http://2014hs.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=100&target=UnicornioMagico&year=&month=
2014hs.igem.org - User contributions [en]
2024-03-29T13:34:52Z
From 2014hs.igem.org
MediaWiki 1.16.5
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_dnaweek
Team:CIDEB-UANL Mexico/hp dnaweek
2014-06-21T04:00:27Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
}<br />
<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>DNA Week</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b><h2>Objective and Description</h2></b></p><br />
<br />
<p>Even though iGEM has been in our high school since 2012, most students still did not know what it is about. We have as a goal that future generations inside CIDEB show more interest and curiosity towards biology, and as a consequence, towards iGEM. </p><br />
<br />
<p>We, as a team, consider important that if we want everybody to know what iGEM is and that our high school is involved in it, the starting point must be inside our own institution.</p> <br />
<br />
<p>With the purpose of spreading iGEM and our project, and taking advantage of the international DNA Day (April 25th), we organized the DNA Week.</p><br />
<br />
<br><center><p><img width=700 height=150 src="https://static.igem.org/mediawiki/2014hs/1/16/DNAweekCIDEB2.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 1.</b> Students listening and participating in the presentations.</p></center><br />
<br />
<br><br />
<p>Our DNA Week consisted of a series of presentations and activities, which were given to all groups of the generation that have a chance to be part of the next iGEM CIDEB team. We asked permission to 3 different biology teachers, and we organized the dates and hours in a 4-day schedule, in May 12th, 13th, 14th, and 16th. We did a PowerPoint presentation with information about iGEM and our project. We also performed two activities referring to synthetic biology and to our project between the information given, with the purpose of keeping the audience interested in what we were talking about.</p><br />
<br />
<br><center><table class=MsoTable15Grid4Accent3 border=1 cellspacing=0 cellpadding=0<br />
style='border-collapse:collapse;border:none;mso-border-alt:solid #C2D69B .5pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;mso-yfti-tbllook:1184;<br />
mso-padding-alt:0cm 5.4pt 0cm 5.4pt'><br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes;<br />
height:15.3pt'><br />
<td width=612 colspan=2 valign=top style='width:459.0pt;border:solid #9BBB59 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-alt:solid #9BBB59 .5pt;mso-border-themecolor:<br />
accent3;background:#9BBB59;mso-background-themecolor:accent3;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:15.3pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:5'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Aharoni;color:white;mso-themecolor:<br />
background1;mso-ansi-language:EN-US'>THE PRESENTATION CONSISTED ON:<o:p></o:p></span></b></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:0'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:<br />
accent3;mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>What is iGEM?</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:115%;mso-yfti-cnfc:64'><span lang=EN-US style='font-size:<br />
12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;<br />
mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>A general explanation of<br />
the <span class=SpellE>iGEM</span> competition.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:1'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>What is synthetic biology?</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:115%'><span lang=EN-US style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;mso-bidi-font-family:<br />
Arial;mso-ansi-language:EN-US'>The creation of biological machines in order<br />
to give new features to organisms.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:2'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:<br />
accent3;mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>Talking about DNA</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:115%;mso-yfti-cnfc:64'><span lang=EN-US style='font-size:<br />
12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;<br />
mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>A brief explanation of<br />
DNA and genes, which make every organism different from each other. <o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:3'><br />
<td width=612 colspan=2 valign=top style='width:459.0pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>GAME TIME<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>The<br />
first game represented the insertion of modified plasmids to the bacteria.<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>They<br />
used toy guns to shoot the different plasmids into three different bacteria,<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><span class=GramE><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>taking</span></b></span><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><br />
into account the difference between red, green, and yellow fluorescence proteins<br />
in each bacteria.<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></b></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:4'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:<br />
accent3;mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>IGEM in our high school</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:115%;mso-yfti-cnfc:64'><span lang=EN-US style='font-size:<br />
12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;<br />
mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>CIDEB_UANL has<br />
participated in the <span class=SpellE>iGEM</span> competition for the last 2<br />
years, obtaining the 3<sup>rd</sup> place in each one.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:5'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>CIDEB 2014’s project</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>E.CARU consists in 4 modules:<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>- The capture of Na<sup>+ </sup>ions<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>- The productions of an aroma (Wintergreen)<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>- Resistance to different environmental conditions <o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>- Binding to silica pearls. <o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:6;mso-yfti-lastrow:yes'><br />
<td width=612 colspan=2 valign=top style='width:459.0pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:<br />
accent3;mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><i style='mso-bidi-font-style:<br />
normal'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;<br />
mso-themecolor:text2;mso-themeshade:191;mso-ansi-language:EN-US'><br><br />
</span></i></b><b><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:<br />
11.0pt;line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;<br />
color:#17365D;mso-themecolor:text2;mso-themeshade:191;mso-ansi-language:EN-US'>LET’S<br />
PLAY<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>The<br />
last game consisted of a bacteria which two students had to <i<br />
style='mso-bidi-font-style:normal'>transform<o:p></o:p></i></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>into<br />
E.CARU, placing in it the characteristics that make it unique:<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>muscles<br />
of resistance, a drawn silica pearl representing the binding<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><span class=GramE><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>of</span></b></span><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><br />
the bacteria, leaves of aroma and sodium ions (Na<sup>+</sup>), which represented<br />
the capture module.<o:p></o:p></span></b></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%;mso-yfti-cnfc:68'><b><span lang=EN-US style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;mso-bidi-font-family:<br />
Arial;mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span><o:p></o:p></span></b></p><br />
</td><br />
</tr><br />
</table></center><br />
<br />
<br><br />
<br />
<p><b><h2>Impact</h2></b></p><br />
<br />
<br />
<table width=100%><br />
<br />
<tr><br />
<td><br />
<br />
<td style="padding-left:12px;"> <p>We achieved our objective. During the explanation, the students appeared<br />
surprised and interested about the IGEM competition and our project.<br />
The response given by the rest of the students, of curiosity and participation, is<br />
a very important approach because we awoke their scientific interest and their<br />
enthusiasm to do something related to it. By listening to us and playing the games, students came closer to the<br />
team members asking more about how we were doing our project, what should<br />
they do if they want to participate, what do we do in each one of our sub-teams<br />
(math model, human practices, safety, and other), and they were even asking us about<br />
the posters we placed around the school. They showed a lot of interest.<br />
Even teachers approached the team to know about our work.</p><br />
<p align: justify>While<br />
the last year’s project was only known by a few students, this year is a<br />
completely different situation. Now, thanks to activities like this, most of<br />
the students at CIDEB know about <span class=SpellE>iGEM</span>. This is a good<br />
thing because some of them will form the new <span class=SpellE>iGEM</span><br />
CIDEB generation next year, and the possibilities of gaining members who are<br />
really interested has increased.</p><br />
</td><br />
<td style="padding-left:12px;"> <img width=507 height=390 src="https://static.igem.org/mediawiki/2014hs/4/4f/DNAweekCIDEB.jpg"<br />
align=center hspace=9 alt="IMG_0317"></p><br />
<center><p><b>Image 2.</b> Student learning about our project</p></center><br />
</td><br />
</tr></table><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_dnaweek#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_dnaweek
Team:CIDEB-UANL Mexico/hp dnaweek
2014-06-21T03:57:01Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
}<br />
<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>DNA Week</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b><h2>Objective and Description</h2></b></p><br />
<br />
<p>Even though iGEM has been in our high school since 2012, most students still did not know what it is about. We have as a goal that future generations inside CIDEB show more interest and curiosity towards biology, and as a consequence, towards iGEM. </p><br />
<br />
<p>We, as a team, consider important that if we want everybody to know what iGEM is and that our high school is involved in it, the starting point must be inside our own institution.</p> <br />
<br />
<p>With the purpose of spreading iGEM and our project, and taking advantage of the international DNA Day (April 25th), we organized the DNA Week.</p><br />
<br />
<br><center><p><img width=700 height=150 src="https://static.igem.org/mediawiki/2014hs/1/16/DNAweekCIDEB2.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 1.</b> Students listening and participating in the presentations.</p></center><br />
<br />
<br><br />
<p>Our DNA Week consisted of a series of presentations and activities, which were given to all groups of the generation that have a chance to be part of the next iGEM CIDEB team. We asked permission to 3 different biology teachers, and we organized the dates and hours in a 4-day schedule, in May 12th, 13th, 14th, and 16th. We did a PowerPoint presentation with information about iGEM and our project. We also performed two activities referring to synthetic biology and to our project between the information given, with the purpose of keeping the audience interested in what we were talking about.</p><br />
<br />
<br><center><table class=MsoTable15Grid4Accent3 border=1 cellspacing=0 cellpadding=0<br />
style='border-collapse:collapse;border:none;mso-border-alt:solid #C2D69B .5pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;mso-yfti-tbllook:1184;<br />
mso-padding-alt:0cm 5.4pt 0cm 5.4pt'><br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes;<br />
height:15.3pt'><br />
<td width=612 colspan=2 valign=top style='width:459.0pt;border:solid #9BBB59 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-alt:solid #9BBB59 .5pt;mso-border-themecolor:<br />
accent3;background:#9BBB59;mso-background-themecolor:accent3;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:15.3pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:5'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Aharoni;color:white;mso-themecolor:<br />
background1;mso-ansi-language:EN-US'>THE PRESENTATION CONSISTED ON:<o:p></o:p></span></b></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:0'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:<br />
accent3;mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>What is iGEM?</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:115%;mso-yfti-cnfc:64'><span lang=EN-US style='font-size:<br />
12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;<br />
mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>A general explanation of<br />
the <span class=SpellE>iGEM</span> competition.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:1'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>What is synthetic biology?</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:115%'><span lang=EN-US style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;mso-bidi-font-family:<br />
Arial;mso-ansi-language:EN-US'>The creation of biological machines in order<br />
to give new features to organisms.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:2'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:<br />
accent3;mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>Talking about DNA</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:115%;mso-yfti-cnfc:64'><span lang=EN-US style='font-size:<br />
12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;<br />
mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>A brief explanation of<br />
DNA and genes, which make every organism different from each other. <o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:3'><br />
<td width=612 colspan=2 valign=top style='width:459.0pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>GAME TIME<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>The<br />
first game represented the insertion of modified plasmids to the bacteria.<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>They<br />
used toy guns to shoot the different plasmids into three different bacteria,<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><span class=GramE><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>taking</span></b></span><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><br />
into account the difference between red, green, and yellow fluorescence proteins<br />
in each bacteria.<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></b></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:4'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:<br />
accent3;mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>IGEM in our high school</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:115%;mso-yfti-cnfc:64'><span lang=EN-US style='font-size:<br />
12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;<br />
mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>CIDEB_UANL has<br />
participated in the <span class=SpellE>iGEM</span> competition for the last 2<br />
years, obtaining the 3<sup>rd</sup> place in each one.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:5'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>CIDEB 2014’s project</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>E.CARU consists in 4 modules:<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>- The capture of Na<sup>+ </sup>ions<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>- The productions of an aroma (Wintergreen)<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>- Resistance to different environmental conditions <o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>- Binding to silica pearls. <o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:6;mso-yfti-lastrow:yes'><br />
<td width=612 colspan=2 valign=top style='width:459.0pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:<br />
accent3;mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><i style='mso-bidi-font-style:<br />
normal'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;<br />
mso-themecolor:text2;mso-themeshade:191;mso-ansi-language:EN-US'><br><br />
</span></i></b><b><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:<br />
11.0pt;line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;<br />
color:#17365D;mso-themecolor:text2;mso-themeshade:191;mso-ansi-language:EN-US'>LET’S<br />
PLAY<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>The<br />
last game consisted of a bacteria which two students had to <i<br />
style='mso-bidi-font-style:normal'>transform<o:p></o:p></i></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>into<br />
E.CARU, placing in it the characteristics that make it unique:<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>muscles<br />
of resistance, a drawn silica pearl representing the binding<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><span class=GramE><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>of</span></b></span><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><br />
the bacteria, leaves of aroma and sodium ions (Na<sup>+</sup>), which represented<br />
the capture module.<o:p></o:p></span></b></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%;mso-yfti-cnfc:68'><b><span lang=EN-US style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;mso-bidi-font-family:<br />
Arial;mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span><o:p></o:p></span></b></p><br />
</td><br />
</tr><br />
</table></center><br />
<br />
<br><br />
<br />
<p><b><h2>Impact</h2></b></p><br />
<br />
<br />
<table width=100%><br />
<br />
<tr><br />
<td><br />
<br />
<td style="padding-left:12px;"> <p>We achieved our objective. During the explanation, the students appeared<br />
surprised and interested about the IGEM competition and our project.<br />
The response given by the rest of the students, of curiosity and participation, is<br />
a very important approach because we awoke their scientific interest and their<br />
enthusiasm to do something related to it. By listening to us and playing the games, students came closer to the<br />
team members asking more about how we were doing our project, what should<br />
they do if they want to participate, what do we do in each one of our sub-teams<br />
(math model, human practices, safety, and other), and they were even asking us about<br />
the posters we placed around the school. They showed a lot of interest.<br />
Even teachers approached the team to know about our work.</p><br />
<p align: justify>While<br />
the last year’s project was only known by a few students, this year is a<br />
completely different situation. Now, thanks to activities like this, most of<br />
the students at CIDEB know about <span class=SpellE>iGEM</span>. This is a good<br />
thing because some of them will form the new <span class=SpellE>iGEM</span><br />
CIDEB generation next year, and the possibilities of gaining members who are<br />
really interested has increased, since they are expecting to approach it.</p><br />
</td><br />
<td style="padding-left:12px;"> <img width=507 height=390 src="https://static.igem.org/mediawiki/2014hs/4/4f/DNAweekCIDEB.jpg"<br />
align=center hspace=9 alt="IMG_0317"></p><br />
<center><p><b>Image 2.</b> Student learning from our project</p></center><br />
</td><br />
</tr></table><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_dnaweek#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_dnaweek
Team:CIDEB-UANL Mexico/hp dnaweek
2014-06-21T03:53:16Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
}<br />
<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>DNA Week</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b><h2>Objective and Description</h2></b></p><br />
<br />
<p>Even though iGEM has been in our high school since 2012, most students still did not know what it is about. We have as a goal that future generations inside CIDEB show more interest and curiosity towards biology, and as a consequence, towards iGEM. </p><br />
<br />
<p>We, as a team, consider important that if we want everybody to know what iGEM is and that our high school is involved in it, the starting point must be inside our own institution.</p> <br />
<br />
<p>With the purpose of spreading iGEM and our project, and taking advantage of the international DNA Day (April 25th), we organized the DNA Week.</p><br />
<br />
<br><center><p><img width=700 height=150 src="https://static.igem.org/mediawiki/2014hs/1/16/DNAweekCIDEB2.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 1.</b> Students listening and participating in the presentations.</p></center><br />
<br />
<br><br />
<p>Our DNA Week consisted of a series of presentations and activities, which were given to all groups of the generation that have a chance to be part of the next iGEM CIDEB team. We asked permission to 3 different biology teachers, and we organized the dates and hours in a 4-day schedule, in May 12th, 13th, 14th, and 16th. We did a PowerPoint presentation with information about iGEM and our project. We also performed two activities referring to synthetic biology and to our project between the information given, with the purpose of keeping the audience interested in what we were talking about.</p><br />
<br />
<br><center><table class=MsoTable15Grid4Accent3 border=1 cellspacing=0 cellpadding=0<br />
style='border-collapse:collapse;border:none;mso-border-alt:solid #C2D69B .5pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;mso-yfti-tbllook:1184;<br />
mso-padding-alt:0cm 5.4pt 0cm 5.4pt'><br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes;<br />
height:15.3pt'><br />
<td width=612 colspan=2 valign=top style='width:459.0pt;border:solid #9BBB59 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-alt:solid #9BBB59 .5pt;mso-border-themecolor:<br />
accent3;background:#9BBB59;mso-background-themecolor:accent3;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:15.3pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:5'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Aharoni;color:white;mso-themecolor:<br />
background1;mso-ansi-language:EN-US'>THE PRESENTATION CONSISTED ON:<o:p></o:p></span></b></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:0'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:<br />
accent3;mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>What is IGEM?</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:115%;mso-yfti-cnfc:64'><span lang=EN-US style='font-size:<br />
12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;<br />
mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>A general explanation of<br />
the <span class=SpellE>iGEM</span> competition.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:1'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>What is synthetic biology?</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:115%'><span lang=EN-US style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;mso-bidi-font-family:<br />
Arial;mso-ansi-language:EN-US'>The creation of biological machines in order<br />
to give new features to organisms.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:2'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:<br />
accent3;mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>Talking about DNA</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:115%;mso-yfti-cnfc:64'><span lang=EN-US style='font-size:<br />
12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;<br />
mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>A brief explanation of<br />
DNA and genes, which make every organism different from each other. <o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:3'><br />
<td width=612 colspan=2 valign=top style='width:459.0pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>GAME TIME<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>The<br />
first game represented the insertion of modified plasmids to the bacteria.<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>They<br />
used toy guns to shoot the different plasmids into three different bacteria,<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><span class=GramE><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>taking</span></b></span><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><br />
into account the difference between red, green, and yellow fluorescence proteins<br />
in each bacteria.<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></b></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:4'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:<br />
accent3;mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>IGEM in our high school</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:115%;mso-yfti-cnfc:64'><span lang=EN-US style='font-size:<br />
12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;<br />
mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>CIDEB_UANL has<br />
participated in the <span class=SpellE>iGEM</span> competition for the last 2<br />
years, obtaining the 3<sup>rd</sup> place in each one.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:5'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>CIDEB 2014’s project</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>E.CARU consists in 4 modules:<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>- The capture of Na<sup>+ </sup>ions<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>- The productions of an aroma (Wintergreen)<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>- Resistance to different environmental conditions <o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>- Binding to silica pearls. <o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:6;mso-yfti-lastrow:yes'><br />
<td width=612 colspan=2 valign=top style='width:459.0pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:<br />
accent3;mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><i style='mso-bidi-font-style:<br />
normal'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;<br />
mso-themecolor:text2;mso-themeshade:191;mso-ansi-language:EN-US'><br><br />
</span></i></b><b><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:<br />
11.0pt;line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;<br />
color:#17365D;mso-themecolor:text2;mso-themeshade:191;mso-ansi-language:EN-US'>LET’S<br />
PLAY<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>The<br />
last game consisted of a bacteria which two students had to <i<br />
style='mso-bidi-font-style:normal'>transform<o:p></o:p></i></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>into<br />
E.CARU, placing in it the characteristics that make it unique:<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>muscles<br />
of resistance, a drawn silica pearl representing the binding<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><span class=GramE><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>of</span></b></span><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><br />
the bacteria, leaves of aroma and sodium ions (Na<sup>+</sup>), which represented<br />
the capture module.<o:p></o:p></span></b></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%;mso-yfti-cnfc:68'><b><span lang=EN-US style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;mso-bidi-font-family:<br />
Arial;mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span><o:p></o:p></span></b></p><br />
</td><br />
</tr><br />
</table></center><br />
<br />
<br><br />
<br />
<p><b><h2>Impact</h2></b></p><br />
<br />
<br />
<table width=100%><br />
<br />
<tr><br />
<td><br />
<br />
<td style="padding-left:12px;"> <p>We achieved our objective. During the explanation, the students appeared<br />
surprised and interested about the IGEM competition and our project.<br />
The response given by the rest of the students, of curiosity and participation, is<br />
a very important approach because we awoke their scientific interest and their<br />
enthusiasm to do something related to it. By listening to us and playing the games, students came closer to the<br />
team members asking more about how we were doing our project, what should<br />
they do if they want to participate, what do we do in each one of our sub-teams<br />
(math model, human practices, safety, and other), and they were even asking us about<br />
the posters we placed around the school. They showed a lot of interest.<br />
Even teachers approached the team to know about our work.</p><br />
<p align: justify>While<br />
the last year’s project was only known by a few students, this year is a<br />
completely different situation. Now, thanks to activities like this, most of<br />
the students at CIDEB know about <span class=SpellE>iGEM</span>. This is a good<br />
thing because some of them will form the new <span class=SpellE>iGEM</span><br />
CIDEB generation next year, and the possibilities of gaining members who are<br />
really interested has increased, since they are expecting to approach it.</p><br />
</td><br />
<td style="padding-left:12px;"> <img width=507 height=390 src="https://static.igem.org/mediawiki/2014hs/4/4f/DNAweekCIDEB.jpg"<br />
align=center hspace=9 alt="IMG_0317"></p><br />
<center><p><b>Image 2.</b> Student learning from our project</p></center><br />
</td><br />
