lenght (nt)} <br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2}=\frac{translation speed}{protein lenght (aa)}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{1}=\frac{(70)(60)}{986}=4.25<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2}=\frac{(40)(60)}{311}=7.7<br />
\end{equation}<br><br />
<p>There were used the parameters for degradation rates for proteins and mRNAs from Beijing PKU 2009 iGEM team:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large d_{1}=\frac{1}{half-life}+\frac{1}{30}min<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large d_{2}=\frac{1}{half-life}+\frac{1}{30}min <br />
\end{equation}<br><br />
<br />
<p>Since IrrE half-life has not been determined yet, it was decided to research about homologous proteins with the same function as IrrE (transcriptional factor), and according to Dibden and Green (2005) the average half-life for transcriptional factors in <i>E. coli</i> is 45 min. They tested FNR proteins (transcriptional factors) through thermo-inducible<i>fnr</i> expression observing that their half-life was 45min average. </p><br />
<br />
<p>In order for determining the degradation rate of average mRNA we used the information from Selinger’s team (2003). They carried several experiments for finding average mRNA half-life in <i>E. coli</i>. They used mRNAs about <i>1100nt</i> concluding they have an average half-life of 5min. So with this we found the average mRNA half-life of IrrE was 4.45min.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \frac{d[P]}{dt} = \alpha_{2} \cdot[mRNA] - d_{2}[P] - f_{post(p)}<br />
\end{equation}<br><br />
<br />
<br />
<p>With all of this information the degradation rates for both transcription and translation of IrrE were found.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large d_{1}=\frac{1}{4.5}+\frac{1}{30}=0.25d_{2}=\frac{1}{45}+\frac{1}{30}=0.055<br />
\end{equation}<br><br />
<br />
<p>For the simulation the team used Simbiology&reg;, by plugging in the previously calculated data from the equations, to findin the amount of proteins <i>E. coli</i> would produce at certain time. The following was the result of the simulation:</p><br />
<br><br />
<br />
<br />
<center><p><img width=500 height=400 src="https://static.igem.org/mediawiki/2014hs/3/38/Irre_sin_post.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br><br />
<br />
<p>But for translation there was another factor taken in consideration, the <b><i>“f<sub>post(p)</sub>”</i></b> which were the posttranslational variables affecting the production of the functional protein.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \frac{dpi}{dt}=Ti-Dpmi- f_{post (p)}<br />
\end{equation}<br><br />
<br />
<p>After researching, it was found that IrrE needs to have a positive charge to be functional, accepting one Zn<SUP>2+</SUP> ion from <i>E.coli</i> (Vujicic, 2009). Vujicic’s team developed the structure of IrrE deducing it should have three domains; one specific is the zinc-binding site where the Zn<SUP>2+</SUP> ion binds to make IrrE positive. IrrE positivecharge is what makes possible its binding to a substrate forming a substrate complex, but the substrate is unknown. For that reason it was only taken as a <b><i>“f<sub>post(p)</sub>”</i></b> variable the Zn<SUP>2+</SUP> binding because the data for finding the affinity between IrrE and the unknown substrate was not possible to determine.</p><br />
<br />
<p>It was not obtained the data fom the affinity between IrrE and Zn<SUP>2+</SUP> it was needed to find the data from homologous proteins. In fact, proteins with zinc binding domainswere found to have an affinity between 0.1 and 0.2 in <i>E. coli</i> (Vorackova, 2012). We used 0.15 as average in the equation for association constant which is defined as the following:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large Ka=\frac{\left [ C \right ]}{\left [ S \right ]\left [ E \right ]}<br />
\end{equation}<br><br />
<br />
<p>Where <b><i>“[C]”</i></b> is the complex formed, <b><i>“[S]”</i></b> is the substrate and <b><i>“[E]”</i></b> is the enzyme, ligand or ion. Substituting for IrrE it is expressed as below:</p><br><br />
<br />
\begin{equation}<br />
\large Ka=\frac{\left [ C \right ]}{\left [ IrrE \right ]\left [ Zn+ \right ]}0.15=\frac{\left [ C \right ]}{\left [ IrrE \right ]\left [ Zn+ \right ]}<br />
\end{equation}<br><br />
<br />
<p>With the association constant, Simbiology&reg; was used to model the functional IrrE production. The results were the following:</p><br />
<center><p><img width=400 height=400 src="https://static.igem.org/mediawiki/2014hs/c/c4/Grafico_simbiology_irre.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<br><br />
<center><img width=500 height=400 src="https://static.igem.org/mediawiki/2014hs/2/23/Functional_irre.png"<br />
align=center hspace=12 alt="IMG_0317"></center><br />
<br />
<br><br />
<p align: justify>When both graphs were compared, (<b>Graph 1</b> and <b>Graph 2</b>) it was concluded that not all the IrrE production was functional. In fact from the total amount produced (about 2400), only about 1700 are functional. So it demonstrates that the rate at which Zn<SUP>2+</SUP> ions binds to IrrE is slower than the rate at which IrrE is produced, leaving a nonfunctional IrrE.</p><br />
<br />
<br><p><b><h2>Bibliography/References</h2></b></p><br />
<br />
<font size="2"><br />
<p>● David Dibden, J. G. (2005). In vivo cycling of the Escherichia coli transcription factor FNR between active and inactive states. <i>Microbiology</i>, 4063-4070.</p><br />
<p>● Douglas Selinger, R. M. (2003). Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. <i>Genome Research</i>, 216-223.</p><br />
<p>● Vorackova Irena, S. S. (2011). Purification of proteins containing zinc finger domains using Immobilized Metal Ion Affinity Chromatography. <i>Protein Expression and Purification</i>, 88-95.</p><br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_resistance#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_aromaTeam:CIDEB-UANL Mexico/math aroma2014-06-18T14:57:11Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_math}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<!-- MathJax (LaTeX for the web) --><br />
<script type="text/x-mathjax-config"><br />
MathJax.Hub.Config({tex2jax: {inlineMath: [['$','$'], ['\\(','\\)']]}});<br />
MathJax.Hub.Config({<br />
TeX: { <br />
equationNumbers: { autoNumber: "AMS" }<br />
}<br />
});<br />
</script><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Aroma Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p>The aroma module is based in the production of SAM/salicylic acid methyltransferase (BSMT1) in order to generate methyl salicylate, leaving a physical evidence of wintergreen odor. Since this module is not affected by external factors during its transcription, the established formula of mRNA was used with their parameters, but with the data we obtained from BSMT1.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \frac{d\left [ mRNA \right ]}{dt}=\alpha_{1}-d_{1}\left [ mRNA \right ]<br />
\end{equation}<br />
<br />
<br><br />
<p>In the case of translation, a ribo-switch affects the production of the protein BSMT1. When the temperature reaches 32°C, the ribo-switch allows the translation of BSMT1 gene, but below 32&deg; C, the translation is not allowed.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large RBS\left\{\begin{matrix}<br />
T<32=0 & \\ <br />
T\geq 32=1& <br />
\end{matrix}\right.<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \frac{d[P]}{dt} = \alpha_{2} \cdot[mRNA] - d_{2}[P] - f_{post}\left\{\begin{matrix}<br />
T<32 \left\{\begin{matrix}<br />
\alpha_{2}=\frac{2400\cdot 0}{358}; R=0 & \\ <br />
No protein degradation& <br />
\end{matrix}\right. & \\ <br />
T\geq 32 \left\{\begin{matrix}<br />
\alpha_{2}\frac{2400}{358}=6.7& \\ <br />
d_{1}\frac{1}{40min}+ \frac{1}{30min}=0.058 & <br />
\end{matrix}\right.& <br />
\end{matrix}\right.<br />
\end{equation}<br />
<br />
<br><br />