</tr></table><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_dnaweek#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav
Team:CIDEB-UANL Mexico/hp cinvestav
2014-06-21T03:47:51Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>CINVESTAV Conference</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p><img width=300 height=200 src="https://static.igem.org/mediawiki/2014hs/2/2e/CINVESTAV_1CIDEB.JPG"/></p><p><The team during the presentation</p><br />
<p><b>Image 1.</b> The team at the end of the presentation.</p><br />
</td><br />
<td style="padding-left:12px;"><p>On Friday March 7th, 40 Chilean teachers visited our high school. They were not very familiar with what the iGEM competition is all about, so we invited them to a conference in the Auditorium were we gave a presentation including an iGEM introduction, its principal areas, our team background and the explanation of our project, enclosing also our previous ideas, with the intention of letting people from other countries know about iGEM, specially about our team and what we are doing. </p></td><br />
</tr></table><br />
<br />
<p><b><h2>Description</h2></b></p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p>In a PowerPoint presentation, we covered the most related topics about iGEM. We started with an introduction of what the iGEM competition is and what it is about, we also included the basics of iGEM’s history, mentioning how the high school division was formed.</p><br />
<br />
<p>We explained how this competition is multidisciplinary and showed all the characteristics that an IGEM team has, therefore, we explained to the teachers the different parts of the project like safety, dry lab, human practices, and more.</p><br />
<br />
<p>Then, we wanted to show them how we finally got to our project; including a brief description of all the ideas we had during the team meetings until deciding the final one. Afterwards, we included a complete description of our project and the purpose we had for it. Finally, a brief explanation of the previous teams in our high school was included. </p><br />
<br />
<p>We also had a short time of questions and answers, and it was very encouraging that they gave us supporting comments about us and the presentation. This was a great feedback for us.</p><br />
</td><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/5/5a/CINVESTAV_2CIDEB.JPG"/></td><br />
<br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/d/dd/CINVESTAV_3CIDEB.JPG"/></td><br />
<br />
</tr></table><br />
<br />
<font size="3pt"><p><center><b>Image 2.</b>Chilean teachers attending to the presentation.</center></font></p><br />
<br />
<p><b><h2>Impact</h2></b></p><br />
<br />
<p>We applied surveys with 5 different questions to each teacher and registered the results:</p><br />
<br />
<center><p><br><img width=550 height=300 src="https://static.igem.org/mediawiki/2014hs/2/2b/Graphcinvestav1CIDEB.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><font size="3pt"><p><b>Graph 1.</b> Graph showing the results of the surveys.</p></font> <br></center><br />
<br />
<p>The questions above showed us that 80% of the teachers that received our presentation considered that our project is an idea that can be very useful for the society.</p><br />
<br />
<p>With this survey it was also shown that most teachers qualified our presentation between 4 and 5. This means that what we tried to explain was very clear for them.</p><br />
<br />
<p>Also rating between 5 and 4, teachers considered very complete and understandable our concepts in the presentation.</p><br />
<br />
<p>97% of the teachers considered synthethic biology as a good path to develop solutions for actual issues in the world, showing they were in favor of the usage of synthethic biology (see Chart 1).</p><br />
<br />
<p>Finally, we wanted to have a general overview of the presentation and decided to include in the answers different adjectives so the teachers could choose. The most chosen option was “Interesting”, which is a positive feedback for us, a minor of 3% chose “Confused" (see Chart 2).</p><br />
<br><br />
<table width=100%><br />
<tr><br />
<td><br />
<td style="padding-left:40px;"><p><img width=400 height=225 src="https://static.igem.org/mediawiki/2014hs/a/ad/Graphcinvestav2CIDEB.jpg"/></p><br />
<font size="3pt"><p><center><b>Chart 1</b> Results from one of the questions.</p><br />
<br />
</td><br />
<td style="padding-left:80px;"><p><img width=400 height=250 src="https://static.igem.org/mediawiki/2014hs/4/49/Graphcinvestav3CIDEB.jpg"/></p><br />
<font size="3pt"><p><center><b>Chart 2</b> More results from the surveys</p></font></td><br />
</tr></table><br><br />
<br />
<p>We consider this activity had great repercussions in both the teachers and us, because they learned about a very interesting international project and took that information to Chile, their country. Probably they are going to spread the information we gave them and maybe there could be more Chilean iGEM teams in the future.</p><br />
<br />
<p>As for us, it helped us to hear the perspective of teachers about our project, and as we mentioned, it was very encouraging to hear their positive thoughts and feedback to improve ourselves.</p><br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav#"><font color="blue">Return to the Top</font></a></p></div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav
Team:CIDEB-UANL Mexico/hp cinvestav
2014-06-21T03:44:31Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>CINVESTAV Conference</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p><img width=300 height=200 src="https://static.igem.org/mediawiki/2014hs/2/2e/CINVESTAV_1CIDEB.JPG"/></p><p><The team during the presentation</p><br />
<p><b>Image 1.</b> The team at the end of the presentation.</p><br />
</td><br />
<td style="padding-left:12px;"><p>On Friday March 7th, 40 Chilean teachers visited our high school. They were not very familiar with what the iGEM competition is all about, so we invited them to a conference in the Auditorium were we gave a presentation including an iGEM introduction, its principal areas, our team background and the explanation of our project, enclosing also our previous ideas, with the intention of letting people from other countries know about iGEM, specially about our team and what we are doing. </p></td><br />
</tr></table><br />
<br />
<p><b><h2>Description</h2></b></p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p>In a PowerPoint presentation, we covered the most related topics about iGEM. We started with an introduction of what the iGEM competition is and what it is about, we also included the basics of iGEM’s history, mentioning how the high school division was formed.</p><br />
<br />
<p>We explained how this competition is multidisciplinary and showed all the characteristics that an IGEM team has, therefore, we explained to the teachers the different parts of the project like safety, dry lab, human practices, and more.</p><br />
<br />
<p>Then, we wanted to show them how we finally got to our project; including a brief description of all the ideas we had during the team meetings until deciding the final one. Afterwards, we included a complete description of our project and the purpose we had for it. Finally, a brief explanation of the previous teams in our high school was included, along with the places they got.</p><br />
<br />
<p>We also had a short time of questions and answers, and it was very encouraging that they gave us supporting comments about us and the presentation. This was a great feedback for us.</p><br />
</td><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/5/5a/CINVESTAV_2CIDEB.JPG"/></td><br />
<br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/d/dd/CINVESTAV_3CIDEB.JPG"/></td><br />
<br />
</tr></table><br />
<br />
<font size="3pt"><p><center><b>Image 2.</b>Chilean teachers attending to the presentation.</center></font></p><br />
<br />
<p><b><h2>Impact</h2></b></p><br />
<br />
<p>We applied surveys with 5 different questions to each teacher and registered the results:</p><br />
<br />
<center><p><br><img width=550 height=300 src="https://static.igem.org/mediawiki/2014hs/2/2b/Graphcinvestav1CIDEB.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><font size="3pt"><p><b>Graph 1.</b> Graph showing the results of the surveys.</p></font> <br></center><br />
<br />
<p>The questions above showed us that 80% of the teachers that received our presentation and an explanation of our project considered that it is an idea which if developed, could be very useful for the society.</p><br />
<br />
<p>With this survey it was also shown that most teachers qualified our presentation between 4 and 5. This means that what we tried to explain was very clear for them.</p><br />
<br />
<p>Also rating between 5 and 4, teachers considered very complete and understandable our concepts in the presentation.</p><br />
<br />
<p>97% of the teachers considered synthethic biology as a good path to develop solutions for actual issues in the world, showing they were in favor of the usage of synthethic biology (see Chart 1).</p><br />
<br />
<p>Finally, we wanted to have a general overview of the presentation and decided to include in the answers different adjectives so the teachers could choose. The most chosen option was “Interesting”, which is a positive feedback for us, a minor of 3% chose “Confused" (see Chart 2).</p><br />
<br><br />
<table width=100%><br />
<tr><br />
<td><br />
<td style="padding-left:40px;"><p><img width=400 height=225 src="https://static.igem.org/mediawiki/2014hs/a/ad/Graphcinvestav2CIDEB.jpg"/></p><br />
<font size="3pt"><p><center><b>Chart 1</b> Results from one of the questions.</p><br />
<br />
</td><br />
<td style="padding-left:80px;"><p><img width=400 height=250 src="https://static.igem.org/mediawiki/2014hs/4/49/Graphcinvestav3CIDEB.jpg"/></p><br />
<font size="3pt"><p><center><b>Chart 2</b>More results from the surveys</p></font></td><br />
</tr></table><br><br />
<br />
<p>We consider this activity had great repercussions in both the teachers and us, because they learned about a very interesting international project and took that information to Chile, their country. Probably they are going to spread the information we gave them and maybe there could be more Chilean iGEM teams in the future.</p><br />
<br />
<p>As for us, it helped us to hear the perspective of teachers about our project, and as we mentioned, it was very encouraging to hear their positive thoughts and feedback to improve ourselves.</p><br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav#"><font color="blue">Return to the Top</font></a></p></div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav
Team:CIDEB-UANL Mexico/hp cinvestav
2014-06-21T03:41:35Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>CINVESTAV Conference</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p><img width=300 height=200 src="https://static.igem.org/mediawiki/2014hs/2/2e/CINVESTAV_1CIDEB.JPG"/></p><p><The team during the presentation</p><br />
<p><b>Image 1.</b> The team at the end of the presentation.</p><br />
</td><br />
<td style="padding-left:12px;"><p>On Friday March 7th, 40 Chilean teachers visited our high school. They were not very familiar with what the iGEM competition is all about, so we invited them to a conference in the Auditorium were we gave a presentation including an iGEM introduction, its principal areas, our team background and the explanation of our project, enclosing also our previews ideas, with the intention of letting people from other states know about iGEM, specially about our team, and what we are doing. This gave us not only a state parameter, but a national one too.</p></td><br />
</tr></table><br />
<br />
<p><b><h2>Description</h2></b></p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p>In a PowerPoint presentation, we covered the most related topics about iGEM. We started with an introduction of what the iGEM competition is and what it is about, we also included the basics of iGEM’s history, mentioning how the high school division was formed.</p><br />
<br />
<p>We explained how this competition is multidisciplinary and showed all the characteristics that an IGEM team has, therefore, we explained to the teachers the different parts of the project like safety, dry lab, human practices, and more.</p><br />
<br />
<p>Then, we wanted to show them how we finally got to our project; including a brief description of all the ideas we had during the team meetings until deciding the final one. Afterwards, we included a complete description of our project and the purpose we had for it. Finally, a brief explanation of the previous teams in our high school was included, along with the places they got.</p><br />
<br />
<p>We also had a short time of questions and answers, and it was very encouraging that they gave us supporting comments about us and the presentation. This was a great feedback for us.</p><br />
</td><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/5/5a/CINVESTAV_2CIDEB.JPG"/></td><br />
<br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/d/dd/CINVESTAV_3CIDEB.JPG"/></td><br />
<br />
</tr></table><br />
<br />
<font size="3pt"><p><center><b>Image 2.</b>Chilean teachers attending to the presentation.</center></font></p><br />
<br />
<p><b><h2>Impact</h2></b></p><br />
<br />
<p>We applied surveys with 5 different questions to each teacher and registered the results:</p><br />
<br />
<center><p><br><img width=550 height=300 src="https://static.igem.org/mediawiki/2014hs/2/2b/Graphcinvestav1CIDEB.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><font size="3pt"><p><b>Graph 1.</b> Graph showing the results of the surveys.</p></font> <br></center><br />
<br />
<p>The questions above showed us that 80% of the teachers that received our presentation and an explanation of our project considered that it is an idea which if developed, could be very useful for the society.</p><br />
<br />
<p>With this survey it was also shown that most teachers qualified our presentation between 4 and 5. This means that what we tried to explain was very clear for them.</p><br />
<br />
<p>Also rating between 5 and 4, teachers considered very complete and understandable our concepts in the presentation.</p><br />
<br />
<p>97% of the teachers considered synthethic biology as a good path to develop solutions for actual issues in the world, showing they were in favor of the usage of synthethic biology (see Chart 1).</p><br />
<br />
<p>Finally, we wanted to have a general overview of the presentation and decided to include in the answers different adjectives so the teachers could choose. The most chosen option was “Interesting”, which is a positive feedback for us, a minor of 3% chose “Confused" (see Chart 2).</p><br />
<br><br />
<table width=100%><br />
<tr><br />
<td><br />
<td style="padding-left:40px;"><p><img width=400 height=225 src="https://static.igem.org/mediawiki/2014hs/a/ad/Graphcinvestav2CIDEB.jpg"/></p><br />
<font size="3pt"><p><center><b>Chart 1</b> Results from one of the questions.</p><br />
<br />
</td><br />
<td style="padding-left:80px;"><p><img width=400 height=250 src="https://static.igem.org/mediawiki/2014hs/4/49/Graphcinvestav3CIDEB.jpg"/></p><br />
<font size="3pt"><p><center><b>Chart 2</b>More results from the surveys</p></font></td><br />
</tr></table><br><br />
<br />
<p>We consider this activity had great repercussions in both the teachers and us, because they learned about a very interesting international project and took that information to Chile, their country. Probably they are going to spread the information we gave them and maybe there could be more Chilean iGEM teams in the future.</p><br />
<br />
<p>As for us, it helped us to hear the perspective of teachers about our project, and as we mentioned, it was very encouraging to hear their positive thoughts and feedback to improve ourselves.</p><br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav#"><font color="blue">Return to the Top</font></a></p></div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav
Team:CIDEB-UANL Mexico/hp cinvestav
2014-06-21T03:37:47Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>CINVESTAV Conference</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p><img width=300 height=200 src="https://static.igem.org/mediawiki/2014hs/2/2e/CINVESTAV_1CIDEB.JPG"/></p><p><The team during the presentation</p><br />
<p><b>Image 1.</b> The team at the end of the presentation.</p><br />
</td><br />
<td style="padding-left:12px;"><p>On Friday March 7th, 40 Chilean teachers from the <i>Instituto Politécnico Nacional</i>, located in Mexico D.F. visited our High School. They were not very familiar with what the iGEM competition is all about, so we invited them to a conference in the Auditorium were we gave a presentation including an iGEM introduction, its principal areas, our team background and the explanation of our project, enclosing also our previews ideas, with the intention of letting people from other states know about iGEM, specially about our team, and what we are doing. This gave us not only a state parameter, but a national one too.</p></td><br />
</tr></table><br />
<br />
<p><b><h2>Description</h2></b></p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p>In a PowerPoint presentation, we covered the most related topics of iGEM. We started with an introduction of what the iGEM competition is and what it is about, we also included the basics of iGEM’s history, mentioning how the High School division was formed.</p><br />
<br />
<p>We explained how this competition is multidisciplinary and showed all the characteristics that an IGEM team has, therefore, we explained to the teachers the different parts of the project like safety, dry lab, human practices, and more.</p><br />
<br />
<p>Then, we wanted to show them how we finally got to our project; including a brief description of all the ideas we had during the meetings until deciding the final one. Afterwards, we included a complete description of our project and the purpose we had for it. Finally, a brief explanation of the previous teams in our High School was included, along with the places they got.</p><br />
<br />
<p>We also had some time for questions from them, and it was very encouraging that they had supporting comments for us and the presentation. This was a great feedback for us.</p><br />
</td><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/5/5a/CINVESTAV_2CIDEB.JPG"/></td><br />
<br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/d/dd/CINVESTAV_3CIDEB.JPG"/></td><br />
<br />
</tr></table><br />
<br />
<font size="3pt"><p><center><b>Image 2.</b>Chilean teachers attending to the presentation.</center></font></p><br />
<br />
<p><b><h2>Impact</h2></b></p><br />
<br />
<p>We applied surveys with 5 different questions to each teacher and registered the results:</p><br />
<br />
<center><p><br><img width=550 height=300 src="https://static.igem.org/mediawiki/2014hs/2/2b/Graphcinvestav1CIDEB.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><font size="3pt"><p><b>Graph 1.</b> Graph showing the results of the surveys.</p></font> <br></center><br />
<br />
<p>The questions above showed us that 80% of the teachers that received our presentation and an explanation of our project considered that it is an idea which if developed, could be very useful for the society.</p><br />
<br />
<p>With this survey it was also shown that most teachers qualified our presentation between 4 and 5. This means that what we tried to explain was very clear for them.</p><br />
<br />
<p>Also rating between 5 and 4, teachers considered very complete and understandable our concepts in the presentation.</p><br />
<br />
<p>97% of the teachers considered synthethic biology as a good path to develop solutions for actual issues in the world, showing they were in favor of the usage of synthethic biology (see Chart 1).</p><br />
<br />
<p>Finally, we wanted to have a general overview of the presentation and decided to include in the answers different adjectives so the teachers could choose. The most chosen option was “Interesting”, which is a positive feedback for us, a minor of 3% chose “Confused" (see Chart 2).</p><br />
<br><br />
<table width=100%><br />
<tr><br />
<td><br />
<td style="padding-left:40px;"><p><img width=400 height=225 src="https://static.igem.org/mediawiki/2014hs/a/ad/Graphcinvestav2CIDEB.jpg"/></p><br />
<font size="3pt"><p><center><b>Chart 1</b> Results from one of the questions.</p><br />
<br />
</td><br />
<td style="padding-left:80px;"><p><img width=400 height=250 src="https://static.igem.org/mediawiki/2014hs/4/49/Graphcinvestav3CIDEB.jpg"/></p><br />
<font size="3pt"><p><center><b>Chart 2</b>More results from the surveys</p></font></td><br />
</tr></table><br><br />
<br />
<p>We consider this activity had great repercussions in both the teachers and us, because they learned about a very interesting international project and took that information to Chile, their country. Probably they are going to spread the information we gave them and maybe there could be more Chilean iGEM teams in the future.</p><br />
<br />
<p>As for us, it helped us to hear the perspective of teachers about our project, and as we mentioned, it was very encouraging to hear their positive thoughts and feedback to improve ourselves.</p><br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav#"><font color="blue">Return to the Top</font></a></p></div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma
Team:CIDEB-UANL Mexico/project aroma
2014-06-21T03:27:58Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project<br />
</title><br />
<style>body{margin: 0px; width: 100%;padding: 0px;dubackground: #2056ac;font-family: 'Oxygen', sans-serif;font-size: 12pt;background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);}h1, h2, h3{margin: 0;padding-bottom: 5px;color: #404040;}p, ol, ul{margin-top: 0;}ol, ul{padding: 0;list-style: none;}p{line-height: 1.60em;padding- right: 3em;}strong{}a{color: #2056ac;}a:hover{text-decoration: none;}.container{margin: 0px auto;width: 1200px;}.container-text{margin: 0px auto;width: 75%;padding: 0px;font-family: 'Oxygen', sans-serif;font-size: 12pt; text-align: justify;}.wrapper{overflow: hidden;padding: 0em 0em 1em 0em;background: #FFF;}#wrapper1{background: #FFF;}#wrapper2{overflow: hidden;background: #F3F3F3;padding: 5em 0em;text-align: center;}#wrapper3{overflow: hidden;padding: 0em 0em 0em 0em;background: #FFF;}#wrapper4{}#banner{padding-top: 2em;}#welcome{overflow: hidden;width: 1000px;padding: 0em 100px 0em 100px;text-align: center;}#welcome .content{padding: 0em 8em;}#welcome .title h2{}#welcome a,#welcome strong{}.title{margin-bottom: 1em;}.title h2{font-size: 2em;}.title .byline{font-size: 1.1em;color: #6F6F6F#;}#three-column{overflow: hidden;margin-top: 5em;padding-top: 1em;border-top: 1px solid rgba(0,0,0,0.2);text-align: center;}#three-column h2{margin: 1em 0em;font-size: 1.5em;font-weight: 700;}#three-column .icon{position: relative;display: block;margin: 0px auto 0.80em auto;background: none;line-height: 150px;font-size: 4em;width: 150px;height: 100px;border-radius: 100px;border: 6px solid #67128F;text-align: center;color: #FFF;}#three-column #tbox1,#three-column #tbox2,#three-column #tbox3{float: left;width: 320px;padding: 30px 40px 50px 40px;}#three-column .title{text-align: center;}#three-column .title h2{font-size: 1.60em;}#three-column .title .byline{padding-top: 0.50em;font-size: 0.90em;color: #858585;}#three-column .arrow-down{border-top-color: #292929;}ul.tools{margin: 0;padding: 0em 0em 0em 0em;list-style: none;}ul.tools li{display: inline-block;padding: 0em .2em;font-size: 4em;}ul.tools li span{display: none;margin: 0;padding: 0;}ul.tools li a{color: #FFF;}ul.tools li a:before{display: inline-block;background: #1ABC9C;width: 120px;height: 120px;border-radius: 50%;line-height: 120px;text-align: center;color: #FFFFFF;}.button{display: inline-block;margin-top: 2em;padding: 0.8em 2em;background: #64ABD1;line-height: 1.8em;letter-spacing: 1px;text-decoration: none;font-size: 1em;color: #FFF;}.button:before{display: inline-block;background: #8DCB89;margin-right: 1em;width: 40px;height: 40px;line-height: 40px;border-radius: 20px;text-align: center;color: #272925;}.button-small{}#portfolio{overflow: hidden;padding-top: 5em;border-top: 1px solid rgba(0,0,0,0.2);}#portfolio .box{text-align: center;color: rgba(0,0,0,0.5);}#portfolio h3{display: block;padding-bottom: 1em;font-size: 1em;color: rgba(0,0,0,0.6);}#portfolio .title{text-align: center;}#portfolio .title h2{color: rgba(0,0,0,0.8);}.column1,.column2,.column3,.column4{width: 282px;}.column1,.column2,.column3{float: left;margin-right: 24px;}.column4{float: right;}<br />
</style><br />
<br />
<body><br />
<br />
<div class="wrapper"><br />
<br />
<div id="welcome" class="container"> <br />
<br />
<div class="title"> <h2>Aroma Module</h2> <br />
</div><br />
</div><br />
<br />
<div class="container-text"><br />
<br />
<br />
<img width=131 height=127 src="https://static.igem.org/mediawiki/2014hs/5/5c/HandsomeAroma.jpg" align=right hspace=12/><br />
<br><br />
<p align="justify">Since the beginning of iGEM project, the use of fluorescent reporters has been used in each one of the proposed projects in previous years, trying to test the theoretical presence of other proteins in <i>E. coli.</i> For our iGEM 2014 project, this module proposed to promote the usage of aroma reporters, instead of fluorescent ones.</p><br />
<br><br />
<br />
<p><b><h2>Description</h2></b></p><br />
<p>In the module, WinterGreen is the most important part. Normally, it catalyzes the conversion of salicylic acid into methyl salicylate. The protein is excreted by the bacteria and when salicylic acid is added to the medium, a chemical reaction takes place and produces methyl salicylate, which is responsible for the wintergreen odor.</p><br />
<br />
<p>But in this module, it will be regulated by temperature with the use of the RNA thermometer. When adding salicylic acid to the bacteria in a 32° Celsius environment, the production of the WinterGreen protein will begin.</p><br><br />
<br />
<br />
<center><img width=350 height=250 src="https://static.igem.org/mediawiki/2014hs/6/6e/AromaFigure1Bb.png" align=center hspace=12/></center><br />
<center><p><b>Figure 1.</b> Production of Wintergreen Odor</p></center><br />
<br />
<p><b><h2>Device</h2></b></p><br />
<p>Originally, WinterGreen was thought to be the reporter of the Capture module, but in order to prove the function of this gene and also the one in charge of the capture of sodium ions (NhaS), we decided to separate the full device into the actual modules of Capture and Aroma, as seen in the figure below.</p><br />
<br />
<center><br />
<p><img width=450 height=250 src="https://static.igem.org/mediawiki/2014hs/3/32/TestCaptureAndAroma.jpg" align=center hspace=12></p><br />
<p><b>Figure 2.</b> The device originally thought, and the 2 modules derived from it.</p></center><br><br />
<br />
<p>This device is composed by the following parts (see <b>figure 3</b>): a constitutive promoter (1), a RNA thermometer (3); used to regulate the WinterGreen-odor protein production through temperature, a Wintergreen-odor enzyme generator, used to allow the production of methyl salicylate, induced by salicylic acid (2); and a terminator (4). All of these parts are ligated by an 8-bp scar (TACTAGAG).</p><br />
<br />
<center><img width=400 height=170 src="https://static.igem.org/mediawiki/2014hs/5/56/AromaFigure1Aa.png" align=center hspace=12/><br />
<p><b>Figure 3.</b> Aroma Module</p></center><br><br />
<br />
<p>These 4 genetic parts form the Aroma device of the project. The full device's length is 1,251bp (including restriction sites).</p><br />
<br />
<p><b><h2>Parts of the module</h2></b></p><br />
<br><center><div><table class=MsoTable15Grid7ColorfulAccent3 border=1 cellspacing=0 cellpadding=0 width=625 style='width:468.55pt;border-collapse:collapse; border:none;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt'> <tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes; height:15.0pt'> <td width=88 nowrap valign=top style='width:66.1pt;border:none;border-bottom: solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint: 153;mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:517'><b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX;mso-bidi-font-style: italic'>IMAGE</span></b><span lang=ES-MX style='font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:"Times New Roman"; mso-fareast-language:ES-MX;mso-bidi-font-style:italic'><o:p></o:p></span></p> </td> <td width=119 valign=top style='width:89.0pt;border:none;border-bottom:solid #C2D69B 1.0pt; mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint:153; mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>CODE</span></b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></p> </td> <td width=418 nowrap valign=top style='width:313.45pt;border:none;border-bottom: solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint: 153;mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>DESCRIPTION</span></b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:0;height:83.15pt'> <td width=88 nowrap valign=top style='width:66.1pt;border:none;border-right: solid #C2D69B 1.0pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:83.15pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape id="_x0000_s1029" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:10.95pt;margin-top:3.2pt;width:66pt;height:48pt; z-index:251660800;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image007.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=88 height=64 src="https://static.igem.org/mediawiki/2014hs/4/43/PConsAroma.png" align=left hspace=12 v:shapes="_x0000_s1029"><![endif]></p> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><i><span lang=ES-MX style='font-family:Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade: 191;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p>&nbsp;</o:p></span></i></p> </td> <td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; background:#EAF1DD;mso-background-themecolor:accent3;mso-background-themetint: 51;padding:0cm 5.4pt 0cm 5.4pt;height:83.15pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119A</a></span><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'><o:p></o:p></span></p> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p> </td> <td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3; mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:83.15pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>In the specific case of our aroma module, it will help the bacteria to continuously transcribe the <span class=SpellE>WinterGreen</span> gene in order to allow the bacteria to continuously produce the aroma. </span><span class=SpellE><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size: 11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'>This</span></span><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family: Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; color:black;mso-fareast-language:ES-MX'> <span class=SpellE>promoter</span> has a <span class=SpellE>length</span> of 35bp.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:1;height:77.45pt'> <td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:77.45pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape id="_x0000_s1028" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:16.95pt;margin-top:4.25pt;width:57.75pt; height:44.25pt;z-index:251662848;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image009.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=77 height=59 src="https://static.igem.org/mediawiki/2014hs/b/b0/RNAthermAroma.png" align=left hspace=12 v:shapes="_x0000_s1028"><![endif]><i><span lang=ES-MX style='font-family: Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade:191;mso-fareast-language: ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p></td> <td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; padding:0cm 5.4pt 0cm 5.4pt;height:77.45pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><span lang=ES-MX style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K115017">BBa_K115017</a><o:p></o:p></span></p></td> <td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:77.45pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><span style='font-size:12.0pt;mso-bidi-font-size: 11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>A RNA thermometer, used for temperature post-transcriptional regulation (thermo sensor), and is designed to initiate transcription around 32°C.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:2;height:190.6pt'> <td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:190.6pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape id="_x0000_s1027" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:13.95pt;margin-top:3.2pt;width:63pt;height:51.75pt; z-index:251664896;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image011.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=84 height=69 src="https://static.igem.org/mediawiki/2014hs/b/b1/WinterGreenAroma.png" align=left hspace=12 v:shapes="_x0000_s1027"><![endif]><i><span style='font-size:3.0pt;font-family: Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade:191;mso-ansi-language: EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p></td> <td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; background:#EAF1DD;mso-background-themecolor:accent3;mso-background-themetint: 51;padding:0cm 5.4pt 0cm 5.4pt;height:190.6pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; mso-ansi-language:EN-US;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K1255001:Design">BBa_K1255001</a><o:p></o:p></span></p> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p> </td> <td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3; mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:190.6pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>Produces a <span class=SpellE>transferase</span> to convert salicylic acid into methyl salicylate (<span class=SpellE>WinterGreen</span> odor). The wintergreen odor generator requires of 2mM of salicylic acid to produce methyl salicylate. BSMT1 (<a href="http://parts.igem.org/Part:BBa_J45004">BBa_J45004</a>), <span class=SpellE>WinterGreen</span> Odor Generator original name, was created by <a href="https://2006.igem.org/wiki/index.php/MIT_2006">MIT 2006</a>. This year, the team optimized the sequence for <i>Escherichia coli</i>. </span><span class=SpellE><span lang=ES-MX style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'>The</span></span><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family: Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; color:black;mso-fareast-language:ES-MX'> new <span class=SpellE>biobrick</span> has a <span class=SpellE>length</span> of 1,074bp.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes;height:70.7pt'> <td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:70.7pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape id="_x0000_s1026" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:18pt;margin-top:1.85pt;width:59.1pt;height:49.4pt; z-index:251666944;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image013.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=79 height=66 src="https://static.igem.org/mediawiki/2014hs/6/62/TerminatorAroma.png" align=left hspace=12 v:shapes="_x0000_s1026"><![endif]></p> </td> <td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; padding:0cm 5.4pt 0cm 5.4pt;height:70.7pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><span lang=ES-MX style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a><o:p></o:p></span></p> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'>&nbsp;</p> </td> <td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:70.7pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><span style='font-size:12.0pt;mso-bidi-font-size: 11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>Part made of 6bp, responsible for transcription stop. The terminator stops the production of methyl salicylate. <o:p></o:p></span></p> </td> </tr></table></div></center><br><br />
<br />
<p><b><h2>Justification</h2></b></p><br />
<p>Different to fluorescent reporters, this module was made in order to (in the future) perform as an aroma reporter and also to test the correct function of the bacteria, for its future usage as a new reporter and functional part (CDS). It is desired to use this part in the project to replace the red fluorescent protein (RFP) in the Capture module. But it was preferable to test it apart to demonstrate its effectiveness. Similarly, this piece is also helpful when the biofilter is assembled, because when performing the filtration by silica, WinterGreen can demonstrate the presence of bacteria in the beads. </p><br />
<br />
<p>The team added the RNA thermometer in the device for regulating the production of the aroma. Another reason for selecting the RNA thermometer as a regulator was to continue the CIDEB UANL 2013 work with it.</p><br />
<br />
<p><b><h2>Other teams that used RNA thermometer and BSMT1</h2></b></p><br />
<br />
<div align=center width="80%" ><br />
<table border=1 cellspacing=0 cellpadding=0 style='border-collapse:collapse;border:none;mso-border-alt:solid #C2D69B .5pt; mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh: .5pt solid #C2D69B;mso-border-insidev:.5pt solid #C2D69B'> <br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #9BBB59 1.0pt; border-right:none;mso-border-top-alt:solid #9BBB59 .5pt;mso-border-left-alt: solid #9BBB59 .5pt;mso-border-bottom-alt:solid #9BBB59 .5pt;background:#9BBB59; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><b><br />
<br />
<span style='font-size:12.0pt; color:white;mso-ansi-language:EN-US'>Team<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #9BBB59 1.0pt; border-left:none;mso-border-top-alt:solid #9BBB59 .5pt;mso-border-bottom-alt: solid #9BBB59 .5pt;mso-border-right-alt:solid #9BBB59 .5pt;background:#9BBB59; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><b><br />
<br />
<span style='font-size:12.0pt; color:white;mso-ansi-language:EN-US'>Part Used<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border:solid #9BBB59 1.0pt; border-left:none;mso-border-top-alt:solid #9BBB59 .5pt;mso-border-bottom-alt: solid #9BBB59 .5pt;mso-border-right-alt:solid #9BBB59 .5pt;background:#9BBB59; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><b><br />
<br />
<span style='font-size:12.0pt; color:white;mso-ansi-language:EN-US'>Use<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
</tr><br />
<br />
<tr style='mso-yfti-irow:1;height:33.0pt'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt;height:33.0pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><br />
<br />
<span lang=FR style='font-size:12.0pt;color:#4F81BD;mso-ansi-language: FR'><a href="https://2008.igem.org/Team:TUDelft" target="_blank">TuDelft 2008</a><br />
</span></u></b><br />
<br />
<span lang=FR style='font-size:6.0pt;mso-bidi-font-size:12.0pt;mso-ansi-language:FR; mso-bidi-font-weight:bold'>:<br />
</span><b><br />
<br />
<span lang=FR style='font-size:12.0pt; mso-ansi-language:FR'><o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=170 valign=top style='width:127.35pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt; height:33.0pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>RNA themometer<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt; height:33.0pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>Temperature-sensing bacteria that changes color at different temperatures; as a temperature reporter system inlarge-scale fermentations, or as a temperature-inducible protein production system.<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:2'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><br />
<br />
<span style='font-size:12.0pt;color:#4F81BD;mso-ansi-language: EN-US'><a href="https://2009.igem.org/Team:VictoriaBC" target="_blank">Victoria BC 2009</a><br />
</span></u></b><br />
<br />
<span style='font-size:6.0pt;mso-bidi-font-size:12.0pt;mso-ansi-language:EN-US; mso-bidi-font-weight:bold'>:<b> <o:p></o:p></b><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></b></p> <br />
</td> <br />
<td width=170 valign=top style='width:127.35pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>RNA themometer<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>NAND logic gate using the ribo-key/ribo-lock system designed by <a href="https://2006.igem.org/wiki/index.php/Berkeley">Berkeley 2006</a> team , producing RFP except when the cells are grown in the presence of both arabinose and IPTG, also coupling fluorescent outputs with the ribo-thermometers made by TUDelft 2008 team.<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
</tr><br />
<tr style='mso-yfti-irow:2'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><br />
<br />
<span style='font-size:12.0pt;color:#4F81BD;mso-ansi-language: EN-US'><a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico" target="_blank">CIDEB UANL 2013</a><br />
</span></u></b><br />
<br />
<span style='font-size:6.0pt;mso-bidi-font-size:12.0pt;mso-ansi-language:EN-US; mso-bidi-font-weight:bold'>:<b> <o:p></o:p></b><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></b></p> <br />
</td> <br />
<td width=170 valign=top style='width:127.35pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>RNA themometer<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>Production of Vip3ca3, which acts as a pesticide protein, regulated by specific temperatures in order to avoid overproduction and it will show activity against target organisms Coleoptera and Lepidoptera..<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;color:#4F81BD'><a href="https://2006.igem.org/wiki/index.php/MIT_2006" target="_blank">MIT 2006</a><br />
</span></u></b><br />
<br />
<span lang=ES-MX style='font-size:7.0pt;mso-bidi-font-size:12.0pt;mso-bidi-font-weight: bold'>:<b> <o:p></o:p></b><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><br />
<br />
<span lang=ES-MX style='font-size:12.0pt'><o:p>&nbsp;</o:p><br />
</span></b></p> <br />
</td> <br />
<td width=170 valign=top style='width:127.35pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>BSMT1<o:p></o:p><br />
</span></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>This device produces methyl salicylate in the presence of salicylic acid. Methyl salicylate smells strongly of mint (wintergreen). Production of methyl salicylate was verified both by scent and by gas chromatography: E. coli with no WGD did not produce methyl salicylate when SA was added to the medium, while E. coli with the WGD did produce methyl salicylate when SA was added to the medium..<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr><br />
</table><br />
</div><br />
<br />
<p><b><h2>Project Zoom in</h2></b></p><br />
<p><center><iframe width="600" height="500" src="//www.youtube.com/embed/fd9EQNCOr2k" frameborder="0" allowfullscreen></iframe></center></p><br />
<br><br />
<br />
<p><b><h2>Bibliography/References</h2></b></p><font size="2"><br />
<br />
<p>● Huang, H. (2006, August 30). <i>Part:BBa_B1002. </i> Retrieved August 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002"> http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002</a>.</p><br />
<br />
<p>● iGEM2006_Berkeley. (2006). <i>Part:BBa_J23100</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_J23100"> http://parts.igem.org/Part:BBa_J23100</a>.</p><br />
<br />
<p>● iGEM2006_MIT. (2006). <i>Part:BBa_J45004</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_J45004"> http://parts.igem.org/Part:BBa_J45004</a>. </p><br />
<br />
<p>● iGEM CIDEB Team. (2013). <i>iGEM CIDEB UANL 2013</i>. Retrieved on March 31th, 2014. <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico/Project"> https://2013hs.igem.org/Team:CIDEB-UANL_Mexico/Project</a>. </p><br />
<br />
<p>● iGEM08_TUDelft. (2008). <i>Part:BBa_K115017</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_K115017"> http://parts.igem.org/Part:BBa_K115017</a>. </p><br />
<br />
<p>● MIT IGEM Team. (2006). <i>MIT 2006</i>. Retrieved on March 31th, 2014, from: <a href="https://2006.igem.org/wiki/index.php/MIT_2006"> https://2006.igem.org/wiki/index.php/MIT_2006</a>. </p><br />
<br />
<p>● TUDelft iGEM Team. (2008). <i>TUDelft 2008</i>. Retrieved on March 31th, 2014, from: <a href="https://2008.igem.org/Team:TUDelft"> https://2008.igem.org/Team:TUDelft</a>. </p><br />
<br />
<p>● VictoriaBC. (2009). <i>VictoriaBC 2009</i>. Retrieved on March 31th, 2014, from: <a href="https://2009.igem.org/Team:VictoriaBC"> https://2009.igem.org/Team:VictoriaBC</a>. </p><br />
<br />
<p>● Zubieta, Chole et al. (2003). <i>Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family</i>. Manuscript submitted for publication. Retrieved from <a href="www.plantcell.org"> www.plantcell.org</a>. </p></font><br />
<br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma#"><font color="blue">Return to the Top</font></a></p><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html>{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma
Team:CIDEB-UANL Mexico/project aroma
2014-06-21T03:24:59Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project<br />
</title><br />
<style>body{margin: 0px; width: 100%;padding: 0px;dubackground: #2056ac;font-family: 'Oxygen', sans-serif;font-size: 12pt;background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);}h1, h2, h3{margin: 0;padding-bottom: 5px;color: #404040;}p, ol, ul{margin-top: 0;}ol, ul{padding: 0;list-style: none;}p{line-height: 1.60em;padding- right: 3em;}strong{}a{color: #2056ac;}a:hover{text-decoration: none;}.container{margin: 0px auto;width: 1200px;}.container-text{margin: 0px auto;width: 75%;padding: 0px;font-family: 'Oxygen', sans-serif;font-size: 12pt; text-align: justify;}.wrapper{overflow: hidden;padding: 0em 0em 1em 0em;background: #FFF;}#wrapper1{background: #FFF;}#wrapper2{overflow: hidden;background: #F3F3F3;padding: 5em 0em;text-align: center;}#wrapper3{overflow: hidden;padding: 0em 0em 0em 0em;background: #FFF;}#wrapper4{}#banner{padding-top: 2em;}#welcome{overflow: hidden;width: 1000px;padding: 0em 100px 0em 100px;text-align: center;}#welcome .content{padding: 0em 8em;}#welcome .title h2{}#welcome a,#welcome strong{}.title{margin-bottom: 1em;}.title h2{font-size: 2em;}.title .byline{font-size: 1.1em;color: #6F6F6F#;}#three-column{overflow: hidden;margin-top: 5em;padding-top: 1em;border-top: 1px solid rgba(0,0,0,0.2);text-align: center;}#three-column h2{margin: 1em 0em;font-size: 1.5em;font-weight: 700;}#three-column .icon{position: relative;display: block;margin: 0px auto 0.80em auto;background: none;line-height: 150px;font-size: 4em;width: 150px;height: 100px;border-radius: 100px;border: 6px solid #67128F;text-align: center;color: #FFF;}#three-column #tbox1,#three-column #tbox2,#three-column #tbox3{float: left;width: 320px;padding: 30px 40px 50px 40px;}#three-column .title{text-align: center;}#three-column .title h2{font-size: 1.60em;}#three-column .title .byline{padding-top: 0.50em;font-size: 0.90em;color: #858585;}#three-column .arrow-down{border-top-color: #292929;}ul.tools{margin: 0;padding: 0em 0em 0em 0em;list-style: none;}ul.tools li{display: inline-block;padding: 0em .2em;font-size: 4em;}ul.tools li span{display: none;margin: 0;padding: 0;}ul.tools li a{color: #FFF;}ul.tools li a:before{display: inline-block;background: #1ABC9C;width: 120px;height: 120px;border-radius: 50%;line-height: 120px;text-align: center;color: #FFFFFF;}.button{display: inline-block;margin-top: 2em;padding: 0.8em 2em;background: #64ABD1;line-height: 1.8em;letter-spacing: 1px;text-decoration: none;font-size: 1em;color: #FFF;}.button:before{display: inline-block;background: #8DCB89;margin-right: 1em;width: 40px;height: 40px;line-height: 40px;border-radius: 20px;text-align: center;color: #272925;}.button-small{}#portfolio{overflow: hidden;padding-top: 5em;border-top: 1px solid rgba(0,0,0,0.2);}#portfolio .box{text-align: center;color: rgba(0,0,0,0.5);}#portfolio h3{display: block;padding-bottom: 1em;font-size: 1em;color: rgba(0,0,0,0.6);}#portfolio .title{text-align: center;}#portfolio .title h2{color: rgba(0,0,0,0.8);}.column1,.column2,.column3,.column4{width: 282px;}.column1,.column2,.column3{float: left;margin-right: 24px;}.column4{float: right;}<br />
</style><br />
<br />
<body><br />
<br />
<div class="wrapper"><br />
<br />
<div id="welcome" class="container"> <br />
<br />
<div class="title"> <h2>Aroma Module</h2> <br />
</div><br />
</div><br />
<br />
<div class="container-text"><br />
<br />
<br />
<img width=131 height=127 src="https://static.igem.org/mediawiki/2014hs/5/5c/HandsomeAroma.jpg" align=right hspace=12/><br />
<p align="justify">Since the beginning of iGEM project, the use of fluorescent reporters has been used in each one of the proposed projects in previous years, trying to test the theoretical presence of other proteins in <i>E. coli.</i> For our iGEM 2014 project, this module proposed to promote the usage of aroma reporters, instead of fluorescent ones.</p><br />
<br><br />
<br />
<p><b><h2>Description</h2></b></p><br />
<p>In the module, WinterGreen is the most important part. Normally, it catalyzes the conversion of salicylic acid into methyl salicylate. The protein is excreted by the bacteria and when salicylic acid is added to the medium, a chemical reaction takes place and produces methyl salicylate, which is responsible for the wintergreen odor.</p><br />
<br />
<p>But in this module, it will be regulated by temperature with the use of the RNA thermometer. When adding salicylic acid to the bacteria in a 32° Celsius environment, the production of the WinterGreen protein will begin.</p><br><br />
<br />
<br />
<center><img width=350 height=250 src="https://static.igem.org/mediawiki/2014hs/6/6e/AromaFigure1Bb.png" align=center hspace=12/></center><br />
<center><p><b>Figure 1.</b> Production of Wintergreen Odor</p></center><br />
<br />
<p><b><h2>Device</h2></b></p><br />
<p>Originally, WinterGreen was thought to be the reporter of the Capture module, but in order to prove the function of this gene and also the one in charge of the capture of sodium ions (NhaS), we decided to separate the full device into the actual modules of Capture and Aroma, as seen in the figure below.</p><br />
<br />
<center><br />
<p><img width=450 height=250 src="https://static.igem.org/mediawiki/2014hs/3/32/TestCaptureAndAroma.jpg" align=center hspace=12></p><br />
<p><b>Figure 2.</b> The device originally thought, and the 2 modules derived from it.</p></center><br><br />
<br />
<p>This device is composed by the following parts (see <b>figure 3</b>): a constitutive promoter (1), a RNA thermometer (3); used to regulate the WinterGreen-odor protein production through temperature, a Wintergreen-odor enzyme generator, used to allow the production of methyl salicylate, induced by salicylic acid (2); and a terminator (4). All of these parts are ligated by an 8-bp scar (TACTAGAG).</p><br />
<br />
<center><img width=400 height=170 src="https://static.igem.org/mediawiki/2014hs/5/56/AromaFigure1Aa.png" align=center hspace=12/><br />
<p><b>Figure 3.</b> Aroma Module</p></center><br><br />
<br />
<p>These 4 genetic parts form the Aroma device of the project. The full device's length is 1,251bp (including restriction sites).</p><br />
<br />
<p><b><h2>Parts of the module</h2></b></p><br />
<br><center><div><table class=MsoTable15Grid7ColorfulAccent3 border=1 cellspacing=0 cellpadding=0 width=625 style='width:468.55pt;border-collapse:collapse; border:none;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt'> <tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes; height:15.0pt'> <td width=88 nowrap valign=top style='width:66.1pt;border:none;border-bottom: solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint: 153;mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:517'><b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX;mso-bidi-font-style: italic'>IMAGE</span></b><span lang=ES-MX style='font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:"Times New Roman"; mso-fareast-language:ES-MX;mso-bidi-font-style:italic'><o:p></o:p></span></p> </td> <td width=119 valign=top style='width:89.0pt;border:none;border-bottom:solid #C2D69B 1.0pt; mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint:153; mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>CODE</span></b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></p> </td> <td width=418 nowrap valign=top style='width:313.45pt;border:none;border-bottom: solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint: 153;mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>DESCRIPTION</span></b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:0;height:83.15pt'> <td width=88 nowrap valign=top style='width:66.1pt;border:none;border-right: solid #C2D69B 1.0pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:83.15pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape id="_x0000_s1029" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:10.95pt;margin-top:3.2pt;width:66pt;height:48pt; z-index:251660800;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image007.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=88 height=64 src="https://static.igem.org/mediawiki/2014hs/4/43/PConsAroma.png" align=left hspace=12 v:shapes="_x0000_s1029"><![endif]></p> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><i><span lang=ES-MX style='font-family:Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade: 191;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p>&nbsp;</o:p></span></i></p> </td> <td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; background:#EAF1DD;mso-background-themecolor:accent3;mso-background-themetint: 51;padding:0cm 5.4pt 0cm 5.4pt;height:83.15pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119A</a></span><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'><o:p></o:p></span></p> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p> </td> <td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3; mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:83.15pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>In the specific case of our aroma module, it will help the bacteria to continuously transcribe the <span class=SpellE>WinterGreen</span> gene in order to allow the bacteria to continuously produce the aroma. </span><span class=SpellE><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size: 11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'>This</span></span><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family: Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; color:black;mso-fareast-language:ES-MX'> <span class=SpellE>promoter</span> has a <span class=SpellE>length</span> of 35bp.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:1;height:77.45pt'> <td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:77.45pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape id="_x0000_s1028" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:16.95pt;margin-top:4.25pt;width:57.75pt; height:44.25pt;z-index:251662848;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image009.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=77 height=59 src="https://static.igem.org/mediawiki/2014hs/b/b0/RNAthermAroma.png" align=left hspace=12 v:shapes="_x0000_s1028"><![endif]><i><span lang=ES-MX style='font-family: Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade:191;mso-fareast-language: ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p></td> <td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; padding:0cm 5.4pt 0cm 5.4pt;height:77.45pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><span lang=ES-MX style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K115017">BBa_K115017</a><o:p></o:p></span></p></td> <td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:77.45pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><span style='font-size:12.0pt;mso-bidi-font-size: 11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>A RNA thermometer, used for temperature post-transcriptional regulation (thermo sensor), and is designed to initiate transcription around 32°C.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:2;height:190.6pt'> <td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:190.6pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape id="_x0000_s1027" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:13.95pt;margin-top:3.2pt;width:63pt;height:51.75pt; z-index:251664896;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image011.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=84 height=69 src="https://static.igem.org/mediawiki/2014hs/b/b1/WinterGreenAroma.png" align=left hspace=12 v:shapes="_x0000_s1027"><![endif]><i><span style='font-size:3.0pt;font-family: Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade:191;mso-ansi-language: EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p></td> <td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; background:#EAF1DD;mso-background-themecolor:accent3;mso-background-themetint: 51;padding:0cm 5.4pt 0cm 5.4pt;height:190.6pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; mso-ansi-language:EN-US;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K1255001:Design">BBa_K1255001</a><o:p></o:p></span></p> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p> </td> <td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3; mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:190.6pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>Produces a <span class=SpellE>transferase</span> to convert salicylic acid into methyl salicylate (<span class=SpellE>WinterGreen</span> odor). The wintergreen odor generator requires of 2mM of salicylic acid to produce methyl salicylate. BSMT1 (<a href="http://parts.igem.org/Part:BBa_J45004">BBa_J45004</a>), <span class=SpellE>WinterGreen</span> Odor Generator original name, was created by <a href="https://2006.igem.org/wiki/index.php/MIT_2006">MIT 2006</a>. This year, the team optimized the sequence for <i>Escherichia coli</i>. </span><span class=SpellE><span lang=ES-MX style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'>The</span></span><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family: Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; color:black;mso-fareast-language:ES-MX'> new <span class=SpellE>biobrick</span> has a <span class=SpellE>length</span> of 1,074bp.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes;height:70.7pt'> <td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:70.7pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape id="_x0000_s1026" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:18pt;margin-top:1.85pt;width:59.1pt;height:49.4pt; z-index:251666944;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image013.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=79 height=66 src="https://static.igem.org/mediawiki/2014hs/6/62/TerminatorAroma.png" align=left hspace=12 v:shapes="_x0000_s1026"><![endif]></p> </td> <td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; padding:0cm 5.4pt 0cm 5.4pt;height:70.7pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><span lang=ES-MX style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a><o:p></o:p></span></p> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'>&nbsp;</p> </td> <td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:70.7pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><span style='font-size:12.0pt;mso-bidi-font-size: 11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>Part made of 6bp, responsible for transcription stop. The terminator stops the production of methyl salicylate. <o:p></o:p></span></p> </td> </tr></table></div></center><br><br />
<br />
<p><b><h2>Justification</h2></b></p><br />