<p>The parameters for translation and transcription rate from Singapore 2008 iGEM team were used, as well as the speeds at which <i>E. coli</i> carry out both, the transcription and the translation, assuming a transcription speed of <i>70nt/s</i> and a translation speed of <i>40aa/s</i>. These data were used in the equations below with the Wintergreen gene length being <i>1198nt</i> and the protein length being <i>358aa</i>:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \alpha_{1} = \frac{transcription speed}{gene length (nt)}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2} = \frac{translation speed}{protein length (aa)}<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{1} = \frac{(70)(60)}{1198} = 3.5<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large \alpha_{2} = \frac{(40)(60)}{358} = 6.7 <br />
\end{equation}<br><br />
<br />
<p>Then, the parameters for degradation rates for proteins and mRNAs from Beijing PKU 2009 iGEM team were used:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large d_{1} = \frac{1}{half-life} + \frac{1}{30} min<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large d_{2} = \frac{1}{half-life} + \frac{1}{30} min<br />
\end{equation}<br><br />
<br />
<p>Since the half-life of BSMT1 has not been determined by MIT Team 2006, an investigation was made and according to Zubieta (2003), the average half-life for salicylic acid methyltransferases are about 40min.</p><br />
<br />
<p>To determine the degradation rate of the average mRNA, the information from Selinger’s team (2003) was used. Several experiments to find the average mRNA half-life in <i>E. coli </i>were carried out. They used mRNAs of about <i>1100nt</i> length, leading to the conclusion that they have an average half-life of 5min.With this information, it could be determined that the average mRNA half-life of BSMT1 was 5.44min.:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large HL = \frac{1100(nt)}{5 min}<br />
\end{equation}<br><br />
<br />
<p>With all these information, the degradation rates for both, the transcription and the translation of BSMT1, could be calculated:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large d_{1} = \frac{1}{5.44} + \frac{1}{30} = 0.21<br />
\end{equation}<br><br />
<br />
\begin{equation}<br />
\large d_{2} = \frac{1}{40} + \frac{1}{30} = 0.058<br />
\end{equation}<br><br />
<br />
<p>Simbiology was used for the simulation. The previous data were used in the equations to find the amount of proteins <i>E. coli</i> would produce at certain times. The results are shown in the next graph: </p><br />
<br><br />
<br />
<br />
<center><p><img width=500 height=380 src="https://static.igem.org/mediawiki/2014hs/b/b4/Graph_wintergreen_1.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<p>For the translation, another factor was needed to be taken into consideration, the <b><i>“f<sub>post</sub>”</i></b>, which were the post-translational variables affecting the production of the functional protein.</p><br />
<br><br />
<br />
\begin{equation}<br />
\large \frac{d[P]}{dt} = \alpha_{2} \cdot[mRNA] - d_{2}[P] - f_{post}<br />
\end{equation}<br />
<br />
<br><br />
<p>During the research of information, it was found out that BSMT1 is a special type of enzyme called Michaelis-Menten enzyme. As BSMT1 will perform an enzymatic reaction, it was needed to know at which rate it will be carried on producing methyl salicylate (Zubieta 2003). For that reason, the post-translational function considers the rate of methyl salicylate production as the variable that directly affects the production of the final protein. The formula used was also called Michaelis-Menten Equation:</p><br />
<br><br />
<br />
\begin{equation}<br />
\large f_{post}=\frac{k_{cat}\left [ S \right ]\left [ E \right ]}{K_{m} + \left [ S \right ]}<br />
\end{equation}<br />
<br />
<br><p>Where: <b><i>“[S]”</i></b> means the substrate concentration; <b><i>“[E]”</i></b>, the enzyme concentration (obtained by the rest of the translational formula); <b><i>“K<sub>cat</sub>”</i></b>; is the turnover number; and <b><i>“K<sub>m</sub>”</i></b>, the substrate concentration needed to achieve a half-maximum enzyme velocity.</p><br />
<br />
<p>Zubieta et al. (2003) established <b><i>“K<sub>m</sub>”</i></b> and <b><i>“K<sub>cat</sub>”</i></b> values for SAM (BSMT1) of 23 and 0.092, respectively. All this values are used when a salicylic acid concentration of 2mM is induced. As <b><i>“[E]”</i></b> stands for enzyme concentration, the protein produced (by the rates of translation and degradation of the protein) will introduce this value in the equation. By substituting these values in the Michaelis-Menten Equation, it will change as follows:</p><br><br />
<br />
\begin{equation}<br />
\large f_{post}=\frac{k_{cat}\left [ S \right ]\left [ E \right ]}{K_{m} + \left [ S \right ]}=\frac{0.092\left ( 2mM \right )\left [ P \right ]}{23 + 2mM}<br />
\end{equation}<br />
<br />
<br><p>Also, this formula is used in order to get the maximum rate of methyl salicylate production. This value is given by the product of <b><i>“K<sub>cat</sub>”</i></b> times the substrate concentration <b><i>“[S]”</i></b>.</p><br><br />
<br />
\begin{equation}<br />
\large V_{max}=K_{cat}\cdot \left [ S \right ]=0.092\left ( 2mM \right )=0.184<br />
\end{equation}<br />
<br />
<br><br />
<p>The enzymatic rate were used in Simbiology to model the functional BSMT1 production. The results are shown in the next graphs:</p><br />
<br />
<center><p><img width=430 height=250 src="https://static.igem.org/mediawiki/2014hs/1/14/Diagram_wintergreen.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<center><p><img width=500 height=380 src="https://static.igem.org/mediawiki/2014hs/0/0a/Wintergreen_2_graph.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<br><br />
<p>With the analysis from both graphs (<b>Graph 1</b> and <b>Graph 2</b>) , it was established that the enzymatic reaction was too slow compared to the BSMT1 production, <strong>leaving almost ¼ nonfunctional of the total amount of proteins produced</strong>. It was assumed that the functional BSMT1 is the final product, which releases the Wintergreen odor and it would be relatively concentrated with the amount of proteins produced.</p><br />
<br />
<br><p><b><h2>Bibliography/References</h2></b></p><br />
<br />
<font size="2"><br />
<p>● David Dibden, J. G. (2005). In vivo cycling of the Escherichia coli transcription factor FNR between active and inactive states. <i>Microbiology</i>, 4063-4070.</p><br />
<p>● Douglas Selinger, R. M. (2003). Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. <i>Genome Research</i>, 216-223.</p><br />
<p>● Zubieta, C. (2003). Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family. <i>Plant Cell</i>, 1704-1716.</p><br><br />
<br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_aroma#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_overviewTeam:CIDEB-UANL Mexico/math overview2014-06-18T14:55:19Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_math}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<!-- MathJax (LaTeX for the web) --><br />
<script type="text/x-mathjax-config"><br />
MathJax.Hub.Config({tex2jax: {inlineMath: [['$','$'], ['\\(','\\)']]}});<br />
MathJax.Hub.Config({<br />
TeX: { <br />
equationNumbers: { autoNumber: "AMS" }<br />
}<br />
});<br />
</script><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Overview</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b><h2>When Biology meets Math</h2><br />
<p>&nbsp;</p><br />
</b>For iGEM projects, the use of mathematical models is necessary to predict the behavior of a biological machine, representing the quantitative relations between two or more variables involved in the function and expression of a gene or a set of genes in organisms like <i>E. coli</i>.<br />
<p>Our team decided to use a deterministic model to simulate and represent the function of the four modules, assuming that the variables (mRNA and protein concentrations) adopt a continuous behavior and obey kinetic rules that can be represented with constant values.</p><br />
<br />