<p>Different to fluorescent reporters, this module was made in order to (in the future) perform as an aroma reporter and also to test the correct function of the bacteria, for its future usage as a new reporter and functional part (CDS). It is desired to use this part in the project to replace the red fluorescent protein (RFP) in the Capture module. But it was preferable to test it apart to demonstrate its effectiveness. Similarly, this piece is also helpful when the biofilter is assembled, because when performing the filtration by silica, WinterGreen can demonstrate the presence of bacteria in the beads. </p><br />
<br />
<p>The team added the RNA thermometer in the device for regulating the production of the aroma. Another reason for selecting the RNA thermometer as a regulator was to continue the CIDEB UANL 2013 work with it.</p><br />
<br />
<p><b><h2>Other teams that used RNA thermometer and BSMT1</h2></b></p><br />
<br />
<div align=center width="80%" ><br />
<table border=1 cellspacing=0 cellpadding=0 style='border-collapse:collapse;border:none;mso-border-alt:solid #C2D69B .5pt; mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh: .5pt solid #C2D69B;mso-border-insidev:.5pt solid #C2D69B'> <br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #9BBB59 1.0pt; border-right:none;mso-border-top-alt:solid #9BBB59 .5pt;mso-border-left-alt: solid #9BBB59 .5pt;mso-border-bottom-alt:solid #9BBB59 .5pt;background:#9BBB59; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><b><br />
<br />
<span style='font-size:12.0pt; color:white;mso-ansi-language:EN-US'>Team<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #9BBB59 1.0pt; border-left:none;mso-border-top-alt:solid #9BBB59 .5pt;mso-border-bottom-alt: solid #9BBB59 .5pt;mso-border-right-alt:solid #9BBB59 .5pt;background:#9BBB59; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><b><br />
<br />
<span style='font-size:12.0pt; color:white;mso-ansi-language:EN-US'>Part Used<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border:solid #9BBB59 1.0pt; border-left:none;mso-border-top-alt:solid #9BBB59 .5pt;mso-border-bottom-alt: solid #9BBB59 .5pt;mso-border-right-alt:solid #9BBB59 .5pt;background:#9BBB59; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><b><br />
<br />
<span style='font-size:12.0pt; color:white;mso-ansi-language:EN-US'>Use<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
</tr><br />
<br />
<tr style='mso-yfti-irow:1;height:33.0pt'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt;height:33.0pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><br />
<br />
<span lang=FR style='font-size:12.0pt;color:#4F81BD;mso-ansi-language: FR'><a href="https://2008.igem.org/Team:TUDelft" target="_blank">TuDelft 2008</a><br />
</span></u></b><br />
<br />
<span lang=FR style='font-size:6.0pt;mso-bidi-font-size:12.0pt;mso-ansi-language:FR; mso-bidi-font-weight:bold'>:<br />
</span><b><br />
<br />
<span lang=FR style='font-size:12.0pt; mso-ansi-language:FR'><o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=170 valign=top style='width:127.35pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt; height:33.0pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>RNA themometer<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt; height:33.0pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>Temperature-sensing bacteria that changes color at different temperatures; as a temperature reporter system inlarge-scale fermentations, or as a temperature-inducible protein production system.<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:2'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><br />
<br />
<span style='font-size:12.0pt;color:#4F81BD;mso-ansi-language: EN-US'><a href="https://2009.igem.org/Team:VictoriaBC" target="_blank">Victoria BC 2009</a><br />
</span></u></b><br />
<br />
<span style='font-size:6.0pt;mso-bidi-font-size:12.0pt;mso-ansi-language:EN-US; mso-bidi-font-weight:bold'>:<b> <o:p></o:p></b><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></b></p> <br />
</td> <br />
<td width=170 valign=top style='width:127.35pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>RNA themometer<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>NAND logic gate using the ribo-key/ribo-lock system designed by <a href="https://2006.igem.org/wiki/index.php/Berkeley">Berkeley 2006</a> team , producing RFP except when the cells are grown in the presence of both arabinose and IPTG, also coupling fluorescent outputs with the ribo-thermometers made by TUDelft 2008 team.<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
</tr><br />
<tr style='mso-yfti-irow:2'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><br />
<br />
<span style='font-size:12.0pt;color:#4F81BD;mso-ansi-language: EN-US'><a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico" target="_blank">CIDEB UANL 2013</a><br />
</span></u></b><br />
<br />
<span style='font-size:6.0pt;mso-bidi-font-size:12.0pt;mso-ansi-language:EN-US; mso-bidi-font-weight:bold'>:<b> <o:p></o:p></b><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></b></p> <br />
</td> <br />
<td width=170 valign=top style='width:127.35pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>RNA themometer<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>Production of Vip3ca3, which acts as a pesticide protein, regulated by specific temperatures in order to avoid overproduction and it will show activity against target organisms Coleoptera and Lepidoptera..<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;color:#4F81BD'><a href="https://2006.igem.org/wiki/index.php/MIT_2006" target="_blank">MIT 2006</a><br />
</span></u></b><br />
<br />
<span lang=ES-MX style='font-size:7.0pt;mso-bidi-font-size:12.0pt;mso-bidi-font-weight: bold'>:<b> <o:p></o:p></b><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><br />
<br />
<span lang=ES-MX style='font-size:12.0pt'><o:p>&nbsp;</o:p><br />
</span></b></p> <br />
</td> <br />
<td width=170 valign=top style='width:127.35pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>BSMT1<o:p></o:p><br />
</span></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>This device produces methyl salicylate in the presence of salicylic acid. Methyl salicylate smells strongly of mint (wintergreen). Production of methyl salicylate was verified both by scent and by gas chromatography: E. coli with no WGD did not produce methyl salicylate when SA was added to the medium, while E. coli with the WGD did produce methyl salicylate when SA was added to the medium..<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr><br />
</table><br />
</div><br />
<br />
<p><b><h2>Project Zoom in</h2></b></p><br />
<p><center><iframe width="600" height="500" src="//www.youtube.com/embed/fd9EQNCOr2k" frameborder="0" allowfullscreen></iframe></center></p><br />
<br><br />
<br />
<p><b><h2>Bibliography/References</h2></b></p><font size="2"><br />
<br />
<p>● Huang, H. (2006, August 30). <i>Part:BBa_B1002. </i> Retrieved August 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002"> http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002</a>.</p><br />
<br />
<p>● iGEM2006_Berkeley. (2006). <i>Part:BBa_J23100</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_J23100"> http://parts.igem.org/Part:BBa_J23100</a>.</p><br />
<br />
<p>● iGEM2006_MIT. (2006). <i>Part:BBa_J45004</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_J45004"> http://parts.igem.org/Part:BBa_J45004</a>. </p><br />
<br />
<p>● iGEM CIDEB Team. (2013). <i>iGEM CIDEB UANL 2013</i>. Retrieved on March 31th, 2014. <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico/Project"> https://2013hs.igem.org/Team:CIDEB-UANL_Mexico/Project</a>. </p><br />
<br />
<p>● iGEM08_TUDelft. (2008). <i>Part:BBa_K115017</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_K115017"> http://parts.igem.org/Part:BBa_K115017</a>. </p><br />
<br />
<p>● MIT IGEM Team. (2006). <i>MIT 2006</i>. Retrieved on March 31th, 2014, from: <a href="https://2006.igem.org/wiki/index.php/MIT_2006"> https://2006.igem.org/wiki/index.php/MIT_2006</a>. </p><br />
<br />
<p>● TUDelft iGEM Team. (2008). <i>TUDelft 2008</i>. Retrieved on March 31th, 2014, from: <a href="https://2008.igem.org/Team:TUDelft"> https://2008.igem.org/Team:TUDelft</a>. </p><br />
<br />
<p>● VictoriaBC. (2009). <i>VictoriaBC 2009</i>. Retrieved on March 31th, 2014, from: <a href="https://2009.igem.org/Team:VictoriaBC"> https://2009.igem.org/Team:VictoriaBC</a>. </p><br />
<br />
<p>● Zubieta, Chole et al. (2003). <i>Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family</i>. Manuscript submitted for publication. Retrieved from <a href="www.plantcell.org"> www.plantcell.org</a>. </p></font><br />
<br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma#"><font color="blue">Return to the Top</font></a></p><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html>{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/File:Alcorta.jpg
File:Alcorta.jpg
2014-06-21T03:15:58Z
<p>UnicornioMagico: </p>
<hr />
<div></div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_abstract
Team:CIDEB-UANL Mexico/project abstract
2014-06-21T03:14:13Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1" /><br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style>body{margin:0;width:100%;padding:0;background:#2056ac;font-family:'Oxygen',sans-serif;font-size:12pt;background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif)}h1,h2,h3{margin:0;padding-bottom:5px;color:#404040}p,ol,ul{margin-top:0}ol,ul{padding:0;list-style:none}p{line-height:1.60em;padding- right:3em}a{color:#2056ac}a:hover{text-decoration:none}.container{margin:0 auto;width:1200px}.container-text{margin:0 auto;width:75%;padding:0;font-family:'Oxygen',sans-serif;font-size:12pt;text-align:justify}.wrapper{overflow:hidden;padding:0 0 1em 0;background:#FFF}#wrapper1{background:#FFF}#wrapper2{overflow:hidden;background:#f3f3f3;padding:5em 0;text-align:center}#wrapper3{overflow:hidden;padding:0;background:#FFF}#banner{padding-top:2em}#welcome{overflow:hidden;width:1000px;padding:0 100px 0 100px;text-align:center}#welcome .content{padding:0 8em}.title{margin-bottom:1em}.title h2{font-size:2em}.title .byline{font-size:1.1em;color:#6F6F6F#}#three-column{overflow:hidden;margin-top:5em;padding-top:1em;border-top:1px solid rgba(0,0,0,0.2);text-align:center}#three-column h2{margin:1em 0;font-size:1.5em;font-weight:700}#three-column .icon{position:relative;display:block;margin:0 auto .80em auto;background:0;line-height:150px;font-size:4em;width:150px;height:100px;border-radius:100px;border:6px solid #67128f;text-align:center;color:#FFF}#three-column #tbox1,#three-column #tbox2,#three-column #tbox3{float:left;width:320px;padding:30px 40px 50px 40px}#three-column .title{text-align:center}#three-column .title h2{font-size:1.60em}#three-column .title .byline{padding-top:.50em;font-size:.90em;color:#858585}#three-column .arrow-down{border-top-color:#292929}ul.tools{margin:0;padding:0;list-style:none}ul.tools li{display:inline-block;padding:0 .2em;font-size:4em}ul.tools li span{display:none;margin:0;padding:0}ul.tools li a{color:#FFF}ul.tools li a:before{display:inline-block;background:#1abc9c;width:120px;height:120px;border-radius:50%;line-height:120px;text-align:center;color:#fff}.button{display:inline-block;margin-top:2em;padding:.8em 2em;background:#64abd1;line-height:1.8em;letter-spacing:1px;text-decoration:none;font-size:1em;color:#FFF}.button:before{display:inline-block;background:#8dcb89;margin-right:1em;width:40px;height:40px;line-height:40px;border-radius:20px;text-align:center;color:#272925}#portfolio{overflow:hidden;padding-top:5em;border-top:1px solid rgba(0,0,0,0.2)}#portfolio .box{text-align:center;color:rgba(0,0,0,0.5)}#portfolio h3{display:block;padding-bottom:1em;font-size:1em;color:rgba(0,0,0,0.6)}#portfolio .title{text-align:center}#portfolio .title h2{color:rgba(0,0,0,0.8)}.column1,.column2,.column3,.column4{width:282px}.column1,.column2,.column3{float:left;margin-right:24px}.column4{float:right}</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Abstract</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<p align="justify"><p>iGEM CIDEB 2014’s project consists on a biological filter in which sodium ions are taken out of saltwater. To achieve this objective, the project reunited 4 different genes, each one giving <i>E. coli</i> a certain ability to perform a specific task.</p><br />
<p>This year’s project consists of two devices: the first and main one is in charge of the removal of sodium ions. This device uses an aroma to report its effectivity. The second one is responsible of giving resistance to the bacteria to outstand conditions that would normally kill it, and also giving <i>E.coli</i> the ability to bind to silica or glass surfaces.</p><br />
<p>Even though the project was originally composed by this two devices, for experimental purposes it was divided into four different modules. These modules are named after their function, and the name of the project “E.CARU” is an acronym of each one of them.</p><br />
<p>The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank">Capture</a> module uses a completely new gene in iGEM that encodes for a protein that introduces sodium ions into the bacteria. The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank">Aroma</a> module is in charge of producing a mint-like odor in order to report the functionality of the Capture module. The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance" target="_blank">Resistance </a> module allows <i>E. coli</i> to withstand the salinity of the environment in which it is required to work, and finally, the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union" target="_blank"> Union</a> module causes the bacteria to join to silica or glass surfaces, giving it the ability to act as a biofilter.<br />
</p><br />
</div><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Problem</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<table width=100%><br />
<tr><br />
<td><br />
<p>Water has been always known as a source of life, but nowadays there is not enough usable fresh water available in the world. The global lack of fresh water is an issue that presents a dangerous problem to our future. Only a small portion of our planet's water is actually usable. Ninety-seven percent of the world's water is too salty for consumption or agricultural use. Furthermore, much of the rest is held in ice caps or other unattainable sources. This leaves approximately one percent of the global water as liquid and fresh; ninety-eight percent of which is groundwater (Bouwer, 2002).</p><br />
<p>For solving this problem different methods have been developed. One of them is desalination, converting sea water (rich in salts) into usable water, but this method is very expensive due to the great use of electrical energy and the extraction process produces dangerous wastes to the environment (Cotruvo, 2010).</p><br />
</td><br />
<td style="padding-left:12px"><br />
<img width=265 height=243 src="https://static.igem.org/mediawiki/2014hs/archive/c/c9/20140609211415%21Logo.png"/><br />
</td><br />
</tr><br />
</table><br />
<p>For that reason our project is focused on developing a biological machine capable of performing desalination, reducing costs and avoiding dangerous wastes during the process. For making this possible, <em>E. coli</em> needed to capture Na<SUP>+</SUP> ions in saline environments to be removed from water after performing its task.</p><br />
</div><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Overview</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<p>Before&nbsp;<em>E. coli</em>&nbsp;could be able to remove Na<sup>+</sup> ions from water, it needed to aquire a resistance to adverse conditions, in particular excess salt. This could be possible through a protein called &ldquo;IrrE&rdquo;, which makes&nbsp;<em>E. coli</em>&nbsp;resistant to saline environments as well as UV rays and temperature changes.<br /><br />
The protein NhaS (a new part), was used to give <em>E. coli</em> the ability to bind and capture Na+ ions. Also, the optimized version of the reporter &ldquo;BSMT1&rdquo;, a protein able to react with salicylic acid and release a Wintergreen odor, was used to know if nhaS was expressed.<br /><br />
The final task that&nbsp;<em>E. coli</em>&nbsp;should perform was to bind its membrane to silica pearls, in order to be able to be removed from the water after taking out Na<sup>+</sup> ions. In order to do this, a fusion protein named L2+AIDA was used. L2 gives&nbsp;<em>E. coli</em>&nbsp;the ability to bind silica, and AIDA acts as a tag for making L2 a membrane protein. With this ability&nbsp;<em>E. coli</em>&nbsp;could be removed from water through a bio-filter, made up of silica.<br /><br />
The complete circuit is shown in&nbsp;<strong>figure 1</strong>. BSMT1 opt acts as a reporter for nhaS which is regulated by UV (to have a control over the NhaS expression), and IrrE with L2+AIDA are continuously produced.</p><br />
<p align="justify">&nbsp;</p><br />
<center><br />
<p><img width=552 height=313 src="https://static.igem.org/mediawiki/2014hs/6/6a/Correct_circuit_cideb.png" align=center hspace=12 alt="IMG_0317"></p><br />
<p><b>Figure 1.</b> Diagram representing our proposed circuit</p><br />
</center><br />
<p>But we realized <i>E. coli</i> could have a genetic overload because the circuit was too big (approximately 5000 bp). Also the time we had to finish it was not enough, as well as most of the proteins we wanted to produce were putative or untested. So for a better understanding and for determine if each piece works we divided the project into four modules: capture, union, aroma and resistance, but the project is the result of their correlation. In fact our <i>E. coli</i> was named E. CARU (each letter by each module). </p><br />
<center><br />
<table width=60%><br />
<tr><br />
<td><br />
<p><b>E</b>scherichia coli</p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank"><b>C</b>apture</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><b>A</b>roma</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance" target="_blank"><b>R</b>esistance </a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union" target="_blank"><b>U</b>nion</a></p><br />
</td><br />
<td style="padding-left:12px"><img width=286 height=285 src="https://static.igem.org/mediawiki/2014hs/3/30/Image006cideb2014.png"/><br />
</td><br />
</tr><br />
</table><br />
</center><br />
<p><b><h2>Project Zoom In</h2></b></p><br />
<center><iframe width="854" height="510" src="//www.youtube.com/embed/dflyBM3WNxE" frameborder="0" allowfullscreen></iframe></center> <br />
<p><b><h2>Bibliography/References</h2></b></p><br />
<font size="2"><br />
<p>● Bouwer, H. (2002). Integrated Water Management for the 21st Century: Problems and Solutions. Journal of irrigation and drainage engineering, 193-200.</p><br />
<p>● Joseph Cotruvo, N. V. (2010). Desalination Technology: Health and Environmental Impacts. U.S: Taylor and Francis Group.</p><br><br />
<div style="text-align:right"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_abstract#"><font color="blue">Return to the Top</font></a></p></div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/team
Team:CIDEB-UANL Mexico/team
2014-06-21T02:56:19Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_team}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Students</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<center><br />
<br />
<br />
</br><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='margin-left:-44.25pt;border-collapse:collapse;border:none;mso-yfti-tbllook:<br />
1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:<br />
none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes'><br />
<td width=491 style='width:368.6pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
class=MsoIntenseEmphasis><span lang=ES-MX style='font-size:14.0pt;mso-bidi-font-size:<br />
10.0pt;font-style:normal;mso-bidi-font-style:italic'>Angelina G. Miranda Lara<o:p></o:p></span></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
lang=ES-MX style='font-size:12.0pt;color:windowtext'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
lang=ES-MX style='font-size:12.0pt;color:windowtext'>Age: 17 <o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'>-Nickname: </span><b<br />
style='mso-bidi-font-weight:normal'><span style='font-size:14.0pt;mso-bidi-font-size:<br />
12.0pt;color:#00B050;mso-ansi-language:EN-US'>Angie</span></b><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'> <o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'>Hobbies: Singing, reading,<br />
sleeping (lots) and yes, talk through a Walkie. <o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'>What do you want to study?<br />
Medicine :)<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Why <span style='color:#E36C0A;mso-themecolor:<br />
accent6;mso-themeshade:191'>iGEM</span>? Because I love anything related to<br />
science and I love learning something new. I think biology is the most<br />
interesting science so why not?<o:p></o:p></span></p><br />
</td><br />
<td width=204 style='width:153.3pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='text-align:center;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US;mso-fareast-language:EN-US;<br />
mso-no-proof:yes'><!--[if gte vml 1]><v:shape id="Picture_x0020_16" o:spid="_x0000_i1048"<br />
type="#_x0000_t75" style='width:141.75pt;height:141.75pt;visibility:visible;<br />
mso-wrap-style:square'><br />
<v:imagedata src="https://static.igem.org/mediawiki/2014hs/0/0e/Angie.jpg" o:title="" cropleft="10699f"<br />
cropright="10880f"/><br />
</v:shape><![endif]--><![if !vml]><img width=189 height=189<br />
src="https://static.igem.org/mediawiki/2014hs/0/0e/Angie.jpg" v:shapes="Picture_x0020_16"><![endif]></span><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoListParagraph style='margin-left:21.3pt;mso-add-space:auto'><strong><span<br />
lang=ES-MX style='font-size:18.0pt;mso-bidi-font-size:10.0pt;line-height:115%;<br />
font-family:"Baskerville Old Face","serif";mso-bidi-font-family:Arial;<br />
font-weight:normal;mso-bidi-font-weight:bold'><o:p>&nbsp;</o:p></span></strong></p><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='border-collapse:collapse;border:none;mso-yfti-tbllook:1184;mso-padding-alt:<br />
0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes'><br />
<td width=206 style='width:154.8pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='text-align:center;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US;mso-fareast-language:EN-US;<br />
mso-no-proof:yes'><!--[if gte vml 1]><v:shape id="Picture_x0020_1" o:spid="_x0000_i1047"<br />
type="#_x0000_t75" style='width:143.25pt;height:141.75pt;visibility:visible;<br />
mso-wrap-style:square'><br />
<v:imagedata src="InfoTeam_archivos/image009.png" o:title="" cropleft="10758f"<br />
cropright="10368f"/><br />
</v:shape><![endif]--><![if !vml]><img width=191 height=189<br />
src="https://static.igem.org/mediawiki/2014hs/6/6c/Vala.jpg" v:shapes="Picture_x0020_1"><![endif]></span><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
<td width=491 style='width:368.0pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='line-height:normal'><span class=MsoIntenseEmphasis><span<br />
lang=ES-MX style='font-size:14.0pt;mso-bidi-font-size:10.0pt;font-style:normal;<br />
mso-bidi-font-style:italic'>Diego Iván Valadez Lozano<o:p></o:p></span></span></p><br />
<p class=MsoNormal style='line-height:normal'><span lang=ES-MX<br />
style='font-size:12.0pt'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal style='line-height:normal;tab-stops:172.95pt'><span<br />
lang=ES-MX style='font-size:12.0pt'><span style='mso-spacerun:yes'> </span>Age:<br />
18<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal;tab-stops:172.95pt'><span<br />
lang=ES-MX style='font-size:12.0pt'><span style='mso-spacerun:yes'> </span></span><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'>Nickname: </span><b<br />
style='mso-bidi-font-weight:normal'><span style='font-size:14.0pt;mso-bidi-font-size:<br />
12.0pt;color:#00B050;mso-ansi-language:EN-US'>Vala </span></b><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal;tab-stops:172.95pt'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Hobbies: Eat, watch movies and play<br />
videogames. <o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal;tab-stops:172.95pt'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>What do you want to study? Computer Sciences<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal;tab-stops:172.95pt'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Why <span style='color:#E36C0A;mso-themecolor:<br />
accent6;mso-themeshade:191'>iGEM</span>?<span style='mso-spacerun:yes'> <br />
</span>Because I became interested in the applications of this science and I<br />
wanted to learn the work in a molecular lab.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal align=right style='text-align:right'><span style='font-size:<br />
12.0pt;line-height:115%;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></p><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='margin-left:-44.25pt;border-collapse:collapse;border:none;mso-yfti-tbllook:<br />
1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:<br />
none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes;<br />
height:3.5pt'><br />
<td width=491 style='width:368.6pt;padding:0cm 5.4pt 0cm 5.4pt;height:3.5pt'><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
class=MsoIntenseEmphasis><span lang=ES-MX style='font-size:14.0pt;mso-bidi-font-size:<br />
10.0pt;font-style:normal;mso-bidi-font-style:italic'>Arnulfo A. Peña<o:p></o:p></span></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
lang=ES-MX style='font-size:12.0pt'><span style='mso-spacerun:yes'> </span>Age:<br />
18<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
lang=ES-MX style='font-size:12.0pt'><span style='mso-spacerun:yes'> </span>Nickname:<br />
</span><b style='mso-bidi-font-weight:normal'><span lang=ES-MX<br />
style='font-size:14.0pt;mso-bidi-font-size:12.0pt;color:#00B050'>18+ (18<br />
mas), papá pato.</span></b><span lang=ES-MX style='font-size:14.0pt;<br />
mso-bidi-font-size:12.0pt;color:#00B050'><span style='mso-spacerun:yes'> <br />
</span></span><span lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
lang=ES-MX style='font-size:12.0pt'><span style='mso-spacerun:yes'> </span></span><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'>Hobbies: Dance, play videogames, practice martial arts, listening to music and being very curious <o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>What do you want to study?<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'>I want biotechnology or<br />
nanotechnology<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Why <span style='color:#E36C0A;mso-themecolor:<br />
accent6;mso-themeshade:191'>iGEM</span>? <span<br />
style='mso-spacerun:yes'> </span>Because it is a very interesting competence for it involves a lot of biology and also the implementation of new ways of scientific manipulation in order to create something better and improve the actual processes as well. I think that the area of biotechnology doesn't have a limit and that inspired me to join this team.<o:p></o:p></span></p><br />
</td><br />
<td width=204 style='width:153.3pt;padding:0cm 5.4pt 0cm 5.4pt;height:3.5pt'><br />
<p class=MsoNormal align=center style='text-align:center;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US;mso-fareast-language:EN-US;<br />
mso-no-proof:yes'><!--[if gte vml 1]><v:shape id="Picture_x0020_3" o:spid="_x0000_i1046"<br />
type="#_x0000_t75" style='width:142.5pt;height:141.75pt;visibility:visible;<br />
mso-wrap-style:square'><br />
<v:imagedata src="InfoTeam_archivos/image011.png" o:title="" cropleft="8969f"<br />
cropright="12877f"/><br />
</v:shape><![endif]--><![if !vml]><img width=190 height=189<br />
src="https://static.igem.org/mediawiki/2014hs/b/bb/Aramis.jpg" v:shapes="Picture_x0020_3"><![endif]></span><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal align=right style='text-align:right'><span lang=ES-MX<br />
style='font-size:12.0pt;line-height:115%'><o:p>&nbsp;</o:p></span></p><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='border-collapse:collapse;border:none;mso-yfti-tbllook:1184;mso-padding-alt:<br />
0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes'><br />
<td width=206 style='width:154.25pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='text-align:center;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US;mso-fareast-language:EN-US;<br />
mso-no-proof:yes'><!--[if gte vml 1]><v:shape id="Picture_x0020_2" o:spid="_x0000_i1045"<br />
type="#_x0000_t75" style='width:142.5pt;height:141.75pt;visibility:visible;<br />
mso-wrap-style:square'><br />
<v:imagedata src="InfoTeam_archivos/image013.png" o:title="" cropleft="9335f"<br />
cropright="12118f"/><br />
</v:shape><![endif]--><![if !vml]><img width=190 height=189<br />
src="https://static.igem.org/mediawiki/2014hs/d/db/To%C3%B1o.jpg" v:shapes="Picture_x0020_2"><![endif]></span><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
<td width=491 style='width:13.0cm;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='line-height:normal'><span class=MsoIntenseEmphasis><span<br />
lang=ES-MX style='font-size:14.0pt;mso-bidi-font-size:10.0pt;font-style:normal;<br />
mso-bidi-font-style:italic'>Antonio Cárdenas Hernández<o:p></o:p></span></span></p><br />
<p class=MsoNormal style='line-height:normal'><span lang=ES-MX<br />
style='font-size:12.0pt'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span lang=ES-MX<br />
style='font-size:12.0pt'><span style='mso-spacerun:yes'> </span>Age: 17<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span lang=ES-MX<br />
style='font-size:12.0pt'><span style='mso-spacerun:yes'> </span>Nickname: </span><b<br />
style='mso-bidi-font-weight:normal'><span lang=ES-MX style='font-size:14.0pt;<br />
mso-bidi-font-size:12.0pt;color:#00B050'>Toño, no Tony</span></b><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span lang=ES-MX<br />
style='font-size:12.0pt'><span style='mso-spacerun:yes'> </span></span><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'>Hobbies: Reading, play video<br />
games, play basketball, but mostly: Be Weird, BE SAFER!!!<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>What do you<br />
want to study? Medical Biotechnology and Neurology<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Why <span<br />
style='color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191'>iGEM</span>?<br />
iGEM is a big opportunity to demonstrate and to acquire more knowledge in diverse areas, including biology, laboratory and math, social sciences; and also it represents a big challenge: I’ll never regret for taking it!!!<o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal align=right style='text-align:right'><span style='font-size:<br />
12.0pt;line-height:115%;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></p><br />
<br />
<p class=MsoNormal align=right style='text-align:right'><span style='font-size:<br />
12.0pt;line-height:115%;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></p><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='margin-left:-44.25pt;border-collapse:collapse;border:none;mso-yfti-tbllook:<br />
1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:<br />
none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes;<br />
height:105.95pt'><br />
<td width=491 style='width:368.6pt;padding:0cm 5.4pt 0cm 5.4pt;height:105.95pt'><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
class=MsoIntenseEmphasis><span style='font-size:14.0pt;mso-bidi-font-size:<br />
10.0pt;mso-ansi-language:EN-US;font-style:normal;mso-bidi-font-style:italic'>Odalisse<br />
Ibarra<o:p></o:p></span></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Age: 16<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Nickname: </span><b style='mso-bidi-font-weight:<br />
normal'><span style='font-size:14.0pt;mso-bidi-font-size:12.0pt;color:#00B050;<br />
mso-ansi-language:EN-US'>Ody</span></b><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'> <o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Hobbies: skateboarding, watch movies<br />
(fantasy drama films, science fiction psychological thriller films), reading,<br />
listening to my favorite music, go to the cinema *alone* <o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>What do you want to study?Mechatronics(?) Medicine(?) Architecture(?) my idea of studying at this moment is unclear, but any of the above are my interests. <o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Why <span style='color:#E36C0A;mso-themecolor:<br />
accent6;mso-themeshade:191'>iGEM</span>? Because I had never been in a disciplinary project that has significant and real applications. Moreover, I’ve always had preferences in science.<o:p></o:p></span></p><br />
</td><br />
<td width=202 style='width:151.8pt;padding:0cm 5.4pt 0cm 5.4pt;height:105.95pt'><br />
<p class=MsoNormal align=center style='text-align:center;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US;mso-fareast-language:EN-US;<br />
mso-no-proof:yes'><!--[if gte vml 1]><v:shape id="Picture_x0020_15" o:spid="_x0000_i1044"<br />
type="#_x0000_t75" style='width:141pt;height:141pt;visibility:visible;<br />
mso-wrap-style:square'><br />
<v:imagedata src="InfoTeam_archivos/image015.png" o:title="" cropleft="11460f"<br />
cropright="10285f"/><br />
</v:shape><![endif]--><![if !vml]><img width=188 height=188<br />
src="https://static.igem.org/mediawiki/2014hs/c/c1/Oda.jpg" v:shapes="Picture_x0020_15"><![endif]></span><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal align=right style='text-align:right'><span lang=ES-MX<br />
style='font-size:12.0pt;line-height:115%'><o:p>&nbsp;</o:p></span></p><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='border-collapse:collapse;border:none;mso-yfti-tbllook:1184;mso-padding-alt:<br />
0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes'><br />
<td width=206 style='width:154.25pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='text-align:center;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US;mso-fareast-language:EN-US;<br />
mso-no-proof:yes'><!--[if gte vml 1]><v:shape id="Picture_x0020_17" o:spid="_x0000_i1043"<br />
type="#_x0000_t75" style='width:141pt;height:141.75pt;visibility:visible;<br />
mso-wrap-style:square'><br />
<v:imagedata src="InfoTeam_archivos/image017.png" o:title="" cropleft="9472f"<br />
cropright="12878f"/><br />
</v:shape><![endif]--><![if !vml]><img width=188 height=189<br />
src="https://static.igem.org/mediawiki/2014hs/a/a9/Yisus.jpg" v:shapes="Picture_x0020_17"><![endif]></span><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
<td width=491 style='width:13.0cm;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='line-height:normal'><span class=MsoIntenseEmphasis><span<br />
lang=ES-MX style='font-size:14.0pt;mso-bidi-font-size:10.0pt;font-style:normal;<br />
mso-bidi-font-style:italic'>Jesus Delgadillo<o:p></o:p></span></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Age: 16<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Nickname: </span><b<br />
style='mso-bidi-font-weight:normal'><span style='font-size:14.0pt;mso-bidi-font-size:<br />
12.0pt;color:#00B050;mso-ansi-language:EN-US'>Yisus</span></b><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'> <o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Hobbies: Reading<br />
novels; drawing machines; cooking and then eating; Leave some boogie on the<br />
dance floor; Watch movies in foreing languages (some with subtitles); make<br />
people laugh.<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>What do you<br />
want to study? <o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'>I don't know what will I study; maybe something<br />
related with arts and humanities.<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Why<span<br />
style='color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191'> iGEM</span>?<br />
Because the lab procedures are really interesting for me; iGEM is a big project which comprehends many activities, people and skills.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal align=right style='text-align:right'><span style='font-size:<br />
12.0pt;line-height:115%;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></p><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='margin-left:-44.25pt;border-collapse:collapse;border:none;mso-yfti-tbllook:<br />
1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:<br />
none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes'><br />
<td width=491 style='width:368.6pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
class=MsoIntenseEmphasis><span lang=ES-MX style='font-size:14.0pt;mso-bidi-font-size:<br />
10.0pt;font-style:normal;mso-bidi-font-style:italic'>Jorge Luis Hernandez<br />
Ayala<o:p></o:p></span></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
lang=ES-MX style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span></span><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'>Age: 17<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Nickname: </span><b style='mso-bidi-font-weight:<br />
normal'><span style='font-size:14.0pt;mso-bidi-font-size:12.0pt;color:#00B050;<br />
mso-ansi-language:EN-US'>Choche</span></b><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Hobbies:Blogging, reading, growing trees and<br />
annoying my cats<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>What do you want to study?: Medicine?,<br />
Biotechnology?, Aeronautics engineering?; I still don’t know yet, but I know<br />
it will be something related to science and its applications.<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Why <span style='color:#E36C0A;mso-themecolor:<br />
accent6;mso-themeshade:191'>iGEM</span>? Because it is the most interesting project that I have been involved, and I love practical applications for the biology and doing things in the lab.<o:p></o:p></span></p><br />
</td><br />
<td width=204 style='width:153.3pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='text-align:center;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US;mso-fareast-language:EN-US;<br />
mso-no-proof:yes'><!--[if gte vml 1]><v:shape id="Picture_x0020_10" o:spid="_x0000_i1042"<br />
type="#_x0000_t75" style='width:141.75pt;height:141.75pt;visibility:visible;<br />
mso-wrap-style:square'><br />
<v:imagedata src="InfoTeam_archivos/image019.png" o:title="" cropleft="11122f"<br />
cropright="10619f"/><br />
</v:shape><![endif]--><![if !vml]><img width=189 height=189<br />
src="https://static.igem.org/mediawiki/2014hs/f/fe/Jorge.jpg" v:shapes="Picture_x0020_10"><![endif]></span><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal><span lang=ES-MX style='font-size:12.0pt;line-height:115%'><o:p>&nbsp;</o:p></span></p><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='border-collapse:collapse;border:none;mso-yfti-tbllook:1184;mso-padding-alt:<br />
0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes'><br />
<td width=206 style='width:154.25pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='text-align:center;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US;mso-fareast-language:EN-US;<br />
mso-no-proof:yes'><!--[if gte vml 1]><v:shape id="Picture_x0020_4" o:spid="_x0000_i1041"<br />
type="#_x0000_t75" style='width:142.5pt;height:141.75pt;visibility:visible;<br />
mso-wrap-style:square'><br />
<v:imagedata src="InfoTeam_archivos/image021.png" o:title=""/><br />
</v:shape><![endif]--><![if !vml]><img width=190 height=189<br />
src="https://static.igem.org/mediawiki/2014hs/e/ea/Adribubu.jpg" v:shapes="Picture_x0020_4"><![endif]></span><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
<td width=491 style='width:13.0cm;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='line-height:normal'><span class=MsoIntenseEmphasis><span<br />
lang=ES-MX style='font-size:14.0pt;mso-bidi-font-size:10.0pt;font-style:normal;<br />
mso-bidi-font-style:italic'>Adrian Alejandro Rodríguez Rodríguez<o:p></o:p></span></span></p><br />
<p class=MsoNormal style='line-height:normal'><span lang=ES-MX<br />
style='font-size:12.0pt'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span lang=ES-MX<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span></span><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'>Age: 17<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Nickname: </span><b<br />
style='mso-bidi-font-weight:normal'><span style='font-size:14.0pt;mso-bidi-font-size:<br />
12.0pt;color:#00B050;mso-ansi-language:EN-US'>Adribubu<o:p></o:p></span></b></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Hobbies:<br />
Listen to music, watching movies, sleeping, running, reading, hanging out<br />
with my friends, meeting new people.<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>What do you<br />
want to study? Biotechology <o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Why <span<br />
style='color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191'>iGEM</span>?<br />
Because I like working in the lab, and for me iGEM is a very interesting project where I can develop my skills and learn more about science nowadays.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;mso-ansi-language:<br />
EN-US'><o:p>&nbsp;</o:p></span></p><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='margin-left:-44.25pt;border-collapse:collapse;border:none;mso-yfti-tbllook:<br />
1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:<br />
none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes'><br />
<td width=491 style='width:368.6pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
class=MsoIntenseEmphasis><span lang=ES-MX style='font-size:14.0pt;mso-bidi-font-size:<br />
10.0pt;font-style:normal;mso-bidi-font-style:italic'>Ingrid Melissa Chávez de<br />
la Portilla<o:p></o:p></span></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
lang=ES-MX style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span></span><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'>Age: 17<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Nickname: </span><b style='mso-bidi-font-weight:<br />
normal'><span style='font-size:14.0pt;mso-bidi-font-size:12.0pt;color:#00B050;<br />
mso-ansi-language:EN-US'>Mely</span></b><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Hobbies: Hanging out with friends, listening to music, doing gymnastics and going to church <o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>What do you want to study? Medicine.<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Why <span style='color:#E36C0A;mso-themecolor:<br />
accent6;mso-themeshade:191'>iGEM</span>? Because I like what it is done and it seems interesting to me. I like Biology, so I decided to try it out. </span><span lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
<td width=204 valign=top style='width:153.35pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US;mso-fareast-language:EN-US;mso-no-proof:yes'><!--[if gte vml 1]><v:shape<br />
id="Picture_x0020_5" o:spid="_x0000_i1040" type="#_x0000_t75" style='width:142.5pt;<br />
height:141.75pt;visibility:visible;mso-wrap-style:square'><br />
<v:imagedata src="InfoTeam_archivos/image023.png" o:title=""/><br />
</v:shape><![endif]--><![if !vml]><img width=190 height=189<br />
src="https://static.igem.org/mediawiki/2014hs/5/53/Mely.jpg" v:shapes="Picture_x0020_5"><![endif]></span><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal><span lang=ES-MX style='font-size:12.0pt;line-height:115%'><o:p>&nbsp;</o:p></span></p><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='border-collapse:collapse;border:none;mso-yfti-tbllook:1184;mso-padding-alt:<br />
0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes'><br />
<td width=206 style='width:154.25pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='text-align:center;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US;mso-fareast-language:EN-US;<br />
mso-no-proof:yes'><!--[if gte vml 1]><v:shape id="Picture_x0020_6" o:spid="_x0000_i1039"<br />
type="#_x0000_t75" style='width:141pt;height:141.75pt;visibility:visible;<br />
mso-wrap-style:square'><br />
<v:imagedata src="InfoTeam_archivos/image025.png" o:title=""/><br />
</v:shape><![endif]--><![if !vml]><img width=188 height=189<br />
src="https://static.igem.org/mediawiki/2014hs/0/0f/Joel.jpg" v:shapes="Picture_x0020_6"><![endif]></span><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
<td width=491 style='width:13.0cm;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='line-height:normal'><span class=MsoIntenseEmphasis><span<br />
lang=ES-MX style='font-size:14.0pt;mso-bidi-font-size:10.0pt;font-style:normal;<br />
mso-bidi-font-style:italic'>Joel Abdias Aguilar Orta<o:p></o:p></span></span></p><br />
<p class=MsoNormal style='line-height:normal'><span lang=ES-MX<br />
style='font-size:12.0pt'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span lang=ES-MX<br />
style='font-size:12.0pt'><span style='mso-spacerun:yes'> </span>Age: 17<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span lang=ES-MX<br />
style='font-size:12.0pt'><span style='mso-spacerun:yes'> </span></span><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'>Nickname</span><b<br />
style='mso-bidi-font-weight:normal'><span style='font-size:14.0pt;mso-bidi-font-size:<br />
12.0pt;color:#00B050;mso-ansi-language:EN-US'>: Jlouz or Chol (a variation of<br />
Schöll)</span></b><span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Hobbies:<br />
Listening to music all day, cooking, sleeping, going where the wind takes me.<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>What do you<br />
want to study? Industrial and/or chemical sciences.<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Why <span<br />
style='color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191'>iGEM</span>?<br />
Because it is an opportunity for me to develop knowledge in another branch of sciences. Also because, “why not?” </span><span lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal><span lang=ES-MX style='font-size:12.0pt;line-height:115%'><o:p>&nbsp;</o:p></span></p><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='margin-left:-44.25pt;border-collapse:collapse;border:none;mso-yfti-tbllook:<br />
1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:<br />
none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes'><br />
<td width=491 style='width:368.6pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
class=MsoIntenseEmphasis><span lang=ES-MX style='font-size:14.0pt;mso-bidi-font-size:<br />
10.0pt;font-style:normal;mso-bidi-font-style:italic'>Raúl de la Garza<o:p></o:p></span></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
lang=ES-MX style='font-size:12.0pt'><span style='mso-spacerun:yes'> </span>Age:<br />
18<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
lang=ES-MX style='font-size:12.0pt'><span style='mso-spacerun:yes'> </span></span><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'>Nickname: </span><b<br />
style='mso-bidi-font-weight:normal'><span style='font-size:14.0pt;mso-bidi-font-size:<br />
12.0pt;color:#00B050;mso-ansi-language:EN-US'>Raúl</span></b><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Hobbies: Playing drums, listening to music and being in the lab.<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>What do you want to study? Biotechnology<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Why <span style='color:#E36C0A;mso-themecolor:<br />
accent6;mso-themeshade:191'>iGEM</span>? (Why not?) I love exact sciences and therefore, like synthetic biology.<o:p></o:p></span></p><br />
</td><br />
<td width=203 style='width:151.95pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='text-align:center;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US;mso-fareast-language:EN-US;<br />
mso-no-proof:yes'><!--[if gte vml 1]><v:shape id="Picture_x0020_7" o:spid="_x0000_i1038"<br />
type="#_x0000_t75" style='width:141pt;height:141.75pt;visibility:visible;<br />
mso-wrap-style:square'><br />
<v:imagedata src="InfoTeam_archivos/image027.png" o:title="" croptop="2162f"<br />
cropleft="8922f" cropright="14949f"/><br />
</v:shape><![endif]--><![if !vml]><img width=188 height=189<br />
src="https://static.igem.org/mediawiki/2014hs/5/52/Raul.jpg" v:shapes="Picture_x0020_7"><![endif]></span><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal><span lang=ES-MX style='font-size:12.0pt;line-height:115%'><o:p>&nbsp;</o:p></span></p><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='border-collapse:collapse;border:none;mso-yfti-tbllook:1184;mso-padding-alt:<br />
0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes'><br />
<td width=206 style='width:154.25pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='text-align:center;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US;mso-fareast-language:EN-US;<br />
mso-no-proof:yes'><!--[if gte vml 1]><v:shape id="Picture_x0020_8" o:spid="_x0000_i1037"<br />
type="#_x0000_t75" style='width:141pt;height:141.75pt;visibility:visible;<br />
mso-wrap-style:square'><br />
<v:imagedata src="InfoTeam_archivos/image029.jpg" o:title="" croptop="7761f"<br />
cropleft="27109f" cropright="1f"/><br />
</v:shape><![endif]--><![if !vml]><img width=188 height=189<br />
src="https://static.igem.org/mediawiki/2014hs/3/3d/Dulce.jpg" v:shapes="Picture_x0020_8"><![endif]></span><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
<td width=491 style='width:13.0cm;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='line-height:normal'><span class=MsoIntenseEmphasis><span<br />
lang=ES-MX style='font-size:14.0pt;mso-bidi-font-size:10.0pt;font-style:normal;<br />
mso-bidi-font-style:italic'>Dulce Valdez<o:p></o:p></span></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Age: 16<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Nickname: </span><b<br />
style='mso-bidi-font-weight:normal'><span style='font-size:14.0pt;mso-bidi-font-size:<br />
12.0pt;color:#00B050;mso-ansi-language:EN-US'>Dulce de leche<o:p></o:p></span></b></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Hobbies:<br />
Hugging people and cooking brownies<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>What do you<br />
want to study? Biotechnology<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Why <span<br />
style='color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191'>iGEM</span>?<br />
Because when I heard about Synthetic Biology I just fell in love, and I<br />
wanted to try something new and make new friends<o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;mso-ansi-language:<br />
EN-US'><o:p>&nbsp;</o:p></span></p><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='margin-left:-44.25pt;border-collapse:collapse;border:none;mso-yfti-tbllook:<br />
1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:<br />
none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes'><br />
<td width=491 style='width:368.6pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
class=MsoIntenseEmphasis><span lang=ES-MX style='font-size:14.0pt;mso-bidi-font-size:<br />
10.0pt;font-style:normal;mso-bidi-font-style:italic'>Fernanda Puente<o:p></o:p></span></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Age: 17<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Nickname: </span><b style='mso-bidi-font-weight:<br />
normal'><span style='font-size:14.0pt;mso-bidi-font-size:12.0pt;color:#00B050;<br />
mso-ansi-language:EN-US'>Nanda</span></b><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Hobbies: Playing video games, reading,<br />
listening to music, eating tortillas and being a Safer. <o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>What do you want to study? Biotechnology<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Why <span style='color:#E36C0A;mso-themecolor:<br />
accent6;mso-themeshade:191'>iGEM</span>? Because I’m very interested in<br />
biology and genetics and iGEM pretty much sums it up.<o:p></o:p></span></p><br />
</td><br />
<td width=204 style='width:153.35pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='text-align:center;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US;mso-fareast-language:EN-US;<br />
mso-no-proof:yes'><!--[if gte vml 1]><v:shape id="Picture_x0020_9" o:spid="_x0000_i1036"<br />
type="#_x0000_t75" style='width:142.5pt;height:141.75pt;visibility:visible;<br />
mso-wrap-style:square'><br />
<v:imagedata src="InfoTeam_archivos/image031.png" o:title=""/><br />
</v:shape><![endif]--><![if !vml]><img width=190 height=189<br />
src="https://static.igem.org/mediawiki/2014hs/b/b1/Nana.jpg" v:shapes="Picture_x0020_9"><![endif]></span><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal><span lang=ES-MX style='font-size:12.0pt;line-height:115%'><o:p>&nbsp;</o:p></span></p><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='border-collapse:collapse;border:none;mso-yfti-tbllook:1184;mso-padding-alt:<br />
0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes'><br />
<td width=206 style='width:154.25pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='text-align:center;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US;mso-fareast-language:EN-US;<br />
mso-no-proof:yes'><!--[if gte vml 1]><v:shape id="Picture_x0020_11" o:spid="_x0000_i1035"<br />
type="#_x0000_t75" style='width:142.5pt;height:141.75pt;visibility:visible;<br />
mso-wrap-style:square'><br />
<v:imagedata src="InfoTeam_archivos/image033.png" o:title="" cropleft="7873f"<br />
cropright="13662f"/><br />
</v:shape><![endif]--><![if !vml]><img width=190 height=189<br />
src="https://static.igem.org/mediawiki/2014hs/7/70/Eva.jpg" v:shapes="Picture_x0020_11"><![endif]></span><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
<td width=491 style='width:13.0cm;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='line-height:normal'><span class=MsoIntenseEmphasis><span<br />
style='font-size:14.0pt;mso-bidi-font-size:10.0pt;mso-ansi-language:EN-US;<br />
font-style:normal;mso-bidi-font-style:italic'>Eva Quintana<o:p></o:p></span></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Age: 17<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Nickname: </span><b<br />
style='mso-bidi-font-weight:normal'><span style='font-size:14.0pt;mso-bidi-font-size:<br />
12.0pt;color:#00B050;mso-ansi-language:EN-US'>EVA (Wall-E &lt;3) or YOLO</span></b><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Hobbies:<br />
Dancing Ballet, listening to music, reading books, being me.<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>What do you<br />
want to study? Biotechnology<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Why <span<br />
style='color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191'>iGEM</span>?<br />
Because I can learn a lot of things, I have lots of fun and I love science.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;mso-ansi-language:<br />
EN-US'><o:p>&nbsp;</o:p></span></p><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='margin-left:-44.25pt;border-collapse:collapse;border:none;mso-yfti-tbllook:<br />
1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:<br />
none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes'><br />
<td width=491 style='width:368.6pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
class=MsoIntenseEmphasis><span lang=ES-MX style='font-size:14.0pt;mso-bidi-font-size:<br />
10.0pt;font-style:normal;mso-bidi-font-style:italic'>Irina Romero Guerrero<o:p></o:p></span></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Age: 17<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Nickname: </span><b style='mso-bidi-font-weight:<br />
normal'><span style='font-size:14.0pt;mso-bidi-font-size:12.0pt;color:#00B050;<br />
mso-ansi-language:EN-US'>:C</span></b><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Hobbies: Reading, listening to music,<br />
eating.<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>What do you want to study? Biotechnology.<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Why <span style='color:#E36C0A;mso-themecolor:<br />
accent6;mso-themeshade:191'>iGEM</span>? Because I like biology, and I love<br />
to learn and discover new things.<o:p></o:p></span></p><br />
</td><br />
<td width=203 style='width:152.0pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US;mso-fareast-language:EN-US;<br />
mso-no-proof:yes'><!--[if gte vml 1]><v:shape id="Picture_x0020_12" o:spid="_x0000_i1034"<br />
type="#_x0000_t75" alt="https://scontent-a-lax.xx.fbcdn.net/hphotos-xpa1/t1.0-9/10364097_648288655261712_3223419575395283934_n.jpg"<br />
style='width:141pt;height:141.75pt;visibility:visible;mso-wrap-style:square'><br />
<v:imagedata src="InfoTeam_archivos/image035.jpg" o:title="10364097_648288655261712_3223419575395283934_n"<br />
cropleft="22000f"/><br />
</v:shape><![endif]--><![if !vml]><img width=188 height=189<br />
src="https://static.igem.org/mediawiki/2014hs/2/26/Irina.jpg"<br />
alt="https://scontent-a-lax.xx.fbcdn.net/hphotos-xpa1/t1.0-9/10364097_648288655261712_3223419575395283934_n.jpg"<br />
v:shapes="Picture_x0020_12"><![endif]></span><span lang=ES-MX<br />
style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal><span lang=ES-MX style='font-size:12.0pt;line-height:115%'><o:p>&nbsp;</o:p></span></p><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='border-collapse:collapse;border:none;mso-yfti-tbllook:1184;mso-padding-alt:<br />
0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes'><br />
<td width=206 style='width:154.25pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='text-align:center;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US;mso-fareast-language:EN-US;<br />
mso-no-proof:yes'><!--[if gte vml 1]><v:shape id="Picture_x0020_13" o:spid="_x0000_i1033"<br />
type="#_x0000_t75" style='width:140.25pt;height:141.75pt;visibility:visible;<br />
mso-wrap-style:square'><br />
<v:imagedata src="InfoTeam_archivos/image037.png" o:title=""/><br />
</v:shape><![endif]--><![if !vml]><img width=187 height=189<br />
src="https://static.igem.org/mediawiki/2014hs/4/46/Lisi.jpg" v:shapes="Picture_x0020_13"><![endif]></span><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
<td width=491 style='width:13.0cm;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='line-height:normal'><span class=MsoIntenseEmphasis><span<br />
lang=ES-MX style='font-size:14.0pt;mso-bidi-font-size:10.0pt;font-style:normal;<br />
mso-bidi-font-style:italic'>Lisandro Hiracheta Torres<o:p></o:p></span></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Age:16<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Nickname: </span><b<br />
style='mso-bidi-font-weight:normal'><span style='font-size:14.0pt;mso-bidi-font-size:<br />
12.0pt;color:#00B050;mso-ansi-language:EN-US'>Lisandro</span></b><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Hobbies:<br />
listening to music, playing videogames, sleeping and painting<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>What do you<br />
want to study? Medicine<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Why <span<br />
style='color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191'>iGEM</span>?<br />
It was a great opportunity to know I can work with a group, and it was a challenge where I wanted to test myself<o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;mso-ansi-language:<br />
EN-US'><o:p>&nbsp;</o:p></span></p><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='margin-left:-44.25pt;border-collapse:collapse;border:none;mso-yfti-tbllook:<br />
1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:<br />
none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes'><br />
<td width=491 style='width:368.6pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
class=MsoIntenseEmphasis><span lang=ES-MX style='font-size:14.0pt;mso-bidi-font-size:<br />
10.0pt;font-style:normal;mso-bidi-font-style:italic'>Andrés Marcelo Jiménez<br />