<p>This type of mathematical model is used to include variables that considerate both, the gene expression and the physiological cycles (chemical process, transport of proteins, etc.). By the use of traditional differential equations we were able to construct the description and analyze the behavior of mRNAs and protein production. We were focused in determine through a mathematical model the ideal behavior of the four modules independently.<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture</a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">A</b>roma</a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance </a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union</a></p><br />
<br />
<p><b><h2>Deterministic Modelling: Equations and Parameters</h2></b></p><br />
<br />
<p>As it was previously stated, it was necessary to work with different equations, focused in the production and degradation rate of proteins, according to the length of the genes in each module. This was performed in order to obtain both, the concentration rates of mRNA and protein based on system (gene) length and protein length respectively.</p><br />
<br />
<br><p><b>Equations</b></p><br />
<br />
<p>● <b>mRNA</b><p><br />
<br />
<p>Generally, to describe the amount of mRNA produced over <i>t</i> time, the equation implemented is shown below:</p><br />
<br />
<br><br />
\begin{equation}<br />
\large \frac{d[mRNA]}{dt} = \alpha_{1} \cdot f_{y} - d_{1}[mRNA]<br />
\end{equation}<br><br />
<br />
<br><p>Where: <b><i>“&#945;<sub>1</sub>”</i></b> means the transcription rate of a given gene; <b><i>“f<sub>y</sub>”</i></b> represents a regulatory function (if there is) that can activate or inhibit the system; and <b><i>“d<sub>1 </sub> [mRNA]”</i></b> the degradation rate of the mRNA produced.</p><br />
<br />
<p>● <b>Protein</b><p><br />
<br />
<p>The same happens with the protein production, but differs in the formula because it also involves a post-translational variable:</p><br><br />
<br />
<br><br />
\begin{equation}<br />
\large \frac{d[P]}{dt} = \alpha_{2} \cdot[mRNA] - d_{2}[P] - f_{post}<br />
\end{equation}<br><br />
<br />
<br><p>Where: <b><i>“&#945;<sub>2 </sub> [mRNA]”</i></b> means the translation rate of a protein based on the amount of mRNA available; <b><i>“d<sub>2</sub>”[P]</i></b> represents the degradation rate of that protein; and <b><i>“f<sub>post</sub>"</i></b> the posttranslational variables which affect the production of the final (functional) protein.<p><br />
<br />
<br><p><b>Parameters</b></p><br />
<br />
<p>To determine both the transcription <b>(1)</b> and translation <b>(2)</b> rates, the parameters from Singapore 2008 iGEM team, at wich<i> E. coli</i> carries out transcription and translation were used ; as well as the degradation rates from Beijing PKU 2009. The parameters <i></i> from Singapore 2008 iGEM were used, assuming a transcription speed of <i>70nt/s</i> and a translation speed of <i>40aa/s</i>. The speeds were multiplied by 60, because minutes were used as units in the simulations of the modules. We assumed that <i>E. coli</i> division time was 30min based on PKU Beijing 2009 iGEM team.</p><br />
<br><br />
<br />
<br><br />
\begin{equation}<br />
\large \alpha_{1} = \frac{transcription speed}{gene length (nt)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{2} = \frac{translation speed}{protein length (aa)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{1} = \frac{70 \frac {nt}{s} \cdot(60)}{gene length (nt)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{2} = \frac{40 \frac {aa}{s} \cdot(60)}{protein length (aa)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{1} = \frac{1}{half-life} + \frac{1}{division time} min<br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{2} = \frac{1}{half-life} + \frac{1}{division time} min<br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{1} = \frac{1}{half-life} + \frac{1}{30} min<br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{2} = \frac{1}{half-life} + \frac{1}{30} min<br />
\end{equation}<br><br />
<br />
<br />
<p><b><br />
<h2>Bibliography/References</h2><br />
</b></p><br />
<br />
<font size="2"><br />
<p>● David Dibden, J. G. (2005). In vivo cycling of the Escherichia coli transcription factor FNR between active and inactive states. <i>Microbiology</i>, 4063-4070.</p><br />
<p>● Douglas Selinger, R. M. (2003). Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. <i>Genome Research</i>, 216-223.</p><br />
<p>● iGEM CIDEB UANL. (2012). <i>Modelling: Equations.</i> Retrieved from: <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico/Math-Equations"></a> </p><br />
<p>● James Hare, K. T. (1991). Mechanisms of plasma membrane protein degradation: Recycling proteins are degraded more rapidly than those confined to the cell surface. <i>PNAS</i>, 5902-5906.</p><br />
<p>● Martina Bergant, N. M. (2010). Modification of Human Papillomavirus Minor Capsid Protein L2 by Sumoylation <i>Journal of Virology</i>, 11585-11589.</p><br />
<p>● NTU Singapore. (2008). <i>Modelling: Parameters</i> Retrieved from: <a href="https://2008.igem.org/Team:NTU-Singapore/Modelling/Parameter">https://2008.igem.org/Team:NTU-Singapore/Modelling/Parameter</a></p><br />
<p>● PKU Beijing. (2009).<i>Modelling: Parameters.</i> Retrieved from: <a href="https://2009.igem.org/Team:PKU_Beijing/Modeling/Parameters">https://2009.igem.org/Team:PKU_Beijing/Modeling/Parameters</a></p><br />
<p>● Vorackova Irena, S. S. (2011). Purification of proteins containing zinc finger domains using Immobilized Metal Ion Affinity Chromatography. <i>Protein Expression and Purification</i>, 88-95</p><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_overview#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_overviewTeam:CIDEB-UANL Mexico/math overview2014-06-18T14:52:36Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_math}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<!-- MathJax (LaTeX for the web) --><br />
<script type="text/x-mathjax-config"><br />
MathJax.Hub.Config({tex2jax: {inlineMath: [['$','$'], ['\\(','\\)']]}});<br />
MathJax.Hub.Config({<br />
TeX: { <br />
equationNumbers: { autoNumber: "AMS" }<br />
}<br />
});<br />
</script><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Overview</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b><h2>When Biology meets Math</h2><br />
<p>&nbsp;</p><br />
</b>For iGEM projects, the use of mathematical models is necessary to predict the behavior of a biological machine, representing the quantitative relations between two or more variables involved in the function and expression of a gene or a set of genes in organisms like <i>E. coli</i>.<br />
<p>Our team decided to use a deterministic model to simulate and represent the function of the four modules, assuming that the variables (mRNA and protein concentrations) adopt a continuous behavior and obey kinetic rules that can be represented with constant values.</p><br />
<br />
<p>This type of mathematical model is used to include variables that considerate both, the gene expression and the physiological cycles (chemical process, transport of proteins, etc.). By the use of traditional differential equations we were able to construct the description and analyze the behavior of mRNAs and protein production. We were focused in determine through a mathematical model the ideal behavior of the four modules independently.<br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture</a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">A</b>roma</a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance">Resistance </a></p><p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union</a></p><br />
<br />
<p><b><h2>Deterministic Modelling: Equations and Parameters</h2></b></p><br />
<br />
<p>As it was previously stated, it was necessary to work with different equations, focused in the production and degradation rate of proteins, according to the length of the genes in each module. This was performed in order to obtain both, the concentration rates of mRNA and protein based on system (gene) length and protein length respectively.</p><br />
<br />
<br><p><b>Equations</b></p><br />
<br />
<p>● <b>mRNA</b><p><br />
<br />
<p>Generally, to describe the amount of mRNA produced over <i>t</i> time, the equation implemented is shown below:</p><br />
<br />
<br><br />
\begin{equation}<br />
\large \frac{d[mRNA]}{dt} = \alpha_{1} \cdot f_{y} - d_{1}[mRNA]<br />
\end{equation}<br><br />
<br />
<br><p>Where: <b><i>“&#945;<sub>1</sub>”</i></b> means the transcription rate of a given gene; <b><i>“f<sub>y</sub>”</i></b> represents a regulatory function (if there is) that can activate or inhibit the system; and <b><i>“d<sub>1 </sub> [mRNA]”</i></b> the degradation rate of the mRNA produced.</p><br />
<br />
<p>● <b>Protein</b><p><br />
<br />
<p>The same happens with the protein production, but differs in the formula because it also involves a post-translational variable:</p><br><br />
<br />
<br><br />
\begin{equation}<br />
\large \frac{d[P]}{dt} = \alpha_{2} \cdot[mRNA] - d_{2}[P] - f_{post}<br />
\end{equation}<br><br />
<br />
<br><p>Where: <b><i>“&#945;<sub>2 </sub> [mRNA]”</i></b> means the translation rate of a protein based on the amount of mRNA available; <b><i>“d<sub>2</sub>”[P]</i></b> represents the degradation rate of that protein; and <b><i>“f<sub>post</sub>"</i></b> the posttranslational variables which affect the production of the final (functional) protein.<p><br />
<br />
<br><p><b>Parameters</b></p><br />
<br />
<p>To determine both the transcription <b>(1)</b> and translation <b>(2)</b> rates, the parameters from Singapore 2008 iGEM team, at wich<i> E. coli</i> carries out transcription and translation were used ; as well as the degradation rates from Beijing PKU 2009. The parameters <i></i> from Singapore 2008 iGEM were used, assuming a transcription speed of <i>70nt/s</i> and a translation speed of <i>40aa/s</i>. The speeds were multiplied by 60, because minutes were used as units in the simulations of the modules. We assumed that <i>E. coli</i> division time was 30min based on PKU Beijing 2009 iGEM team.</p><br />
<br><br />
<br />
<br><br />
\begin{equation}<br />
\large \alpha_{1} = \frac{transcription speed}{gene length (nt)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{2} = \frac{translation speed}{protein length (aa)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{1} = \frac{70 \frac {nt}{s} \cdot(60)}{gene length (nt)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large \alpha_{2} = \frac{40 \frac {aa}{s} \cdot(60)}{protein length (aa)}<br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{1} = \frac{1}{half-life} + \frac{1}{division time} min<br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{2} = \frac{1}{half-life} + \frac{1}{division time} min<br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{1} = \frac{1}{half-life} + \frac{1}{30} min<br />
\end{equation}<br><br />
\begin{equation}<br />
\large d_{2} = \frac{1}{half-life} + \frac{1}{30} min<br />
\end{equation}<br><br />
<br />
<br />
<p><b><br />
<h2>Bibliography/References</h2><br />
</b></p><br />
<br />
<font size="2"><br />
<p>● David Dibden, J. G. (2005). In vivo cycling of the Escherichia coli transcription factor FNR between active and inactive states. <i>Microbiology</i>, 4063-4070.</p><br />
<p>● Douglas Selinger, R. M. (2003). Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. <i>Genome Research</i>, 216-223.</p><br />
<p>● iGEM CIDEB UANL. (2012). <i>Modelling: Equations.</i> Retrieved from: <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico/Math-Equations"></a> </p><br />
<p>● James Hare, K. T. (1991). Mechanisms of plasma membrane protein degradation: Recycling proteins are degraded more rapidly than those confined to the cell surface. <i>PNAS</i>, 5902-5906.</p><br />
<p>● Martina Bergant, N. M. (2010). Modification of Human Papillomavirus Minor Capsid Protein L2 by Sumoylation <i>Journal of Virology</i>, 11585-11589.</p><br />
<p>● NTU Singapore. (2008). <i>Modelling: Parameters</i> Retrieved from: <a href="https://2008.igem.org/Team:NTU-Singapore/Modelling/Parameter">https://2008.igem.org/Team:NTU-Singapore/Modelling/Parameter</p><br />
<p>● PKU Beijing. (2009).<i>Modelling: Parameters.</i> Retrieved from: https://2009.igem.org/Team:PKU_Beijing/Modeling/Parameters</p><br />
<p>● Vorackova Irena, S. S. (2011). Purification of proteins containing zinc finger domains using Immobilized Metal Ion Affinity Chromatography. <i>Protein Expression and Purification</i>, 88-95</p><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/math_overview#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_discussionsTeam:CIDEB-UANL Mexico/labwork discussions2014-06-18T14:38:07Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_labwork}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Results Interpretation</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p> Here is the interpretation of the results that were obtained on all the experiments</p><br />
<br />
<p><b><a name="CaptureInt"></a><h2>Capture module - <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#Ligation"><font size="2" color="blue"> [Go to Results]</font></h2> </a> </b></p><br />
<br />
<p><b>Ligation of NhaS and pSB1C3</b></p><br />
<br />
<p>The ligation transformed in <i>E. coli</i> of the NhaS module produced red and white colonies when we expected only red colonies (bacteria expressing the RFP). We did not know the reason of the unexpected result so we designed an experiment with the UV light promoter. </p><p><br />
The NhaS module was proved in the experiment with the Petri Dishes in the UV camera. The red bacteria was already red (meaning that the RFP expression already started) before being exposed to the UV camera at 302nm. The promoter <a href = http://parts.igem.org/Part:BBa_I765001> pUV 1765001</a> is activated by the UV exposition under 360 nm as the iGEM team Colombia_Israel 2007 reported. (iGEM Colombia_Isreal, 2006) The UV promoter does not have a reported wavelength interval.<br />
The unexpected result obtained can mean that the promoter is so sensible to the UV light that the normal UV radiation is enough to activate it without the need of being exposed to the UV camera. In the normal light the UV rays are present in different ammount as it is presented in the Global Solar UV Index publication. (World Health Organization, 2002)<br />
<br />
In the part description is reported that the UV promoter gets active and the protein must be expressed after 10 minutes of exposure in the UV camera, but after 2 hours there was no change in the white colonies so the RFP was not expressed there. </p><br />
<br />
<p><br />
After doing the experiment we obtained that the red colonies continued with the RFP expression and the white colonies did not changed in color. As we expected to activate the RFP expression in the white colonies, this means that the time of the exposure was not enough to activate the UV promoter or the promoter did not worked in the conditions we thought it would work. To see if the promoter was already activated we did another experiment. </p><p><br />
The experiment with NaCl in different concentrations in Petri Dishes showed that the bacteria grew in a medium with high NaCl concentration. The control group with non-modified bacteria did not grow because it did not contain the Nhas insert so it was not able to survive in a saline medium. The white bacteria did actually grow but they did not expressed the RFP, but the fact that they did grow means that they have the NaCl resistance and the insert is inside them. </p><p><br />
As the white and red colonies are supposed to come from the same ligation and to contain the same genetic information we need to prove that the insert was inside them. In order to prove this we sent samples of DNA to be sequenced to the DNA Synthesis and Sequentiation Biotechnology Institute Unit (USSDNA in Spanish), from the UNAM. </p><p><br />
The primer used was in the complementary reverse chain, so the sequences are in the 3’ to 5’ direction. We did an analysis of the sequences obtained by aligning them with the <a href=”http://blast.ncbi.nlm.nih.gov/Blast.cgi”>BLAST Software</a>.</p><br />