González <o:p></o:p></span></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
lang=ES-MX style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span></span><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'>Age: 16 <o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Nickname: </span><b style='mso-bidi-font-weight:<br />
normal'><span style='font-size:14.0pt;mso-bidi-font-size:12.0pt;color:#00B050;<br />
mso-ansi-language:EN-US'>Copernicus </span></b><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Hobbies: Solving equations, reading algebra<br />
books, watching movies about statistics, and dreaming about math.<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>What do you want to study?<span<br />
style='mso-spacerun:yes'> </span>Actuarial Science<o:p></o:p></span></p><br />
<p class=MsoNormal align=right style='text-align:right;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><span<br />
style='mso-spacerun:yes'> </span>Why <span style='color:#E36C0A;mso-themecolor:<br />
accent6;mso-themeshade:191'>iGEM</span>? I consider it a really interesting<br />
project, in which the projects can be later be use on real applications.<o:p></o:p></span></p><br />
</td><br />
<td width=204 style='width:153.3pt;padding:0cm 5.4pt 0cm 5.4pt;height:3.5pt'><br />
<p class=MsoNormal align=center style='text-align:center;line-height:normal'><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US;mso-fareast-language:EN-US;<br />
mso-no-proof:yes'><!--[if gte vml 1]><v:shape id="Picture_x0020_3" o:spid="_x0000_i1046"<br />
type="#_x0000_t75" style='width:142.5pt;height:141.75pt;visibility:visible;<br />
mso-wrap-style:square'><br />
<v:imagedata src="https://static.igem.org/mediawiki/2014hs/1/16/Andres.jpg " o:title="" cropleft="8969f"<br />
cropright="12877f"/><br />
</v:shape><![endif]--><![if !vml]><img width=190 height=189<br />
src="https://static.igem.org/mediawiki/2014hs/1/16/Andres.jpg" v:shapes="Picture_x0020_3"><![endif]></span><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;mso-ansi-language:<br />
EN-US'><o:p>&nbsp;</o:p></span></p><br />
<br />
<table class=MsoTableGrid border=0 cellspacing=0 cellpadding=0<br />
style='border-collapse:collapse;border:none;mso-yfti-tbllook:1184;mso-padding-alt:<br />
0cm 5.4pt 0cm 5.4pt;mso-border-insideh:none;mso-border-insidev:none'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;mso-yfti-lastrow:yes'><br />
<td width=206 style='width:154.25pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='text-align:center;line-height:normal'><span<br />
style='font-size:12.0pt;color:red;mso-ansi-language:EN-US;mso-fareast-language:<br />
EN-US;mso-no-proof:yes'><!--[if gte vml 1]><v:shape id="Picture_x0020_14"<br />
o:spid="_x0000_i1032" type="#_x0000_t75" style='width:142.5pt;height:141.75pt;<br />
visibility:visible;mso-wrap-style:square'><br />
<v:imagedata src="InfoTeam_archivos/image039.png" o:title="" cropleft="9923f"<br />
cropright="11768f"/><br />
</v:shape><![endif]--><![if !vml]><img width=190 height=189<br />
src="https://static.igem.org/mediawiki/2014hs/6/69/Marina.jpg" v:shapes="Picture_x0020_14"><![endif]></span><span<br />
lang=ES-MX style='font-size:12.0pt'><o:p></o:p></span></p><br />
</td><br />
<td width=491 style='width:13.0cm;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='line-height:normal'><span class=MsoIntenseEmphasis><span<br />
lang=ES-MX style='font-size:14.0pt;mso-bidi-font-size:10.0pt;font-style:normal;<br />
mso-bidi-font-style:italic'>Marina Emilio Aguirre<o:p></o:p></span></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Age: 17<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Nickname: </span><b<br />
style='mso-bidi-font-weight:normal'><span style='font-size:14.0pt;mso-bidi-font-size:<br />
12.0pt;color:#00B050;mso-ansi-language:EN-US'>Tortuga /Turtle</span></b><span<br />
style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Hobbies:<br />
Reading, playing basketball, painting, eating chocolate (it is my favourite), sleeping (well, it is my favourite too!), drawing, I think anything.<o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>What do you<br />
want to study?: Astrophysics ;D <o:p></o:p></span></p><br />
<p class=MsoNormal style='line-height:normal'><span style='font-size:12.0pt;<br />
mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span>Why <span<br />
style='color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191'>iGEM</span>?<br />
I don’t really know, I just love any science and it looked pretty interesting and great. <o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
</center><br />
<br />
</br><br />
<center><iframe width="640" height="390" src="//www.youtube.com/embed/ezWx0jxfqek" frameborder="0" allowfullscreen></iframe></center><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/team#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma
Team:CIDEB-UANL Mexico/project aroma
2014-06-21T02:46:29Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project<br />
</title><br />
<style>body{margin: 0px; width: 100%;padding: 0px;dubackground: #2056ac;font-family: 'Oxygen', sans-serif;font-size: 12pt;background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);}h1, h2, h3{margin: 0;padding-bottom: 5px;color: #404040;}p, ol, ul{margin-top: 0;}ol, ul{padding: 0;list-style: none;}p{line-height: 1.60em;padding- right: 3em;}strong{}a{color: #2056ac;}a:hover{text-decoration: none;}.container{margin: 0px auto;width: 1200px;}.container-text{margin: 0px auto;width: 75%;padding: 0px;font-family: 'Oxygen', sans-serif;font-size: 12pt; text-align: justify;}.wrapper{overflow: hidden;padding: 0em 0em 1em 0em;background: #FFF;}#wrapper1{background: #FFF;}#wrapper2{overflow: hidden;background: #F3F3F3;padding: 5em 0em;text-align: center;}#wrapper3{overflow: hidden;padding: 0em 0em 0em 0em;background: #FFF;}#wrapper4{}#banner{padding-top: 2em;}#welcome{overflow: hidden;width: 1000px;padding: 0em 100px 0em 100px;text-align: center;}#welcome .content{padding: 0em 8em;}#welcome .title h2{}#welcome a,#welcome strong{}.title{margin-bottom: 1em;}.title h2{font-size: 2em;}.title .byline{font-size: 1.1em;color: #6F6F6F#;}#three-column{overflow: hidden;margin-top: 5em;padding-top: 1em;border-top: 1px solid rgba(0,0,0,0.2);text-align: center;}#three-column h2{margin: 1em 0em;font-size: 1.5em;font-weight: 700;}#three-column .icon{position: relative;display: block;margin: 0px auto 0.80em auto;background: none;line-height: 150px;font-size: 4em;width: 150px;height: 100px;border-radius: 100px;border: 6px solid #67128F;text-align: center;color: #FFF;}#three-column #tbox1,#three-column #tbox2,#three-column #tbox3{float: left;width: 320px;padding: 30px 40px 50px 40px;}#three-column .title{text-align: center;}#three-column .title h2{font-size: 1.60em;}#three-column .title .byline{padding-top: 0.50em;font-size: 0.90em;color: #858585;}#three-column .arrow-down{border-top-color: #292929;}ul.tools{margin: 0;padding: 0em 0em 0em 0em;list-style: none;}ul.tools li{display: inline-block;padding: 0em .2em;font-size: 4em;}ul.tools li span{display: none;margin: 0;padding: 0;}ul.tools li a{color: #FFF;}ul.tools li a:before{display: inline-block;background: #1ABC9C;width: 120px;height: 120px;border-radius: 50%;line-height: 120px;text-align: center;color: #FFFFFF;}.button{display: inline-block;margin-top: 2em;padding: 0.8em 2em;background: #64ABD1;line-height: 1.8em;letter-spacing: 1px;text-decoration: none;font-size: 1em;color: #FFF;}.button:before{display: inline-block;background: #8DCB89;margin-right: 1em;width: 40px;height: 40px;line-height: 40px;border-radius: 20px;text-align: center;color: #272925;}.button-small{}#portfolio{overflow: hidden;padding-top: 5em;border-top: 1px solid rgba(0,0,0,0.2);}#portfolio .box{text-align: center;color: rgba(0,0,0,0.5);}#portfolio h3{display: block;padding-bottom: 1em;font-size: 1em;color: rgba(0,0,0,0.6);}#portfolio .title{text-align: center;}#portfolio .title h2{color: rgba(0,0,0,0.8);}.column1,.column2,.column3,.column4{width: 282px;}.column1,.column2,.column3{float: left;margin-right: 24px;}.column4{float: right;}<br />
</style><br />
<br />
<body><br />
<br />
<div class="wrapper"><br />
<br />
<div id="welcome" class="container"> <br />
<br />
<div class="title"> <h2>Aroma Module</h2> <br />
</div><br />
</div><br />
<br />
<div class="container-text"><br />
<br />
<br />
<img width=131 height=127 src="https://static.igem.org/mediawiki/2014hs/5/5c/HandsomeAroma.jpg" align=right hspace=12/><br />
<p align="justify">Since the beginning of iGEM project, the use of fluorescent reporters has been used in each one of the proposed projects in previous years, trying to test the theoretical presence of other proteins in <i>E. coli.</i> For our iGEM 2014 project, this module proposed to promote the usage of aroma reporters, instead of fluorescent ones.</p><br />
<br />
<br />
<p><b><h2>Description</h2></b></p><br />
<p>In the module, WinterGreen is the most important part. Normally, it catalyzes the conversion of salicylic acid into methyl salicylate. The protein is excreted by the bacteria and when salicylic acid is added to the medium, a chemical reaction takes place and produces methyl salicylate, which is responsible for the wintergreen odor.</p><br />
<br />
<p>But in this module, it will be regulated by temperature with the use of the RNA thermometer. When adding salicylic acid to the bacteria in a 32° Celsius environment, the production of the WinterGreen protein will begin.</p><br><br />
<br />
<br />
<center><img width=350 height=250 src="https://static.igem.org/mediawiki/2014hs/6/6e/AromaFigure1Bb.png" align=center hspace=12/></center><br />
<center><p><b>Figure 1.</b> Production of Wintergreen Odor</p></center><br />
<br />
<p><b><h2>Device</h2></b></p><br />
<p>Originally, WinterGreen was thought to be the reporter of the Capture module, but in order to prove the function of this gene and also the one in charge of the capture of sodium ions (NhaS), we decided to separate the full device into the actual modules of Capture and Aroma, as seen in the figure below.</p><br />
<br />
<center><br />
<p><img width=450 height=250 src="https://static.igem.org/mediawiki/2014hs/3/32/TestCaptureAndAroma.jpg" align=center hspace=12></p><br />
<p><b>Figure 2.</b> The device originally thought, and the 2 modules derived from it.</p></center><br><br />
<br />
<p>This device is composed by the following parts (see <b>figure 3</b>): a constitutive promoter (1), a RNA thermometer (3); used to regulate the WinterGreen-odor protein production through temperature, a Wintergreen-odor enzyme generator, used to allow the production of methyl salicylate, induced by salicylic acid (2); and a terminator (4). All of these parts are ligated by an 8-bp scar (TACTAGAG).</p><br />
<br />
<center><img width=400 height=170 src="https://static.igem.org/mediawiki/2014hs/5/56/AromaFigure1Aa.png" align=center hspace=12/><br />
<p><b>Figure 3.</b> Aroma Module</p></center><br><br />
<br />
<p>These 4 genetic parts form the Aroma device of the project. The full device's length is 1,251bp (including restriction sites).</p><br />
<br />
<p><b><h2>Parts of the module</h2></b></p><br />
<br><center><div><table class=MsoTable15Grid7ColorfulAccent3 border=1 cellspacing=0 cellpadding=0 width=625 style='width:468.55pt;border-collapse:collapse; border:none;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt'> <tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes; height:15.0pt'> <td width=88 nowrap valign=top style='width:66.1pt;border:none;border-bottom: solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint: 153;mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:517'><b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX;mso-bidi-font-style: italic'>IMAGE</span></b><span lang=ES-MX style='font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:"Times New Roman"; mso-fareast-language:ES-MX;mso-bidi-font-style:italic'><o:p></o:p></span></p> </td> <td width=119 valign=top style='width:89.0pt;border:none;border-bottom:solid #C2D69B 1.0pt; mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint:153; mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>CODE</span></b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></p> </td> <td width=418 nowrap valign=top style='width:313.45pt;border:none;border-bottom: solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint: 153;mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>DESCRIPTION</span></b><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:0;height:83.15pt'> <td width=88 nowrap valign=top style='width:66.1pt;border:none;border-right: solid #C2D69B 1.0pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:83.15pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape id="_x0000_s1029" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:10.95pt;margin-top:3.2pt;width:66pt;height:48pt; z-index:251660800;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image007.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=88 height=64 src="https://static.igem.org/mediawiki/2014hs/4/43/PConsAroma.png" align=left hspace=12 v:shapes="_x0000_s1029"><![endif]></p> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><i><span lang=ES-MX style='font-family:Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade: 191;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p>&nbsp;</o:p></span></i></p> </td> <td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; background:#EAF1DD;mso-background-themecolor:accent3;mso-background-themetint: 51;padding:0cm 5.4pt 0cm 5.4pt;height:83.15pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119A</a></span><span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'><o:p></o:p></span></p> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p> </td> <td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3; mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:83.15pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>In the specific case of our aroma module, it will help the bacteria to continuously transcribe the <span class=SpellE>WinterGreen</span> gene in order to allow the bacteria to continuously produce the aroma. </span><span class=SpellE><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size: 11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'>This</span></span><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family: Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; color:black;mso-fareast-language:ES-MX'> <span class=SpellE>promoter</span> has a <span class=SpellE>length</span> of 35bp.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:1;height:77.45pt'> <td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:77.45pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape id="_x0000_s1028" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:16.95pt;margin-top:4.25pt;width:57.75pt; height:44.25pt;z-index:251662848;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image009.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=77 height=59 src="https://static.igem.org/mediawiki/2014hs/b/b0/RNAthermAroma.png" align=left hspace=12 v:shapes="_x0000_s1028"><![endif]><i><span lang=ES-MX style='font-family: Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade:191;mso-fareast-language: ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p></td> <td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; padding:0cm 5.4pt 0cm 5.4pt;height:77.45pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><span lang=ES-MX style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K115017">BBa_K115017</a><o:p></o:p></span></p></td> <td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:77.45pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><span style='font-size:12.0pt;mso-bidi-font-size: 11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>A RNA thermometer, used for temperature post-transcriptional regulation (thermo sensor), and is designed to initiate transcription around 32°C.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:2;height:190.6pt'> <td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:190.6pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape id="_x0000_s1027" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:13.95pt;margin-top:3.2pt;width:63pt;height:51.75pt; z-index:251664896;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image011.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=84 height=69 src="https://static.igem.org/mediawiki/2014hs/b/b1/WinterGreenAroma.png" align=left hspace=12 v:shapes="_x0000_s1027"><![endif]><i><span style='font-size:3.0pt;font-family: Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade:191;mso-ansi-language: EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p></td> <td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; background:#EAF1DD;mso-background-themecolor:accent3;mso-background-themetint: 51;padding:0cm 5.4pt 0cm 5.4pt;height:190.6pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; mso-ansi-language:EN-US;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K1255001:Design">BBa_K1255001</a><o:p></o:p></span></p> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p> </td> <td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3; mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:190.6pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>Produces a <span class=SpellE>transferase</span> to convert salicylic acid into methyl salicylate (<span class=SpellE>WinterGreen</span> odor). The wintergreen odor generator requires of 2mM of salicylic acid to produce methyl salicylate. BSMT1 (<a href="http://parts.igem.org/Part:BBa_J45004">BBa_J45004</a>), <span class=SpellE>WinterGreen</span> Odor Generator original name, was created by <a href="https://2006.igem.org/wiki/index.php/MIT_2006">MIT 2006</a>. This year, the team optimized the sequence for <i>Escherichia coli</i>. </span><span class=SpellE><span lang=ES-MX style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'>The</span></span><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family: Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; color:black;mso-fareast-language:ES-MX'> new <span class=SpellE>biobrick</span> has a <span class=SpellE>length</span> of 1,074bp.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes;height:70.7pt'> <td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:70.7pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape id="_x0000_s1026" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:18pt;margin-top:1.85pt;width:59.1pt;height:49.4pt; z-index:251666944;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image013.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=79 height=66 src="https://static.igem.org/mediawiki/2014hs/6/62/TerminatorAroma.png" align=left hspace=12 v:shapes="_x0000_s1026"><![endif]></p> </td> <td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; padding:0cm 5.4pt 0cm 5.4pt;height:70.7pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><span lang=ES-MX style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a><o:p></o:p></span></p> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'>&nbsp;</p> </td> <td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:70.7pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><span style='font-size:12.0pt;mso-bidi-font-size: 11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>Part made of 6bp, responsible for transcription stop. The terminator stops the production of methyl salicylate. <o:p></o:p></span></p> </td> </tr></table></div></center><br><br />
<br />
<p><b><h2>Justification</h2></b></p><br />
<p>Different to fluorescent reporters, this module was made in order to (in the future) perform as an aroma reporter and also to test the correct function of the bacteria, for its future usage as a new reporter and functional part (CDS). It is desired to use this part in the project to replace the red fluorescent protein (RFP) in the Capture module. But it was preferable to test it apart to demonstrate its effectiveness. Similarly, this piece is also helpful when the biofilter is assembled, because when performing the filtration by silica, WinterGreen can demonstrate the presence of bacteria in the beads. </p><br />
<br />
<p>The team added the RNA thermometer in the device for regulating the production of the aroma. Another reason for selecting the RNA thermometer as a regulator was to continue the CIDEB UANL 2013 work with it.</p><br />
<br />
<p><b><h2>Other teams that used RNA thermometer and BSMT1</h2></b></p><br />
<br />
<div align=center width="80%" ><br />
<table border=1 cellspacing=0 cellpadding=0 style='border-collapse:collapse;border:none;mso-border-alt:solid #C2D69B .5pt; mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh: .5pt solid #C2D69B;mso-border-insidev:.5pt solid #C2D69B'> <br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #9BBB59 1.0pt; border-right:none;mso-border-top-alt:solid #9BBB59 .5pt;mso-border-left-alt: solid #9BBB59 .5pt;mso-border-bottom-alt:solid #9BBB59 .5pt;background:#9BBB59; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><b><br />
<br />
<span style='font-size:12.0pt; color:white;mso-ansi-language:EN-US'>Team<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #9BBB59 1.0pt; border-left:none;mso-border-top-alt:solid #9BBB59 .5pt;mso-border-bottom-alt: solid #9BBB59 .5pt;mso-border-right-alt:solid #9BBB59 .5pt;background:#9BBB59; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><b><br />
<br />
<span style='font-size:12.0pt; color:white;mso-ansi-language:EN-US'>Part Used<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border:solid #9BBB59 1.0pt; border-left:none;mso-border-top-alt:solid #9BBB59 .5pt;mso-border-bottom-alt: solid #9BBB59 .5pt;mso-border-right-alt:solid #9BBB59 .5pt;background:#9BBB59; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><b><br />
<br />
<span style='font-size:12.0pt; color:white;mso-ansi-language:EN-US'>Use<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
</tr><br />
<br />
<tr style='mso-yfti-irow:1;height:33.0pt'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt;height:33.0pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><br />
<br />
<span lang=FR style='font-size:12.0pt;color:#4F81BD;mso-ansi-language: FR'><a href="https://2008.igem.org/Team:TUDelft" target="_blank">TuDelft 2008</a><br />
</span></u></b><br />
<br />
<span lang=FR style='font-size:6.0pt;mso-bidi-font-size:12.0pt;mso-ansi-language:FR; mso-bidi-font-weight:bold'>:<br />
</span><b><br />
<br />
<span lang=FR style='font-size:12.0pt; mso-ansi-language:FR'><o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=170 valign=top style='width:127.35pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt; height:33.0pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>RNA themometer<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt; height:33.0pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>Temperature-sensing bacteria that changes color at different temperatures; as a temperature reporter system inlarge-scale fermentations, or as a temperature-inducible protein production system.<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:2'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><br />
<br />
<span style='font-size:12.0pt;color:#4F81BD;mso-ansi-language: EN-US'><a href="https://2009.igem.org/Team:VictoriaBC" target="_blank">Victoria BC 2009</a><br />
</span></u></b><br />
<br />
<span style='font-size:6.0pt;mso-bidi-font-size:12.0pt;mso-ansi-language:EN-US; mso-bidi-font-weight:bold'>:<b> <o:p></o:p></b><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></b></p> <br />
</td> <br />
<td width=170 valign=top style='width:127.35pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>RNA themometer<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>NAND logic gate using the ribo-key/ribo-lock system designed by <a href="https://2006.igem.org/wiki/index.php/Berkeley">Berkeley 2006</a> team , producing RFP except when the cells are grown in the presence of both arabinose and IPTG, also coupling fluorescent outputs with the ribo-thermometers made by TUDelft 2008 team.<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
</tr><br />
<tr style='mso-yfti-irow:2'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><br />
<br />
<span style='font-size:12.0pt;color:#4F81BD;mso-ansi-language: EN-US'><a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico" target="_blank">CIDEB UANL 2013</a><br />
</span></u></b><br />
<br />
<span style='font-size:6.0pt;mso-bidi-font-size:12.0pt;mso-ansi-language:EN-US; mso-bidi-font-weight:bold'>:<b> <o:p></o:p></b><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></b></p> <br />
</td> <br />
<td width=170 valign=top style='width:127.35pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>RNA themometer<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>Production of Vip3ca3, which acts as a pesticide protein, regulated by specific temperatures in order to avoid overproduction and it will show activity against target organisms Coleoptera and Lepidoptera..<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;color:#4F81BD'><a href="https://2006.igem.org/wiki/index.php/MIT_2006" target="_blank">MIT 2006</a><br />
</span></u></b><br />
<br />
<span lang=ES-MX style='font-size:7.0pt;mso-bidi-font-size:12.0pt;mso-bidi-font-weight: bold'>:<b> <o:p></o:p></b><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><br />
<br />
<span lang=ES-MX style='font-size:12.0pt'><o:p>&nbsp;</o:p><br />
</span></b></p> <br />
</td> <br />
<td width=170 valign=top style='width:127.35pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>BSMT1<o:p></o:p><br />
</span></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>This device produces methyl salicylate in the presence of salicylic acid. Methyl salicylate smells strongly of mint (wintergreen). Production of methyl salicylate was verified both by scent and by gas chromatography: E. coli with no WGD did not produce methyl salicylate when SA was added to the medium, while E. coli with the WGD did produce methyl salicylate when SA was added to the medium..<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr><br />
</table><br />
</div><br />
<br />
<p><b><h2>Project Zoom in</h2></b></p><br />
<p><center><iframe width="600" height="500" src="//www.youtube.com/embed/fd9EQNCOr2k" frameborder="0" allowfullscreen></iframe></center></p><br />
<br><br />
<br />
<p><b><h2>Bibliography/References</h2></b></p><font size="2"><br />
<br />
<p>● Huang, H. (2006, August 30). <i>Part:BBa_B1002. </i> Retrieved August 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002"> http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002</a>.</p><br />
<br />
<p>● iGEM2006_Berkeley. (2006). <i>Part:BBa_J23100</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_J23100"> http://parts.igem.org/Part:BBa_J23100</a>.</p><br />
<br />
<p>● iGEM2006_MIT. (2006). <i>Part:BBa_J45004</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_J45004"> http://parts.igem.org/Part:BBa_J45004</a>. </p><br />
<br />
<p>● iGEM CIDEB Team. (2013). <i>iGEM CIDEB UANL 2013</i>. Retrieved on March 31th, 2014. <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico/Project"> https://2013hs.igem.org/Team:CIDEB-UANL_Mexico/Project</a>. </p><br />
<br />
<p>● iGEM08_TUDelft. (2008). <i>Part:BBa_K115017</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_K115017"> http://parts.igem.org/Part:BBa_K115017</a>. </p><br />
<br />
<p>● MIT IGEM Team. (2006). <i>MIT 2006</i>. Retrieved on March 31th, 2014, from: <a href="https://2006.igem.org/wiki/index.php/MIT_2006"> https://2006.igem.org/wiki/index.php/MIT_2006</a>. </p><br />
<br />
<p>● TUDelft iGEM Team. (2008). <i>TUDelft 2008</i>. Retrieved on March 31th, 2014, from: <a href="https://2008.igem.org/Team:TUDelft"> https://2008.igem.org/Team:TUDelft</a>. </p><br />
<br />
<p>● VictoriaBC. (2009). <i>VictoriaBC 2009</i>. Retrieved on March 31th, 2014, from: <a href="https://2009.igem.org/Team:VictoriaBC"> https://2009.igem.org/Team:VictoriaBC</a>. </p><br />
<br />
<p>● Zubieta, Chole et al. (2003). <i>Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family</i>. Manuscript submitted for publication. Retrieved from <a href="www.plantcell.org"> www.plantcell.org</a>. </p></font><br />
<br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma#"><font color="blue">Return to the Top</font></a></p><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html>{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_abstract
Team:CIDEB-UANL Mexico/project abstract
2014-06-21T02:42:31Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1" /><br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style>body{margin:0;width:100%;padding:0;background:#2056ac;font-family:'Oxygen',sans-serif;font-size:12pt;background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif)}h1,h2,h3{margin:0;padding-bottom:5px;color:#404040}p,ol,ul{margin-top:0}ol,ul{padding:0;list-style:none}p{line-height:1.60em;padding- right:3em}a{color:#2056ac}a:hover{text-decoration:none}.container{margin:0 auto;width:1200px}.container-text{margin:0 auto;width:75%;padding:0;font-family:'Oxygen',sans-serif;font-size:12pt;text-align:justify}.wrapper{overflow:hidden;padding:0 0 1em 0;background:#FFF}#wrapper1{background:#FFF}#wrapper2{overflow:hidden;background:#f3f3f3;padding:5em 0;text-align:center}#wrapper3{overflow:hidden;padding:0;background:#FFF}#banner{padding-top:2em}#welcome{overflow:hidden;width:1000px;padding:0 100px 0 100px;text-align:center}#welcome .content{padding:0 8em}.title{margin-bottom:1em}.title h2{font-size:2em}.title .byline{font-size:1.1em;color:#6F6F6F#}#three-column{overflow:hidden;margin-top:5em;padding-top:1em;border-top:1px solid rgba(0,0,0,0.2);text-align:center}#three-column h2{margin:1em 0;font-size:1.5em;font-weight:700}#three-column .icon{position:relative;display:block;margin:0 auto .80em auto;background:0;line-height:150px;font-size:4em;width:150px;height:100px;border-radius:100px;border:6px solid #67128f;text-align:center;color:#FFF}#three-column #tbox1,#three-column #tbox2,#three-column #tbox3{float:left;width:320px;padding:30px 40px 50px 40px}#three-column .title{text-align:center}#three-column .title h2{font-size:1.60em}#three-column .title .byline{padding-top:.50em;font-size:.90em;color:#858585}#three-column .arrow-down{border-top-color:#292929}ul.tools{margin:0;padding:0;list-style:none}ul.tools li{display:inline-block;padding:0 .2em;font-size:4em}ul.tools li span{display:none;margin:0;padding:0}ul.tools li a{color:#FFF}ul.tools li a:before{display:inline-block;background:#1abc9c;width:120px;height:120px;border-radius:50%;line-height:120px;text-align:center;color:#fff}.button{display:inline-block;margin-top:2em;padding:.8em 2em;background:#64abd1;line-height:1.8em;letter-spacing:1px;text-decoration:none;font-size:1em;color:#FFF}.button:before{display:inline-block;background:#8dcb89;margin-right:1em;width:40px;height:40px;line-height:40px;border-radius:20px;text-align:center;color:#272925}#portfolio{overflow:hidden;padding-top:5em;border-top:1px solid rgba(0,0,0,0.2)}#portfolio .box{text-align:center;color:rgba(0,0,0,0.5)}#portfolio h3{display:block;padding-bottom:1em;font-size:1em;color:rgba(0,0,0,0.6)}#portfolio .title{text-align:center}#portfolio .title h2{color:rgba(0,0,0,0.8)}.column1,.column2,.column3,.column4{width:282px}.column1,.column2,.column3{float:left;margin-right:24px}.column4{float:right}</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Abstract</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<p align="justify"><p>iGEM CIDEB 2014’s project consists on a biological filter in which sodium ions are taken out of saltwater. To achieve this objective, the project reunited 4 different genes, each one giving <i>E. coli</i> a certain ability to perform a specific task.</p><br />
<p>This year’s project consists of two devices: the first and main one is in charge of the removal of sodium ions. This device uses an aroma to report its effectivity. The second one is responsible of giving resistance to the bacteria to outstand conditions that would normally kill it, and also giving <i>E.coli</i> the ability to bind to silica or glass surfaces.</p><br />
<p>Even though the project was originally composed by this two devices, for experimental purposes it was divided into four different modules. These modules are named after their function, and the name of the project “E.CARU” is an acronym of each one of them.</p><br />
<p>The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank">Capture</a> module uses a completely new gene in iGEM that encodes for a protein that introduces sodium ions into the bacteria. The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank">Aroma</a> module is in charge of producing a mint-like odor in order to report the functionality of the Capture module. The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance" target="_blank">Resistance </a> module allows <i>E. coli</i> to withstand the salinity of the environment in which it is required to work, and finally, the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union" target="_blank"> Union</a> module causes the bacteria to join to silica or glass surfaces, giving it the ability to act as a biofilter.<br />
</p><br />
</div><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Problem</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<table width=100%><br />
<tr><br />
<td><br />
<p>Water has been always known as a source of life, but nowadays there is not enough usable fresh water available in the world. The global lack of fresh water is an issue that presents a dangerous problem to our future. Only a small portion of our planet's water is actually usable. Ninety-seven percent of the world's water is too salty for consumption or agricultural use. Furthermore, much of the rest is held in ice caps or other unattainable sources. This leaves approximately one percent of the global water as liquid and fresh; ninety-eight percent of which is groundwater (Bouwer, 2002).</p><br />
<p>For solving this problem different methods have been developed. One of them is desalination, converting sea water (rich in salts) into usable water, but this method is very expensive due to the great use of electrical energy and the extraction process produces dangerous wastes to the environment (Cotruvo, 2010).</p><br />
</td><br />
<td style="padding-left:12px"><br />
<img width=265 height=243 src="https://static.igem.org/mediawiki/2014hs/archive/c/c9/20140609211415%21Logo.png"/><br />
</td><br />
</tr><br />
</table><br />
<p>For that reason our project is focused on developing a biological machine capable of performing desalination, reducing costs and avoiding dangerous wastes during the process. For making this possible, <em>E. coli</em> needed to capture Na<SUP>+</SUP> ions in saline environments to be removed from water after performing its task.</p><br />
</div><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Overview</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<p>Before&nbsp;<em>E. coli</em>&nbsp;could be able to remove Na<sup>+</sup> ions from water, it needed to aquire a resistance to adverse conditions, in particular excess salt. This could be possible through a protein called &ldquo;IrrE&rdquo;, which makes&nbsp;<em>E. coli</em>&nbsp;resistant to saline environments as well as UV rays and temperature changes.<br /><br />
The protein NhaS (a new part), was used to give <em>E. coli</em> the ability to bind and capture Na+ ions. Also, the optimized version of the reporter &ldquo;BSMT1&rdquo;, a protein able to react with salicylic acid and release a Wintergreen odor, was used to know if nhaS was expressed.<br /><br />
The final task that&nbsp;<em>E. coli</em>&nbsp;should perform was to bind its membrane to silica pearls, in order to be able to be removed from the water after sequestering Na<sup>+</sup> ions. In order to do this, a fusion protein named L2+AIDA was used. L2 gives&nbsp;<em>E. coli</em>&nbsp;the ability to bind silica, and AIDA acts as a tag for making L2 a membrane protein. With this ability&nbsp;<em>E. coli</em>&nbsp;could be removed from water through a bio-filter, made up of silica.<br /><br />
The complete circuit is shown in&nbsp;<strong>figure 1</strong>. BSMT1 opt acts as a reporter for nhaS which is regulated by UV (to have a control over the NhaS expression), and IrrE with L2+AIDA are continuously produced.</p><br />
<p align="justify">&nbsp;</p><br />
<center><br />
<p><img width=552 height=313 src="https://static.igem.org/mediawiki/2014hs/6/6a/Correct_circuit_cideb.png" align=center hspace=12 alt="IMG_0317"></p><br />
<p><b>Figure 1.</b> Diagram representing our proposed circuit</p><br />
</center><br />
<p>But we realized <i>E. coli</i> could have a genetic overload because the circuit was too big (approximately 5000 bp). Also the time we had to finish it was not enough, as well as most of the proteins we wanted to produce were putative or untested. So for a better understanding and for determine if each piece works we divided the project into four modules: capture, union, aroma and resistance, but the project is the result of their correlation. In fact our <i>E. coli</i> was named E. CARU (each letter by each module). </p><br />
<center><br />
<table width=60%><br />
<tr><br />
<td><br />
<p><b>E</b>scherichia coli</p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank"><b>C</b>apture</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><b>A</b>roma</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance" target="_blank"><b>R</b>esistance </a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union" target="_blank"><b>U</b>nion</a></p><br />
</td><br />
<td style="padding-left:12px"><img width=286 height=285 src="https://static.igem.org/mediawiki/2014hs/3/30/Image006cideb2014.png"/><br />
</td><br />
</tr><br />
</table><br />
</center><br />
<br />
<p><b><h2>Bibliography/References</h2></b></p><br />
<font size="2"><br />
<p>● Bouwer, H. (2002). Integrated Water Management for the 21st Century: Problems and Solutions. Journal of irrigation and drainage engineering, 193-200.</p><br />
<p>● Joseph Cotruvo, N. V. (2010). Desalination Technology: Health and Environmental Impacts. U.S: Taylor and Francis Group.</p><br><br />
<div style="text-align:right"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_abstract#"><font color="blue">Return to the Top</font></a></p></div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_abstract
Team:CIDEB-UANL Mexico/project abstract
2014-06-21T02:40:32Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1" /><br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style>body{margin:0;width:100%;padding:0;background:#2056ac;font-family:'Oxygen',sans-serif;font-size:12pt;background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif)}h1,h2,h3{margin:0;padding-bottom:5px;color:#404040}p,ol,ul{margin-top:0}ol,ul{padding:0;list-style:none}p{line-height:1.60em;padding- right:3em}a{color:#2056ac}a:hover{text-decoration:none}.container{margin:0 auto;width:1200px}.container-text{margin:0 auto;width:75%;padding:0;font-family:'Oxygen',sans-serif;font-size:12pt;text-align:justify}.wrapper{overflow:hidden;padding:0 0 1em 0;background:#FFF}#wrapper1{background:#FFF}#wrapper2{overflow:hidden;background:#f3f3f3;padding:5em 0;text-align:center}#wrapper3{overflow:hidden;padding:0;background:#FFF}#banner{padding-top:2em}#welcome{overflow:hidden;width:1000px;padding:0 100px 0 100px;text-align:center}#welcome .content{padding:0 8em}.title{margin-bottom:1em}.title h2{font-size:2em}.title .byline{font-size:1.1em;color:#6F6F6F#}#three-column{overflow:hidden;margin-top:5em;padding-top:1em;border-top:1px solid rgba(0,0,0,0.2);text-align:center}#three-column h2{margin:1em 0;font-size:1.5em;font-weight:700}#three-column .icon{position:relative;display:block;margin:0 auto .80em auto;background:0;line-height:150px;font-size:4em;width:150px;height:100px;border-radius:100px;border:6px solid #67128f;text-align:center;color:#FFF}#three-column #tbox1,#three-column #tbox2,#three-column #tbox3{float:left;width:320px;padding:30px 40px 50px 40px}#three-column .title{text-align:center}#three-column .title h2{font-size:1.60em}#three-column .title .byline{padding-top:.50em;font-size:.90em;color:#858585}#three-column .arrow-down{border-top-color:#292929}ul.tools{margin:0;padding:0;list-style:none}ul.tools li{display:inline-block;padding:0 .2em;font-size:4em}ul.tools li span{display:none;margin:0;padding:0}ul.tools li a{color:#FFF}ul.tools li a:before{display:inline-block;background:#1abc9c;width:120px;height:120px;border-radius:50%;line-height:120px;text-align:center;color:#fff}.button{display:inline-block;margin-top:2em;padding:.8em 2em;background:#64abd1;line-height:1.8em;letter-spacing:1px;text-decoration:none;font-size:1em;color:#FFF}.button:before{display:inline-block;background:#8dcb89;margin-right:1em;width:40px;height:40px;line-height:40px;border-radius:20px;text-align:center;color:#272925}#portfolio{overflow:hidden;padding-top:5em;border-top:1px solid rgba(0,0,0,0.2)}#portfolio .box{text-align:center;color:rgba(0,0,0,0.5)}#portfolio h3{display:block;padding-bottom:1em;font-size:1em;color:rgba(0,0,0,0.6)}#portfolio .title{text-align:center}#portfolio .title h2{color:rgba(0,0,0,0.8)}.column1,.column2,.column3,.column4{width:282px}.column1,.column2,.column3{float:left;margin-right:24px}.column4{float:right}</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Abstract</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<p align="justify"><p>iGEM CIDEB 2014’s project consists on a biological filter in which sodium ions are taken out of saltwater. To achieve this objective, the project reunited 4 different genes, each one giving <i>E. coli</i> a certain ability to perform a specific task.</p><br />
<p>This year’s project consists of two devices: the first and main one is in charge of the removal of sodium ions. This device uses an aroma to report its effectivity. The second one is responsible of giving resistance to the bacteria to outstand conditions that would normally kill it, and also giving <i>E.coli</i> the ability to bind to silica or glass surfaces.</p><br />
<p>Even though the project was originally composed by this two devices, for experimental purposes it was divided into four different modules. These modules are named after their function, and the name of the project “E.CARU” is an acronym of each one of them.</p><br />
<p>The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank">Capture</a> module uses a completely new gene in iGEM that encodes for a protein that introduces sodium ions into the bacteria. The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank">Aroma</a> module is in charge of producing a mint-like odor in order to report the functionality of the Capture module. The <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance" target="_blank">Resistance </a> module allows <i>E. coli</i> to withstand the salinity of the environment in which it is required to work, and finally, the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union" target="_blank"> Union</a> module causes the bacteria to join to silica or glass surfaces, giving it the ability to act as a biofilter.<br />
</p><br />
</div><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Problem</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<table width=100%><br />
<tr><br />
<td><br />
<p>Water has been always known as a source of life, but nowadays there is not enough usable fresh water available in the world. The global lack of fresh water is an issue that presents a dangerous problem to our future. Only a small portion of our planet's water is actually usable. Ninety-seven percent of the world's water is too salty for consumption or agricultural use. Furthermore, much of the rest is held in ice caps or other unattainable sources. This leaves approximately one percent of the global water as liquid and fresh; ninety-eight percent of which is groundwater (Bouwer, 2002).</p><br />
</td><br />
<td style="padding-left:12px"><br />
<img width=265 height=243 src="https://static.igem.org/mediawiki/2014hs/archive/c/c9/20140609211415%21Logo.png"/><br />
</td><br />
</tr><br />
</table><br />
<p>For solving this problem different methods have been developed. One of them is desalination, converting sea water (rich in salts) into usable water, but this method is very expensive due to the great use of electrical energy and the extraction process produces dangerous wastes to the environment (Cotruvo, 2010).</p><br />
<p>For that reason our project is focused on developing a biological machine capable of performing desalination, reducing costs and avoiding dangerous wastes during the process. For making this possible, <em>E. coli</em> needed to capture Na<SUP>+</SUP> ions in saline environments to be removed from water after performing its task.</p><br />
</div><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Overview</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<p>Before&nbsp;<em>E. coli</em>&nbsp;could be able to remove Na<sup>+</sup> ions from water, it needed to aquire a resistance to adverse conditions, in particular excess salt. This could be possible through a protein called &ldquo;IrrE&rdquo;, which makes&nbsp;<em>E. coli</em>&nbsp;resistant to saline environments as well as UV rays and temperature changes.<br /><br />
The protein NhaS (a new part), was used to give <em>E. coli</em> the ability to bind and capture Na+ ions. Also, the optimized version of the reporter &ldquo;BSMT1&rdquo;, a protein able to react with salicylic acid and release a Wintergreen odor, was used to know if nhaS was expressed.<br /><br />
The final task that&nbsp;<em>E. coli</em>&nbsp;should perform was to bind its membrane to silica pearls, in order to be able to be removed from the water after sequestering Na<sup>+</sup> ions. In order to do this, a fusion protein named L2+AIDA was used. L2 gives&nbsp;<em>E. coli</em>&nbsp;the ability to bind silica, and AIDA acts as a tag for making L2 a membrane protein. With this ability&nbsp;<em>E. coli</em>&nbsp;could be removed from water through a bio-filter, made up of silica.<br /><br />
The complete circuit is shown in&nbsp;<strong>figure 1</strong>. BSMT1 opt acts as a reporter for nhaS which is regulated by UV (to have a control over the NhaS expression), and IrrE with L2+AIDA are continuously produced.</p><br />
<p align="justify">&nbsp;</p><br />
<center><br />
<p><img width=552 height=313 src="https://static.igem.org/mediawiki/2014hs/6/6a/Correct_circuit_cideb.png" align=center hspace=12 alt="IMG_0317"></p><br />
<p><b>Figure 1.</b> Diagram representing our proposed circuit</p><br />
</center><br />
<p>But we realized <i>E. coli</i> could have a genetic overload because the circuit was too big (approximately 5000 bp). Also the time we had to finish it was not enough, as well as most of the proteins we wanted to produce were putative or untested. So for a better understanding and for determine if each piece works we divided the project into four modules: capture, union, aroma and resistance, but the project is the result of their correlation. In fact our <i>E. coli</i> was named E. CARU (each letter by each module). </p><br />
<center><br />
<table width=60%><br />
<tr><br />
<td><br />
<p><b>E</b>scherichia coli</p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture" target="_blank"><b>C</b>apture</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma" target="_blank"><b>A</b>roma</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance" target="_blank"><b>R</b>esistance </a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union" target="_blank"><b>U</b>nion</a></p><br />
</td><br />
<td style="padding-left:12px"><img width=286 height=285 src="https://static.igem.org/mediawiki/2014hs/3/30/Image006cideb2014.png"/><br />
</td><br />
</tr><br />
</table><br />
</center><br />
<br />
<p><b><h2>Bibliography/References</h2></b></p><br />
<font size="2"><br />
<p>● Bouwer, H. (2002). Integrated Water Management for the 21st Century: Problems and Solutions. Journal of irrigation and drainage engineering, 193-200.</p><br />
<p>● Joseph Cotruvo, N. V. (2010). Desalination Technology: Health and Environmental Impacts. U.S: Taylor and Francis Group.</p><br><br />
<div style="text-align:right"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_abstract#"><font color="blue">Return to the Top</font></a></p></div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_explosion
Team:CIDEB-UANL Mexico/hp explosion
2014-06-19T17:16:01Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Mascot & iGEM Explosion</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b><h2><center>iGEM Mascot</center></h2></b></p><br />
<br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p>With the purpose of obtaining information of how our high school and the public in general sees iGEM and our iGEM CIDEB project we created our own iGEM mascot. According to the divulgation objective, the group has developed activities with the goal of showing an overview of synthetic biology, as an initiative and entertaining visual recognition, a mascot was elaborated. The importance and objective of the mascot is to generate interest among people, causing them to come and see paraphernalia explaining our project (posters, bracelets bearing an explanation of our project, etc.) There are two main activities where the motley was used; the first one is called DNA Week – it took place inside a high school, and consisted of several activities that promoted synthetic biology. The second activity was called Race 4 Science, and consisted in a series of modules concerning synthetic biology and its different areas.</p><br />
</td><br />
<td style="padding-left:12px;"><img width=160 height=240 src="https://static.igem.org/mediawiki/2014hs/a/a3/CIDEBHPbotarga1.jpg"/><br />
<center><p><b>Image 1.</b> Motley during the race for science.</p></center></td><br />
</tr></table><br />
<br />
<br><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:100px;"><img width=324 height=216 src="https://static.igem.org/mediawiki/2014hs/9/94/CIDEBHPbotarga2.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=320 height=213 src="https://static.igem.org/mediawiki/2014hs/c/cf/CIDEBHPbotarga3.jpg"/></td><br />
<br />
</tr></table><br />
<br />
<br><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:100px;"><img width=320 height=240 src="https://static.igem.org/mediawiki/2014hs/6/63/CIDEBHPbotarga4.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=324 height=216 src="https://static.igem.org/mediawiki/2014hs/0/07/CIDEBHPbotarga5.jpg"/></td><br />
<br />
</tr></table><br />
<center><p><b>Image 2.</b> Motley participating during the different iGEM activities.</p></center><br />
<br />
<br><br />
<br />
<p><b><h2><center>iGEM Explosion</center></h2></b></p><br />
<br><br />
<p><b><h2>Objective and Description</h2></b></p><br />
<br />
<p>When we started our project, we noticed that the students, teachers and administrative employees in our high school, were not involved in our project and in the iGEM competition as we wanted them to be. For this reason, we decided to make the iGEM “Explosion” to inform everyone in our high school about iGEM and stimulate their curiosity.</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:60px;"><img width=282 height=95 src="https://static.igem.org/mediawiki/2014hs/e/e1/CIDEBHPexplosion1.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=192 height=174 src="https://static.igem.org/mediawiki/2014hs/7/7a/CIDEBHPexplosion2.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=198 height=106 src="https://static.igem.org/mediawiki/2014hs/6/66/CIDEBHPexplosion3.png"/></td><br />
<br />
</tr></table><br />
<br />
<center><p><b>Image 3.</b> Different logos used during the iGEM explosion.</p></center><br />
<br />
<p>Our activities were all focused in giving them a little bit of information about us in a creative way.</p><br />
<br />
<p>For this “Explosion”, we designed several posters with images related to iGEM and some more with information about our project. After this, on the first day after vacations, we placed these posters all over our high school building in commonly visited areas. With this we could make the students to pass and look what the posters said, inciting curiosity towards iGEM.</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:60px;"><img width=173 height=126 src="https://static.igem.org/mediawiki/2014hs/5/53/CIDEBHPexplosion4.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=173 height=160 src="https://static.igem.org/mediawiki/2014hs/b/bf/CIDEBHPexplosion5.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=113 height=196 src="https://static.igem.org/mediawiki/2014hs/1/1f/CIDEBHPexplosion6.png"/></td><br />
<br />
</tr></table><br />
<br />
<center><p><b>Image 4.</b> Messages showed to the students on the iGEM explosion.</p></center><br />
<br />
<p>We also made a Facebook page and Twitter account with the purpose of uploading pictures of the team working, several science related images, information related to our project and updates of our activities in laboratory, so people could see all of our progress in an easy way.</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:100px;"><img width=274 height=257 src="https://static.igem.org/mediawiki/2014hs/6/62/CIDEBHPexplosion7.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=343 height=224 src="https://static.igem.org/mediawiki/2014hs/8/81/CIDEBHPexplosion8.png"/></td><br />
<br />
</tr></table><br />
<br />
<center><p><b>Image 5.</b> Different social webs of the team.</p></center><br />
<br />
<p>We wanted everyone to have something personal and related to us, so we made bracelets and sold them. Both of the designs we made had the caption “IGEM” on them, the blue bracelets also had some little figures representing the 4 modules or our project and a tiny E.CARU with its representative snorkel. The other design was either given in green and white (iGEM colors) or purple and yellow (our High School colors), they looked like the DNA structure and were hand-made by us!</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:100px;"><img width=256 height=166 src="https://static.igem.org/mediawiki/2014hs/6/62/CIDEBHPexplosion9.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=230 height=172 src="https://static.igem.org/mediawiki/2014hs/9/9b/CIDEBHPexplosion10.png"/></td><br />
<br />
</tr></table><br />
<br />
<center><p><b>Image 6.</b> Bracelets sold during iGEM explosion.</p></center><br />
<br />
<p><b><h2>Impact</h2></b></p><br />
<br />
<br />
<p>The posters gained the attention of the people who were walking nearby. Teachers and students stopped and after reading them they continued their way. Now people had the opportunity of learning what our project is about just by walking through the high school halls.</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:100px;"><img width=282 height=187 src="https://static.igem.org/mediawiki/2014hs/a/ae/CIDEBHPexplosion11.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=230 height=200 src="https://static.igem.org/mediawiki/2014hs/2/2c/CIDEBHPexplosion12.png"/></td><br />
<br />
</tr></table><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:100px;"><img width=280 height=180 src="https://static.igem.org/mediawiki/2014hs/4/44/CIDEBHPexplosion13.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=230 height=160 src="https://static.igem.org/mediawiki/2014hs/5/53/CIDEBHPexplosion14.png"/></td><br />
<br />
</tr></table><br />
<center><p><b>Image 7.</b> Posters used during iGEM explosion.</p></center><br />
<br><br />
<br />
<br />
<p>With the purpose of motivating second semester students, we planned and exposed an informative conference for the people who were interested in being part of next year’s iGEM CIDEB team. We introduced them the idea that our project should continue in our high school. With activities like “Explosion”, we caught their attention because they could find out what an iGEM project is, what it consists of, and how exciting it can be. The conference was in our high school auditorium. When the set hour arrived, students were already inside; they showed real interest of being part of this, because they discovered what iGEM is about. </p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:60px;"><img width=258 height=181 src="https://static.igem.org/mediawiki/2014hs/5/5d/CIDEBHPexplosion15.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=260 height=162 src="https://static.igem.org/mediawiki/2014hs/a/a0/CIDEBHPexplosion16.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=273 height=183 src="https://static.igem.org/mediawiki/2014hs/f/f5/CIDEBHPexplosion17.png"/></td><br />
<br />
</tr></table><br><br />
<center><p><b>Image 8.</b> Students interested in forming part of the new iGEM CIDEB 2015 team.</p></center><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_explosion#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav
Team:CIDEB-UANL Mexico/hp cinvestav
2014-06-19T15:57:00Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>CINVESTAV Conference</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p><img width=300 height=200 src="https://static.igem.org/mediawiki/2014hs/2/2e/CINVESTAV_1CIDEB.JPG"/></p><p><The team during the presentation</p><br />
</td><br />
<td style="padding-left:12px;"><p>On Friday March 7th, 40 Chilean teachers from the Instituto Politécnico Nacional, located inMexico D.F. visited our High School. They were not very familiar with what the iGEM competition is all about, so we invited them to a conference in the Auditorium were we gave a presentation including an iGEM introduction, its principal areas, our team background and the explanation of our project, enclosing also our previews ideas, with the intention of letting people from other states know about iGEM, specially about our team, and what we are doing. This gave us not only a state parameter, but a national one too.</p></td><br />
</tr></table><br />
<br />
<br><p><b><h2>Description</h2></b></p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p>In a PPT presentation we covered the most related topics of iGEM. We started with an introduction of what the iGEM competition is and what it is about, we also included the basics of iGEM’s history, mentioning how the High School division was formed.</p><br />
<br />
<p>We explained how this competition is multidisciplinary and showed all the characteristics that an IGEM team has, therefore, we explained to the teachers the different parts of the project like safety, dry lab, human practices, etc.</p><br />
<br />
<p>Then, we wanted to show them how we finally got to our project; including a brief description of all the ideas we had during the meetings until deciding the final one. Afterwards, we included a complete description of our project and the purpose we had for it. Finally, a brief explanation of the previous teams in our High School was included, along with the places they got.</p><br />
<br />
<p>We also had some time for questions from them, and it was very encouraging that they had supporting comments for us and the presentation. This was a great feedback for us.</p><br />
</td><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/5/5a/CINVESTAV_2CIDEB.JPG"/></td><br />
<br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/d/dd/CINVESTAV_3CIDEB.JPG"/></td><br />
<br />
</tr></table><br />
<br />
<font size="3pt"><p><center>Chilean teachers attending to the presentation</center></font></p><br />
<br />
<br><p><b><h2>Impact</h2></b></p><br />
<br />
<p>We applied surveys with 5 different questions to each teacher and registered the results:</p><br />
<br />
<center><p><br><img width=550 height=300 src="https://static.igem.org/mediawiki/2014hs/2/2b/Graphcinvestav1CIDEB.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><font size="3pt"><p>Graph showing the results of the surveys.</font> <br></center><br />