<p><b>The RFP sequence used in the alignment was the following (in 5' to 3' direction):</b> </p><br />
<pre><br />
Atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaa<br />
cggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaac<br />
tgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggt<br />
tccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggttt<br />
caaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgc<br />
aagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatg<br />
cagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaagg<br />
tgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctaca<br />
tggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccac<br />
aacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaata<br />
acgctgatagtgctagtgtagatcgctaa</pre><br />
<p><br />
It was aligned with the sequences obtained from the samples Nhas white bacteria and Nhas red bacteria. </p><br />
<p><b>NhaS sequence from white colonies (in 3' to 5' direction of the complementary reverse)</b></p><br />
<pre><br />
TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGA<br />
ACCTGCATAACGCGAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTT<br />
TTTGCCGGACTGCAGCGGCCGCTACTAGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCA<br />
CCGGTGGAGTGACTACCTTCAGCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGT<br />
GATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTTTTAGCCATGTAGGTGG<br />
TTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGA<br />
GCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGG <br />
ACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGG<br />
AGTCCTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCC<br />
GGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCCGGGTGTTTAACGTAAGCTTTGGAACCGTACTG<br />
GAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTTCAGTTTAGCGG<br />
TCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTTAACGGA<br />
ACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTT<br />
CGCTTACAAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTA<br />
TCGGTTTTGCCATGCAGATTCCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGT<br />
CCGCAAAATGTGTAA</pre><p><br />
<b>NhaS sequence from red colonies (in 3' to 5' direction of the complementary reverse)</b></p><br />
<pre><br />
AAAGTGTCCACCCCGTACGACCGAGCGGAGCGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTA<br />
ATCTTTTCGGCTTAAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGC<br />
CGCTACTAGTATATAAACGCAGAAAGGCCCACCCGAAGGTGAGCCAGTGTGACTCTAGTAGAGAGCGT<br />
TCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGATGC<br />
CTGGCTCTAGTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACGACCTTCA<br />
GCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGT<br />
TTTGTAAGCACCCGGCAGCTGAACCGGTTTTTTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGT<br />
GACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGAGCACCGTCTTCCGGGTACATA<br />
CGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGACGGGAAGTTGGT<br />
ACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAA<br />
CACCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAG<br />
TCCGGGATGTCAGCCGGGTGTTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGAACAGGATG<br />
TCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTTCAGTTTAGCGGTCTCGGGTACCTTCGAACG<br />
GACGACCTTCACCTTCACCCTTCAATTTTCAAACTCGTGACCGTAAACGGAACCTTTCCATACAACTT<br />
TGAAAACGCATGAAACTCATTTGAATAACGTCTTCCGGAAGAAAGCCCAATCTAAGTATTTTCTCCCT<br />
CTTTTCTCATATAAATGTGATGAATATTTGATCTATCCGCCCTCCAACAACTTTCCCACAACAATCAT<br />
GTATCGAAATTCCTGTTATACGACACTATAAAGATGGTATAAAAAGCCCGTGGAGGGGGCGTGACCA</pre><br />
<b>Report</b></p><p><br />
The report obtained from the analysis with the NhaS in red colonies is the following: </p><p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/6/6d/DISCUSSIONIGEMCIDEB2014.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
The RFP original sequence has a length of 709 bp. The match started at position 3 and ended at position 708, this means that almost all the RFP is present in the sample sequenced as we expected because the colonies were red. </p><p><br />
<b>The report obtained from the analysis with the NhaS in white colonies is the following: </b></p><p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/7/7e/DISCUSSIONIGEMCIDEB20142.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
The match ends at the 709 position from the original RFP sequence, but it did not star from the position 1 or 3, it starts at position 50. This means that there are 49 nucleotides that did not match with the original RFP sequence. This can be a possible cause in the problem with the RFP expression in white colonies, a mutation in the region of the RFP. </p><p><br />
<b>We also made an analysis with the Ribosome Binding Site (RBS) sequence:</b> </p><p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/5/52/DISCUSSIONIGEMCIDEB20143.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center> <br />
In the red colonies there where two matches, which is the complete sequence but in two parts: from 1 to 7 and from 6 to 12 positions. In the white colonies there was only one match, this means that the RBS sequence was not found there. If the RBS previous to the RFP has a problem, the mRNA cannot bind in the ribosome, and is not able to be translated. </p><br />
<center><img width=500 src="https://static.igem.org/mediawiki/2014hs/f/f1/Mutationigemcideb2014.png"<br />
align=center hspace=12></center><br />
<p><br />
With these results we can infer that the BioBrick works find and expresses the NhaS (because both of them survive in a high NaCl concentrated medium) but it stops being translated in the RBS or in the RFP region causing the colonies to be white instead of red but being able to survive in a medium with high NaCl concentration.</p><br />
<p><br />
The question is if the problem is caused by a mutation, When did it happen?</p><br />
<p><br />
The ligation transformed contained a DNA obtained from a digestion done the May 16th in the 3rd week registered in the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_notebook">Notebook</a>. This digestion was exposed to the UV light camera at 302nm for about 5 minutes. After the digestion it was ligated and purified. Later it was transformed in <i>E. coli</i>. The chance of occurring a mutation of this insert was 1) before the miniPrep, inside the cell or 2) due to the UV radiation after the transformation. The UV radiation at 312nm can cause a damage in the DNA sample and to reduce the succes in transormation in <i>E. coli</i> (Gründemann, 1996). There are also several types of mutagenesis due to the UV radiation inside the cell (Ikehata & Ono, 2011) that can have occurred before the transformation to some samples of the plasmid. The red bacteria had the original DNA and the white bacteria had the mutated DNA.</p><br />
</br><br />
<div style="text-align: left;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_discussions#"><font color="blue">Return to the Top</font></a></p></div><br />
<br><br />
<br><br />
<br />
<p><h2><a name="AromaInt"></a><b>Aroma module - </b><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_results#AromaRe1"><font size="2" color="blue">[Go to Results]</font></a> </h2></p><br />
<br />
<p><b>Qualitative experiment</b></p><br />
<p>People had different opinions while smelling the different Petri dishes with the aroma transformed bacteria. All of them used different words but at the end most of them remitted to the same meaning. The MIT team documented that the odor was produced when it was added 2mM of salicylic acid, so it was expected that the Petri dishes did not smell so much, but the results indicated that there was a mayor odor at 10mM than at 2mM (experiment previously done).</p><br />
<p>In the samples of 20 mM, both of the bacteria that was grown under 32 ºC had a little smell, which in theory, should not had happened because the riboswitch should be a loop at that temperature. One posible explanation is that the riboswitch is very sensitive to heat, and it could be activated during the time in which the Petri dishes were outside the incubator to perform the experiment and with the heat of the hands of the people who smelled it.</p><br />
<p>Finally, all of the samples that had a concentration of 30 mM of salicylic acid smelled like rotten food. By this, it can be inferred that all the bacteria in the Petri Dishes could not withstand the condition that particular concentration of salicylic acid, therefore they died, because “growth in a subinhibitory concentration of salicylic acid resulted in a significant reduction in the number of bacterial cells and a reduction in the rate of the number of bacteria increasing during logarithmic growth” (Bandara MB, et. al. 2006)</p><br />
</br><br />
<div style="text-align: left;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_discussions#"><font color="blue">Return to the Top</font></a></p></div><br />
<br><br />
<br><p><b><h2>Bibliography/References</h2></b></p><br />
<br />
<font size="2"><br />
<p>● Bandara MB, et al. (2006, October). Salicylic acid reduces the product... [Invest Ophthalmol Vis Sci. 2006] - PubMed <br />
<p>● Gründemann, D., & Schömig, E. (1996) Protection of DNA during preparative agarose gel electrophoresis against damage induced by ultraviolet light. <i>Biotechniques</i>, 21, 898-903.</p><br />
<p>● Ikehata, H., & Ono, T. (2011) The Mechanisms of UV Mutagenesis. <i>Journal of Radiation Research</i>, <i>52</i>, 115-125.</p><br />
<p>● Health Organization. (2002, January 1). Global Solar UV Index: A Practical Guide. Retrieved , from <a href="http://www.who.int/uv/publications/en/GlobalUVI.pdf">http://www.who.int/uv/publications/en/GlobalUVI.pdf</a> </p><br />
<p>● iGEM Colombian Team 2007 (2007, October 26). <i>Part:BBa I765001</i>. Retrieved June 15, 2014, from <a href"=http://parts.igem.org/Part:BBa_I765001">http://parts.igem.org/Part:BBa_I765001</a></p><br />
<p>● iGEM Colombian Team 2006 (2006). <i>A Microbial Biosensor Device for Iron Detection under UV irradiation</i>. Retrieved June 15, 2014, from <a href="https://2007.igem.org/wiki/index.php/IGEM_2006_Project">https://2007.igem.org/wiki/index.php/IGEM_2006_Project</a></p><br />
<p>● NCBI. Retrieved June 13, 2014, from <a href="http://www.ncbi.nlm.nih.gov/pubmed/17003439">http://www.ncbi.nlm.nih.gov/pubmed/17003439</a></p><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_discussions#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piffhttp://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_unionTeam:CIDEB-UANL Mexico/project union2014-06-18T14:33:01Z<p>Piff: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}{{:Team:CIDEB-UANL_Mexico/menu_project}}<html xmlns="http://www.w3.org/1999/xhtml"><head><meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><title>iGEM CIDEB 2014 - Project</title><style>body{margin: 0px; width: 100%;padding: 0px;background: #2056ac;font-family: 'Oxygen', sans-serif;font-size: 12pt;background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);}h1, h2, h3{margin: 0;padding-bottom: 5px;color: #404040;}p, ol, ul{margin-top: 0;}ol, ul{padding: 0;list-style: none;}p{line-height: 1.60em;padding- right: 3em;}strong{}a{color: #2056ac;}a:hover{text-decoration: none;}.container{margin: 0px auto;width: 1200px;}.container-text{margin: 0px auto;width: 75%;padding: 0px;font-family: 'Oxygen', sans-serif;font-size: 12pt; text-align: justify;}.wrapper{overflow: hidden;padding: 0em 0em 1em 0em;background: #FFF;}#wrapper1{background: #FFF;}#wrapper2{overflow: hidden;background: #F3F3F3;padding: 5em 0em;text-align: center;}#wrapper3{overflow: hidden;padding: 0em 0em 0em 0em;background: #FFF;}#wrapper4{}#banner{padding-top: 2em;}#welcome{overflow: hidden;width: 1000px;padding: 0em 100px 0em 100px;text-align: center;}#welcome .content{padding: 0em 8em;}#welcome .title h2{}#welcome a,#welcome strong{}.title{margin-bottom: 1em;}.title h2{font-size: 2em;}.title .byline{font-size: 1.1em;color: #6F6F6F#;}#three-column{overflow: hidden;margin-top: 5em;padding-top: 1em;border-top: 1px solid rgba(0,0,0,0.2);text-align: center;}#three-column h2{margin: 1em 0em;font-size: 1.5em;font-weight: 700;}#three-column .icon{position: relative;display: block;margin: 0px auto 0.80em auto;background: none;line-height: 150px;font-size: 4em;width: 150px;height: 100px;border-radius: 100px;border: 6px solid #67128F;text-align: center;color: #FFF;}#three-column #tbox1,#three-column #tbox2,#three-column #tbox3{float: left;width: 320px;padding: 30px 40px 50px 40px;}#three-column .title{text-align: center;}#three-column .title h2{font-size: 1.60em;}#three-column .title .byline{padding-top: 0.50em;font-size: 0.90em;color: #858585;}#three-column .arrow-down{border-top-color: #292929;}ul.tools{margin: 0;padding: 0em 0em 0em 0em;list-style: none;}ul.tools li{display: inline-block;padding: 0em .2em;font-size: 4em;}ul.tools li span{display: none;margin: 0;padding: 0;}ul.tools li a{color: #FFF;}ul.tools li a:before{display: inline-block;background: #1ABC9C;width: 120px;height: 120px;border-radius: 50%;line-height: 120px;text-align: center;color: #FFFFFF;}.button{display: inline-block;margin-top: 2em;padding: 0.8em 2em;background: #64ABD1;line-height: 1.8em;letter-spacing: 1px;text-decoration: none;font-size: 1em;color: #FFF;}.button:before{display: inline-block;background: #8DCB89;margin-right: 1em;width: 40px;height: 40px;line-height: 40px;border-radius: 20px;text-align: center;color: #272925;}.button-small{}#portfolio{overflow: hidden;padding-top: 5em;border-top: 1px solid rgba(0,0,0,0.2);}#portfolio .box{text-align: center;color: rgba(0,0,0,0.5);}#portfolio h3{display: block;padding-bottom: 1em;font-size: 1em;color: rgba(0,0,0,0.6);}#portfolio .title{text-align: center;}#portfolio .title h2{color: rgba(0,0,0,0.8);}.column1,.column2,.column3,.column4{width: 282px;}.column1,.column2,.column3{float: left;margin-right: 24px;}.column4{float: right;}</style><body><div class="wrapper"><div id="welcome" class="container"> <div class="title"> <h2>Union Module</h2> </div></div><div class="container-text"><table width=100%><tr><td><p><i>E. coli</i> needs to resist saline environments, UV rays and temperature changes in order to capture Na<SUP>+</SUP> ions, and produce an aroma as a reporter, everything in the water. But after <i>E. coli</i> performs its tasks, it is necessary to remove it from the water in order to obtain usable water; it was easy to do it through a biofilter.</p><p>We chose silica as the material for our biofilter, so that <i>E. coli</i> expressed a membrane protein which could have the ability for binding silica, and in that way remove <i>E. coli</i> from the water. This was possible for the circuit created by <a href="https://2012hs.igem.org/Team:CIDEB-UANL_Mexico">UANL Mexico 2012</a> team; they created a circuit to make <i>E. coli</i> attached to silica, but as they did not proved it, we want to determine if it really works or not.</p></td><td style="padding-left:12px;"><img width=154 height=133 src="https://static.igem.org/mediawiki/2014hs/c/cf/Logo_silica.png"/></td></tr></table><br><p><b>How is the Union module composed?</b></p><p>Initially, L2+AIDA and IrrE, protein for giving resistance to <i>E. coli</i> to adverse conditions (resistance module [link]), were joined together in only one circuit, but we needed to separate them because L2+AIDA has not been proved yet and it could affect the correct production of IrrE (see figure 1) as well as for testing each module alone.</p><center><p><img width=463 height=301 src="https://static.igem.org/mediawiki/2014hs/0/05/Circuit_l2_and_irre.png"align=center hspace=12 alt="IMG_0317"></p></center><center><p><b>Figure 1.</b> Circuit for our project and for testing resistance and union modules</p></center><p>The union circuit consists mainly in a fusion protein (a set which includes the CDS L2 with its peptide signal and AIDA) in order to make the protein for binding silica, a membrane protein. In that way <i>E. coli</i> would attach to silica.</p><center><p><img width=463 height=101 src="https://static.igem.org/mediawiki/2014hs/9/92/Composicion_silica.png"align=center hspace=12 alt="IMG_0317"></p></center><center><p><b>Figure 2.</b> Union circuit</p></center><br><p><b>How does L2 and AIDA act together?</b></p><p>The gene L2 encodes for a protein able to attach to silica. Taniguchi et al. reported in 2007 that the L2 ribosomal protein from <i>E. coli</i> strongly adsorbs to silica surfaces, up to 200 times tighter than poliarginine tags commonly used for protein purification. In their work, Taniguchiet al. 2007, constructed a fusion protein of L2 and green fluorescent protein (GFP) which adsorbed to a silica surface even after washing for 24 hours with a buffer containing 1 M NaCl (<b>Figure 3</b>). <a href="https://2012hs.igem.org/Team:CIDEB-UANL_Mexico">UANL Mexico 2012</a> did not have this piece in stock, so we decided to synthetize L2.</p><center><p><img width=237 height=140 src="https://static.igem.org/mediawiki/2014hs/0/05/Silica_washed.png"align=center hspace=12 alt="IMG_0317"></p><p><b>Figure 3.</b> Proteins absorbed to a silica slide and washed for 24 hours a)GFP b) L2-GFP fusion c) R9-GFP fusion. Taken from Taniguchi (2007)</p></center><br><p>AIDA-I is an <i>E. coli</i> membrane protein with a passenger domain of 76 kDa exposed to the extracellular space and a transmembrane beta-barrel domain of 45 kDa; the latter has been used to express functional proteins in the cell-membrane of up to 65 kDa (van Bloois et al., 2011). Furthermore passengers coupled to AIDA-I have been reported to reach an expression level of more than 100,000 copies per cell in the outer membrane (Jose and Meyer, 2007). AIDA-1 allows the expression of proteins larger than small peptides in the outer membrane what makes it the best option to use with L2. AIDA-I was obtained by PCR for <a href="https://2012hs.igem.org/Team:CIDEB-UANL_Mexico">UANL Mexico 2012</a>, so we use their piece for our project.</p><center><p><img width=226 height=251 src="https://static.igem.org/mediawiki/2014hs/a/a2/Aida_system.png"align=center hspace=12 alt="IMG_0317"></p><p><b>Figure 4.</b> Schematic representation of AIDA-I carrier protein</p></center><br><p><b>How important to use BgIII and BamHI to link L2 and AIDA-I?</b></p><p>As we need to join both proteins in order to make a fusion protein we cannot use SpeI and XbaI to join them because the reading frame would change making a completely different protein. So in order to avoid such problem we use BgIII and BamHI instead which can join AIDA and L2 without changing the reading frame. The scar produced between BamHI and BgIII, as is shown in the figure 3, is formed by six bases respecting the reading frame from both proteins in order to synthetize the correct protein.</p><br><center><p><img width=397 height=222 src="https://static.igem.org/mediawiki/2014hs/b/b5/Bg_y_bam_III.png"align=center hspace=12 alt="IMG_0317"></p><p><b>Figure 5.</b> Example of a ligation using BamHI and BgIII</p></center><p><b>How to know if <i>E.coli</i> binds to silica?</b></p><p>We will use a silica biofilter to remove <i>E. coli</i> from water, but in order to observe if really <i>E. coli</i> would attach to it we wanted to use a Wintergreen aroma as reporter. This would lead us know if the bacteria are in the biofilter by adding salicylic acid and changing the temperature; but as we will test this module alone we needed to design a new way to observe if L2+AIDA works. We decided to transform <i>E. coli</i> with two plasmids, one with RFP and the other containing the fusion protein (<b>figure 7</b>); if the biofilter becomes red it would mean <i>E. coli</i> is attached to it.</p><center><p><img width=401 height=243 src="https://static.igem.org/mediawiki/2014hs/c/c3/E.COLI_RFP.png"align=center hspace=12 alt="IMG_0317"></p><p><b>Figure 6.</b> <i>E. coli</i> containing the fusion (L2+AIDA) and RFP proteins</p></center><br><p><b>How to create a biofilter?</b></p><p>Although <i>E. coli</i> could acquire the ability for binding silica, we need to create a biofilter to remove bacteria from water. Our proposal as biofilter is shown in the next figure:</p><center><p><img width=236 height=346 src="https://static.igem.org/mediawiki/2014hs/e/e2/Biofiltro.png"align=center hspace=12 alt="IMG_0317"></p></center><center><p><b>Figure 7.</b> Our proposed biofilter model</p></center> <p><b>Parts of the module</b></p><br><center><div><table border=0 cellspacing=0 cellpadding=0 width=700 style='width:441.4pt;margin-left:25.5pt;border-collapse: collapse;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh: .5pt solid windowtext;mso-border-insidev:.5pt solid windowtext'> <tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes'> <td width=120 valign=top style='width:89.95pt;border:none;border-bottom:solid #AE78D6 1.0pt; mso-border-bottom-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:517'><b style='mso-bidi-font-weight: normal'><span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font:major-fareast; mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font:major-bidi; mso-bidi-font-style:italic'>IMAGE<o:p></o:p></span></b></p> </td> <td width=122 valign=top style='width:91.85pt;border:none;border-bottom:solid #934BC9 1.0pt; mso-border-bottom-alt:solid #934BC9 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b style='mso-bidi-font-weight: normal'><span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font:major-fareast; mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font:major-bidi; mso-bidi-font-style:italic'>CODE<o:p></o:p></span></b></p> </td> <td width=346 valign=top style='width:259.6pt;border:none;border-bottom:solid #AE78D6 1.0pt; mso-border-bottom-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal;tab-stops:85.15pt center 130.35pt;mso-yfti-cnfc:1'><b style='mso-bidi-font-weight:normal'><span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font: major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font: major-bidi;mso-bidi-font-style:italic'><span style='mso-tab-count:2'> </span>DESCRIPTION<o:p></o:p></span></b></p> </td> </tr> <tr style='mso-yfti-irow:0'> <td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #AE78D6 .5pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape id="_x0000_s1062" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:11.6pt;margin-top:3.55pt;width:54.05pt;height:41.3pt; z-index:251671552;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image013.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1062" DrawAspect="Content" ObjectID="_1464162125"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=72 height=55 src="https://static.igem.org/mediawiki/2014hs/e/e0/PromoterCIDEB.jpg" align=left hspace=12 v:shapes="_x0000_s1062"><![endif]><span style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:major-fareast;mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:major-bidi;mso-ansi-language:EN-US;mso-bidi-font-style: italic'><o:p></o:p></span></p></td> <td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #934BC9 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #934BC9 .5pt; background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_J23119">BBa_J23119</a></span><span style='font-size:7.0pt;mso-bidi-font-size:12.0pt;font-family:Oxygen; color:red;mso-ansi-language:EN-US'> </span></p> </td> <td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen'>The J23119 is the most effective and common constitutive promoter used. It has a length of 35bp.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:1'> <td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape id="Picture_x0020_11" o:spid="_x0000_s1067" type="#_x0000_t75" style='position:absolute; left:0;text-align:left;margin-left:12.55pt;margin-top:1.55pt;width:52.6pt; height:49.9pt;z-index:251669504;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image015.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=70 height=67 src="https://static.igem.org/mediawiki/2014hs/3/30/CDSCIDEB.jpg" align=left hspace=12 v:shapes="Picture_x0020_11"><![endif]></p></td> <td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #934BC9 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;mso-border-bottom-alt:solid #934BC9 .5pt; padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa%C2%AD_B0034">BBa_B0034</a></span></p> </td> <td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen'>This specific RBS is based on Elowitz repressilator. It has a length of 12bp.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:2'> <td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape id="_x0000_s1063" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:8.4pt;margin-top:2.55pt;width:52.8pt;height:39.05pt; z-index:251673600;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image017.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1063" DrawAspect="Content" ObjectID="_1464162126"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=70 height=52 src="https://static.igem.org/mediawiki/2014hs/5/54/CDS2CIDEB.jpg" align=left hspace=12 v:shapes="_x0000_s1063"><![endif]></p> </td> <td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #934BC9 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #934BC9 .5pt; background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888000">BBa_K888000</a></span></p> </td> <td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'>L2. This CDS gives the property for binding silica and glass surfaces to <i>E. coli</i>, it has a length of 819 bp.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:3'> <td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape id="_x0000_s1064" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:8.65pt;margin-top:2.15pt;width:52.55pt;height:40.65pt; z-index:251675648;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image019.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1064" DrawAspect="Content" ObjectID="_1464162127"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=70 height=54 src="https://static.igem.org/mediawiki/2014hs/f/f2/CDS3CIDEB.jpg" align=left hspace=12 v:shapes="_x0000_s1064"><i><span style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:major-fareast;mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:major-bidi;mso-ansi-language:EN-US'> <o:p></o:p></span></i></p> </td> <td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888001">BBa_K888001 </a></span></p> </td> <td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen'>AIDA-I is synthetized as a 132 kDa pre-protein featuring a signal peptide which is cleaved during transport trough the inner membrane, a 78 kDa adhesin (passenger) domain, and a 45 kDa translocator. This autotransporter has a large capability in translocating relatively large passengers from 12-65 kDa by showing a N-terminal type of fusion. Coupled with a passenger domain and a signal peptide (<a href="http://parts.igem.org/Part:BBa_K888005">K888005</a>), it is possible to express functional proteins in the outer membrane of <i>E. coli</i>.<span style='mso-spacerun:yes'> </span>It has a length of 1482 bp.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:4;height:122.1pt'> <td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:122.1pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'>&nbsp;</p> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape id="_x0000_s1065" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:9.8pt;margin-top:3.6pt;width:50.05pt;height:38.05pt; z-index:251677696;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image021.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1065" DrawAspect="Content" ObjectID="_1464162128"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=67 height=51 src="https://static.igem.org/mediawiki/2014hs/d/d5/CIDEBCDS5.jpg" align=left hspace=12 v:shapes="_x0000_s1065"><![endif]><i><span style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font: major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font: major-bidi;mso-ansi-language:EN-US'><o:p></o:p></span></i></p> </td> <td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt; height:122.1pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888005">BBa_K888005</a> </span></p> </td> <td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt; height:122.1pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen'>When this part is coupled with a passenger attached to AIDA-I translocator domain (<a href="http://parts.igem.org/Part:BBa_K888005">K888001</a>), it is possible to express functional proteins in the outer membrane of <i>E. coli</i>. The signal peptide is naturally cleaved during transport trough the inner membrane (Li et al. 2007; van Bloois et al. 2011).It has a length of 147 bp.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:5;mso-yfti-lastrow:yes;height:51.65pt'> <td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt; mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape id="_x0000_s1066" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:17.8pt;margin-top:3.2pt;width:32.25pt;height:44.6pt; z-index:251679744;mso-position-horizontal-relative:text; mso-position-vertical-relative:text;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image023.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1066" DrawAspect="Content" ObjectID="_1464162130"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=43 height=59 src="https://static.igem.org/mediawiki/2014hs/d/d7/STOP.jpg" align=left hspace=12 v:shapes="_x0000_s1066"><![endif]><i><span style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font: major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font: major-bidi;mso-ansi-language:EN-US'> <o:p></o:p></span></i></p> </td> <td width=122 valign=top style='width:91.85pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_B1002">BBa_B1002</a></span></p> </td> <td width=346 valign=top style='width:259.6pt;border-top:none;border-left: none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt; mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt; mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><span style='font-size:12.0pt;font-family:Oxygen; mso-ansi-language:EN-US'>Part made of 6bp, responsible for stopping transcription.<o:p></o:p></span></p> </td> </tr></table></div></center><br><p><b>Other teams that used it:</b></p><p><b><a href="https://2012hs.igem.org/Team:CIDEB-UANL_Mexico">UANL México 2012</a>:</b> They proposed the fusion protein for using it to binding silica after detect and capture arsenic acid in groundwater, and in that way removed the pollutant arsenic acid from the water, as part of water bioremediation, but they did not finish it. That is why we want to determine if it will work.</p><p><h2><b>Union Module Zoom In</b></h2></p></br><center><iframe width="640" height="390" src="//www.youtube.com/embed/PC6pQ6gfT9A" frameborder="0" allowfullscreen></iframe></center><br><p><b><h2>Bibliography/References</h2></b></p><font size="2"><p>● Antiquity. (2003). <i>Part:BBa_B0034</i>. Retrieved March 30th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034">http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034</a>.</p><p>● iGEM2006_Berkeley. (2006). <i>Part:BBa_J23119</i>. Retrieved April 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119">http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119</a>.</p><p>● iGEM12_UANL_Mty-Mexico. (2012). <i>Part BBa_K888000</i>. Retrieved March 29th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888000">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888000</a>.</p> <p>● iGEM12_UANL_Mty-Mexico. (2012). <i>Part BBa_K888001</i>. Retrieved March 29th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888001">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888001</a>.</p> <p>● iGEM12_UANL_Mty-Mexico. (2012) <i>Part BBa_K888005</i>. Retrieved March 29th,2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888005">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888005</a>.</p> <p>● UANL Mexico. (2012). <i>Recovery module</i>. Retrieved March 28th,2014, from <a href="https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery">https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery</a>.</p> </p></font><br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union#"><font color="blue">Return to the Top</font></a></p></div></div></div></div></body></html>{{:Team:CIDEB-UANL_Mexico/footer}}</div>Piff