<br />
<p>The questions above showed us that 80% of the teachers that received our presentation and an explanation of our project considered that it is an idea which if developed, could be very useful for the society.</p><br />
<br />
<p>With this survey it was also shown that most teachers qualified our presentation between 4 and 5. This means that what we tried to explain was very clear for them.</p><br />
<br />
<p>Also rating between 5 and 4, teachers considered very complete and understandable our concepts in the presentation.</p><br />
<br />
<p>97% of the teachers considrered synthethic biology as a good path to develop solutions for actual issues in the world, they were in favor of the usage of synthethic biology (see <b>Chart 1</b>).</p><br />
<br />
<p>Finally, we wanted to have a general overview of the presentation and decided to include in the answers different adjectives so the teachers could choose, the most chosen one was “Interesting” which is a positive feedback for us, a minor of 3% chose “confused" (see <b>Chart 2</b>).</p><br />
<br><br />
<table width=100%><br />
<tr><br />
<td><br />
<td style="padding-left:40px;"><p><img width=400 height=225 src="https://static.igem.org/mediawiki/2014hs/a/ad/Graphcinvestav2CIDEB.jpg"/></p><br />
<font size="3pt"><p><center><b>Chart 1</b></p><br />
<br />
</td><br />
<td style="padding-left:80px;"><p><img width=400 height=250 src="https://static.igem.org/mediawiki/2014hs/4/49/Graphcinvestav3CIDEB.jpg"/></p><br />
<font size="3pt"><p><center><b>Chart 2</b></p></font></td><br />
</tr></table><br><br />
<br />
<p>We consider this activity had great repercussions in both the teachers and us, because they learned about a very interesting international project and took that information to Chile, their country. Probably they are going to spread the information we gave them and maybe there could be more Chilean iGEM teams in the future.</p><br />
<br />
<p>As for us, it helped us to hear the perspective of teachers about our project, and as we mentioned, it was very encouraging to hear their positive thoughts and feedback to improve ourselves.</p><br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav#"><font color="blue">Return to the Top</font></a></p></div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_enlacecientifico
Team:CIDEB-UANL Mexico/hp enlacecientifico
2014-06-19T15:51:27Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>"Enlace Cientifico" Conference</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b><h2>Objective and Description</h2></b></p> <br />
<br />
<p>After an advance in science is achieved, the scientist’s community is obligated to share their discoveries. In the specific case of México, there are many programs and business eager to share those achievements.</p><br />
<br />
<p>The company “<i>Enlace Científico</i>” sent an invitation to the CIDEB-UANL 2014 team to participate in a conference at the <i>Facultad de Agronomía</i> (Agronomy’s Faculty) in collaboration with other institutions. This conference represented a great opportunity to create relationships with other institutions, encourage people to create their own iGEM teams and talk about our experiences, feeling and opportunities to grow trough the competence.</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p>In order to achieve these objectives, the conference was planned and presented by the older students in the team, those who had participated at an iGEM competition before; we made a presentation wich incuded the information of CIDEB-UANL 2013 including our goals, dificulties, experiences and most importantly, what happened with all members after finishing the project. We worked with a representative of IGEM-UANL 2014 team, a representative of TecMonterrey team and some others.</p><br />
<br />
<p>When the conference began, the director of the company “<i>Enlace Científico</i>” presented each of the speakers and gave a general idea of what the iGEM competition was.</p><br />
<br />
</td><br />
<td style="padding-left:12px;"><img width=355 height=225 src="https://static.igem.org/mediawiki/2014hs/8/89/Enlace_2.jpg"/><br />
</tr></table><br />
<br />
<br><br />
<p>After that, the first speaker was a representative from IGEM-UANL 2013. He gave a more detailed explanation about the iGEM competition and he showed details about the project of his team, his experiences and achieved goals. Consecutively, we showed our presentation; it contained 3 main stages: the first being &quot;what the competition was&quot;, followed by the second &quot;who were part of the CIDEB-UANL 2013 team and how were they distributed&quot;, the third goal was to describe which were the difficulties and goals achieved, and finally, the fourth goal was toi speak about what happened after the competition.</p><br />
<br />
<p>For the first stage we introduced the competition information and its history, about the first participants and the amount of teams participating today.</p><br />
<br />
<p>Afterwards, we showed an image of the CIDEB-UANL 2013 team’s members and explained the way we were organized in order to achieve each important part: Math model, Human practices, Safety, etc.</p><br />
<br />
<p>For the 3rd part, we explained the initial difficulties of the creation of the project, mostly about the ideas that were a possibility but didn’t evolve into the real project. The idealization of a viable project is the most difficult part of the entire work because most of the time an idea can be very difficult to achieve or another team could have done it already.</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p><img width=320 height=190 src="https://static.igem.org/mediawiki/2014hs/c/cb/Enlace_3.jpg"/></p><br />
<br />
</td><br />
<td style="padding-left:12px;"><p>Finally, we talked about what followed the project, in the case of the UANL-CIDEB 2013 team. As we all were high school students the general idea was that everyone would continue their education, each member took a different career according to their ideas and aims but before that we established that our project could be viable and could be used by one of the members or another person for future experiments. This is the most important part of the iGEM project, to think about the consequences of the project and try to improve something in the world.</p><br />
<br />
<p>After our presentation, the missing groups explained their projects and goals trough the competition.</p></td><br />
</tr></table><br />
<br />
<p><b><h2>Impact</h2></b></p> <br />
<br />
<p>The impact of this conference was showed by the students. First of all there were a variation of questions about the projects and the experiences obtained by participating in a project of this category. There were students that wanted to create a new team but planned to participate until 2015.</p><br />
<br />
<br />
<p>It was an event where we had the opportunity to share time with other iGEM teams form Mexico, talked about our projects and at the same time, we encouraged students to join the iGEM community.</p><br />
<br />
</td><br />
<td style="padding-left:12px;"><img width=355 height=225 src="https://static.igem.org/mediawiki/2014hs/8/88/Enlace_4.jpg"/><br />
</tr></table><br />
<br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_enlacecientifico#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_enlacecientifico
Team:CIDEB-UANL Mexico/hp enlacecientifico
2014-06-19T15:48:51Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>"Enlace Cientifico" Conference</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b><h2>Objective and Description</h2></b></p> <br />
<br />
<p>After an advance in science is achieved, the scientist’s community is obligated to share their discoveries. In the specific case of México, there are many programs and business eager to share those achievements.</p><br />
<br />
<p>The company “<i>Enlace Científico</i>” sent an invitation to the CIDEB-UANL 2014 team to participate in a conference at the <i>Facultad de Agronomía</i> (Agronomy’s Faculty) in collaboration with other institutions. This conference represented a great opportunity to create relationships with other institutions, encourage people to create their own iGEM teams and talk about our experiences, feeling and opportunities to grow trough the competence.</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p>In order to achieve these objectives, the conference was planned and presented by the older students in the team, those who had participated at an iGEM competition before; we made a presentation wich incuded the information of CIDEB-UANL 2013 including our goals, dificulties, experiences and most importantly, what happened with all members after finishing the project. We worked with a representative of IGEM-UANL 2014 team, a representative of TecMonterrey team and some others.</p><br />
<br />
<p>When the conference began, the director of the company “<i>Enlace Científico</i>” presented each of the speakers and gave a general idea of what the iGEM competition was.</p><br />
<br />
</td><br />
<td style="padding-left:12px;"><img width=355 height=225 src="https://static.igem.org/mediawiki/2014hs/8/89/Enlace_2.jpg"/><br />
</tr></table><br />
<br />
<br><br />
<p>After that, the first speaker was a representative from IGEM-UANL 2013. He gave a more detailed explanation about the iGEM competition and he showed details about the project of his team, his experiences and achieved goals. Consecutively, we showed our presentation; it contained 3 main stages: the first being &quot;what the competition was&quot;, followed by the second &quot;who were part of the CIDEB-UANL 2013 team and how were they distributed&quot;, the third goal was to describe which were the difficulties and goals achieved, and finally, the fourth goal was toi speak about what happened after the competition.</p><br />
<br />
<p>For the first stage we introduced the competition information and its history, about the first participants and the amount of teams participating today.</p><br />
<br />
<p>Afterwards, we showed an image of the CIDEB-UANL 2013 team’s members and explained the way we were organized in order to achieve each important part: Math model, Human practices, Safety, etc.</p><br />
<br />
<p>For the 3rd part, we explained the initial difficulties of the creation of the project, mostly about the ideas that were a possibility but didn’t evolve into the real project. The idealization of a viable project is the most difficult part of the entire work because most of the time an idea can be very difficult to achieve or another team could have done it already.</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p><img width=320 height=190 src="https://static.igem.org/mediawiki/2014hs/c/cb/Enlace_3.jpg"/></p><br />
<br />
</td><br />
<td style="padding-left:12px;"><p>Finally, we talked about what followed the project, in the case of the UANL-CIDEB 2013 team. As we all were high school students the general idea was that everyone would continue their education, each member took a different career according to their ideas and aims but before that we established that our project could be viable and could be used by one of the members or another person for future experiments. This is the most important part of the iGEM project, to think about the consequences of the project and try to improve something in the world.</p><br />
<br />
<p>After our presentation, the missing groups explained their projects and goals trough the competition.</p></td><br />
</tr></table><br />
<br />
<p><b><h2>Impact</h2></b></p> <br />
<br />
<p>The impact of this conference was showed by the students. First of all there were a variation of questions about the projects and the experiences obtained by participating in a project of this category. There were students that wanted to create a new team but planned to participate until 2015.</p><br />
<br />
<br />
<p>It was an event we had the opportunity to share time with other iGEM teams form Mexico, talked about our projects and at the same time, we encouraged students to join the iGEM community.</p><br />
<br />
</td><br />
<td style="padding-left:12px;"><img width=355 height=225 src="https://static.igem.org/mediawiki/2014hs/8/88/Enlace_4.jpg"/><br />
</tr></table><br />
<br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_enlacecientifico#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations
Team:CIDEB-UANL Mexico/hp collaborations
2014-06-19T15:41:54Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Collaborations</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b><h2> Objective</h2></b></p> <br />
Collaborate with other iGEM teams and share information, knowledge and experiences, so we can receive new points of view and also help more iGEM competitors.</p><br />
<br />
<br><br />
<br />
<p style="font-size:20px"><b>GenetiX_Tec_CCM</b></p><br />
<br />
<p>On Monday June the 2nd we had a videoconference with “GenetiX_Tec_CCM” team, from “Tecnológico de Monterrey Campus Ciudad de México” high school. At the beginning, they were contacting one of our teammates and they asked if we could make a Skype Call, we of course accepted and scheduled it when both teams could concur. As we are both Mexican teams, we decided to help each other, also as a symbol of the national help between its habitants.</p><br />
<br />
<p>On the videoconference both teams talked about how our projects were developing, if we had any problem with the BioBricks or tools needed for the project. We also talked about general information from our teams, like the number of members, how old we are, how we started in the iGEM Competition, and more. </p><br />
<br />
<p>We also had an exchange of information about our projects and it was very interesting to know in what are they working on, how they did it or if they received some kind of capacitation or help from their institution, also telling them how these situations were in our team.</p><br />
<br />
<p>This was a great experience for us; to talk to other students with the same age as us, which are working in their own project as we are doing in ours and share our great iGEM experience.</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/8/81/HPCOLLABMEX1.JPG"/></td><br />
<br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/3/36/HPCOLLABMEX2.JPG"/></td><br />
<br />
</tr></table><br />
<br />
<br><br />
<br />
<p style="font-size:20px"><b>UCL_London</b></p><br />
<br />
<p>On Monday June the 9th, we had a Skype videoconference with the “Team:UCL” from London. At first, we scheduled the conference to discuss things about the usage of the IrrE gene. The conversation was about our project, but they also explained their project to us. It was very interesting listening to their project, and how they were developing it; their project was about removing ammonia from water and they were using the IrrE gene to give resistance to the bacteria and a kill switch to avoid uncontrolled spreading. We also spoke about the sponsors they have, and how many team members they were and vice-versa. The team offered us to sequence some pieces, unluckily; we had already sequenced everything that had to be sequenced.</p><br />
<br />
<p>The collaboration ended up to be actually very nice and friendly, sharing our opinions about each other’s projects and talking about the teams was a great experience.</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:px;"><img width=480 height=270 src="https://static.igem.org/mediawiki/2014hs/9/92/HPLONDONCOLLAB2.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=480 height=270 src="https://static.igem.org/mediawiki/2014hs/1/14/HPLONDONCOLLAB1.jpg"/></td><br />
<br />
</tr></table><br />
<br />
<br><br />
<br />
<p style="font-size:20px"><b>EVRY France</b></p><br />
<br />
<p>On Wednesday June the 11th, we shared a videoconference with the “Team: EVRY-Genople” from the college category, in order to continue with our teams collaboration activity. The reunion was scheduled from 12:00 to 12:40, in which we shared our projects and ideas, in order to improve them.</p><br />
<br />
<p>In this conference we found out that both projects were very similar, because both worked in saline environments. Their project was about modifying sponges to absorb certain substances in a marine environment, and the piece that we were using for the resistance module: IrrE, would be very helpful in their further project development. In order to continue with this collaboration, we agreed to send the necessary information of our working genes when the experimentation was over.</p><br />
<br />
<p>This conference was very rich in content, because is the first time in which we are able to be helpful to another team, besides we met different people, which was a great experience too, like the previous ones.</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:px;"><img width=480 height=270 src="https://static.igem.org/mediawiki/2014hs/3/30/HPFRANCECOLLAB1.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=480 height=270 src="https://static.igem.org/mediawiki/2014hs/b/b4/HPFRANCECOLLAB2.jpg"/></td><br />
<br />
</tr></table><br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav
Team:CIDEB-UANL Mexico/hp cinvestav
2014-06-19T15:40:47Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>CINVESTAV Conference</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p><img width=300 height=200 src="https://static.igem.org/mediawiki/2014hs/2/2e/CINVESTAV_1CIDEB.JPG"/></p><br />
</td><br />
<td style="padding-left:12px;"><p>On Friday March 7th, 40 Chilean teachers from the Instituto Politécnico Nacional, located inMexico D.F. visited our High School. They were not very familiar with what the iGEM competition is all about, so we invited them to a conference in the Auditorium were we gave a presentation including an iGEM introduction, its principal areas, our team background and the explanation of our project, enclosing also our previews ideas, with the intention of letting people from other states know about iGEM, specially about our team, and what we are doing. This gave us not only a state parameter, but a national one too.</p></td><br />
</tr></table><br />
<br />
<br><p><b><h2>Description</h2></b></p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p>In a PPT presentation we covered the most related topics of iGEM. We started with an introduction of what the iGEM competition is and what it is about, we also included the basics of iGEM’s history, mentioning how the High School division was formed.</p><br />
<br />
<p>We explained how this competition is multidisciplinary and showed all the characteristics that an IGEM team has, therefore, we explained to the teachers the different parts of the project like safety, dry lab, human practices, etc.</p><br />
<br />
<p>Then, we wanted to show them how we finally got to our project; including a brief description of all the ideas we had during the meetings until deciding the final one. Afterwards, we included a complete description of our project and the purpose we had for it. Finally, a brief explanation of the previous teams in our High School was included, along with the places they got.</p><br />
<br />
<p>We also had some time for questions from them, and it was very encouraging that they had supporting comments for us and the presentation. This was a great feedback for us.</p><br />
</td><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/5/5a/CINVESTAV_2CIDEB.JPG"/></td><br />
<br />
<td style="padding-left:px;"><img width=480 height=320 src="https://static.igem.org/mediawiki/2014hs/d/dd/CINVESTAV_3CIDEB.JPG"/></td><br />
<br />
</tr></table><br />
<br />
<br><br />
<br />
<br><p><b><h2>Impact</h2></b></p><br />
<br />
<p>We applied surveys with 5 different questions to each teacher and registered the results:</p><br />
<br />
<center><p><br><img width=600 height=300 src="https://static.igem.org/mediawiki/2014hs/2/2b/Graphcinvestav1CIDEB.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br></center><br />
<br />
<p>The questions above showed us that 80% of the teachers that received our presentation and an explanation of our project considered that it is an idea which if developed, could be very useful for the society.</p><br />
<br />
<p>With this survey it was also shown that most teachers qualified our presentation between 4 and 5. This means that what we tried to explain was very clear for them.</p><br />
<br />
<p>Also rating between 5 and 4, teachers considered very complete and understandable our concepts in the presentation.</p><br />
<br />
<p>97% of the teachers considrered synthethic biology as a good path to develop solutions for actual issues in the world, they were in favor of the usage of synthethic biology (see <b>Chart 1</b>).</p><br />
<br />
<p>Finally, we wanted to have a general overview of the presentation and decided to include in the answers different adjectives so the teachers could choose, the most chosen one was “Interesting” which is a positive feedback for us, a minor of 3% chose “confused" (see <b>Chart 2</b>).</p><br />
<br><br />
<table width=100%><br />
<tr><br />
<td><br />
<td style="padding-left:40px;"><p><img width=400 height=200 src="https://static.igem.org/mediawiki/2014hs/a/ad/Graphcinvestav2CIDEB.jpg"/></p><br />
<p><center><b>Chart 1</b></p><br />
<br />
</td><br />
<td style="padding-left:80px;"><p><img width=400 height=250 src="https://static.igem.org/mediawiki/2014hs/4/49/Graphcinvestav3CIDEB.jpg"/></p><br />
<p><center><b>Chart 2</b></p></td><br />
</tr></table><br><br />
<br />
<p>We consider this activity had great repercussions in both the teachers and us, because they learned about a very interesting international project and took that information to Chile, their country. Probably they are going to spread the information we gave them and maybe there could be more Chilean iGEM teams in the future.</p><br />
<br />
<p>As for us, it helped us to hear the perspective of teachers about our project, and as we mentioned, it was very encouraging to hear their positive thoughts and feedback to improve ourselves.</p><br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_cinvestav#"><font color="blue">Return to the Top</font></a></p></div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_race
Team:CIDEB-UANL Mexico/hp race
2014-06-19T15:38:59Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Race for Science</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=290 height=139 src=" https://static.igem.org/mediawiki/2014hs/b/b2/CIDEBHPcarrera1.png"/><br />
</td><br />
<td><br />
<p> As it is said: <i>“Mens sana in corpore sano” </i> (healthy mind in a healthy body), we, as a team, believe that everyone should enjoy a healthy life, in which there is a balance between study and physical activity.</p><br />
<p>So after making the “Explosion”, once people knew what we do in iGEM, we wanted to expand the knowledge and interest of people about our project. That's why we decided to organize this "Carrera por la Ciencia" (Race for Science), which included a circuit of about 4 kilometers and at the end a fair with entertaining games related to the project in a way that people could spend time together as a family and learn at the same time. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p>Thus, the event gave us the ability to combine the information about our project and synthetic biology, with physical exercise. This last concept is particularly important for us, especially in Mexico, where the rates of obesity and sedentary lifestyle are disturbing. </p><br />
<br />
<p><b><h2> Objectives</h2></b></p> <br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=280 height=174 src="https://static.igem.org/mediawiki/2014hs/0/02/CIDEBHPcarrera3.jpg"/><br />
</td><br />
<td><br />
<p> According to an article from the United Nations Food and Agricultural Organization (FAO), Mexico is considered as the world's fattest country with a 32.8 percent adult obesity rate, surpassing United States' 31.8 obesity rate. About 70 percent of Mexican adults are considered to be overweight.</p><br />
<p>Monterrey is an industrial city where most people lead stressful and sedentary lifestyles. We, as a part of this society, are too familiar with the dangers of obesity and the prevalent lack of healthy diet and exercise habits. </p><br />
<p>This, combined with the need to develop our project in the Human Practices area, is the reason why we felt motivated to organize this Race for Science. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<p><b> The main purposes of the Race for Science were:</p></b><br />
<p> • To spread information about the project within both the academic and non-academic community, in a fun, innovating and accessible way </p><br />
<p> • To promote physical activities that have a beneficial impact on human health and thus, help cultivate a balance between body and mind </p><br />
<br />
<p>The event was promoted through a personal invitation to the people in our high school, and they were suggested to invite their family members and/or friends to join them. Posters were also made with all the information about the event; they were placed in different parts of the school and simultaneously posted digitally on the official page of the iGEM CIDEB team on Facebook. </p><br />
<br><br />
<p><b><h2> 1st Stage of the Race: Physical Activity</h2></b></p> <br />
<br />
<p>The race was held within the “Mederos” campus of the UANL. The attendees were asked to arrive at 6:30 a.m., so that the event could start at 7:00 a.m. We welcomed about 600 participants, ranging in age from 7 years old to third age.</p><br />
<br />
<p>At 7:00 am a warm-up session was performed. The session was developed with the help of a professional, who lead a dance for about 30 minutes, turning conventional exercises into something fun. The mascot of our team had a very active participation in the warm-up, which encouraged the people to do the exercises properly and enthusiastically. </p><br />
<br />
<p>We then proceeded to take the participants to the start area. The women’s group was the first one to start running, followed 5 minutes later by the men’s group.</p><br />
<br />
<p>The start of the route was the main entrance to our school. Then, the road stretched by the campus’ internal streets to the Faculty of Economics, and then the participants resumed their route in the opposite direction of the streets to return to the entrance of the school. </p><br />
<br></div><br />
<br />
<center><table width=80%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:px;"><img width=400 height=270 src="https://static.igem.org/mediawiki/2014hs/e/e5/CIDEBHPcarrera4.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://static.igem.org/mediawiki/2014hs/0/01/CIDEBHPcarrera5.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://static.igem.org/mediawiki/2014hs/5/5c/CIDEBHPcarrera6.png"/></td><br />
<br />
</tr></table></center><br />
<br />
<br><br />
<div class="container-text"><br />
<p><b><h2> 2nd Stage of the Race: Project information</h2></b></p><br />
<br />
<p>Along the route, there were people on the sidewalks with informative signs about different synthetic biology fun facts, general information about the project, about the impact that our project would have on society, etc... At the halfway point, several people could be found giving away small bags of water to hydrate the runners.</p><br />
<br />
<p>At this point, we had already accomplished one of the main objectives of the race (to promote physical activity). The next step was encouraging people to learn more about our project (and have some fun while doing so). </p><br />
<br />
<p> At the end of the route, the participants returned to the starting point (the parking of the school). In this place, there were different modules with information relevant to our project. Each module included an allusive game to every action of the bacterium (Capture, Union, Resistance and Aroma), so that people could learn in an easy and interactive way. Thus, while participants took a break, they could observe and receive a brief explanation of our project, and they could play and get coupons which could be exchanged for prizes. </p><br />
<br />
<center><table width=80%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:px;"><img width=252 height=395 src="https://static.igem.org/mediawiki/2014hs/0/03/CIDEBHPcarrera7.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=544 height=387 src="https://static.igem.org/mediawiki/2014hs/9/9c/CIDEBHPcarrera8.jpg"/></td><br />
<br />
<br />
</tr></table></center><br />
<br />
<p><b><h2>Impact</h2></b></p> <br />
<br />
<p>Two weeks before, the students learned from the DNA WEEK what was our project about, so they made comments such as “Hi E.CARU!” to our costume, or “Is this from iGEM?” and “How can I get in?” to our team members. Even in the game time, when looking at it, some of them were able to recognize easily the parts referring to our project. (Each game was created to give a reference about our project, its modules and their function). </p><br />
<br />
<p>People, who were not students and hadn’t received those talks, were asking about the iGEM team and the project that we are working on. They asked how does it work, how did we do it, what will it be able to do, and more. They were very interested; even though they did not want to play because they were older, they were paying attention while the younger ones were playing and listened to the explanation that the team members gave.</p><br />
<br />
<p>The race was a complete success. We had received supportive comments during it, and we realized that people were interested in what we are doing. The assistants gained knowledge about our project while having a good time, spending time with their families and friends.</p><br />
<br />
<br />
<p><b><h2>Bibliography/References</h2></b></p> <br />
<font size="2pt"><br />
United Nations Food and Agricultural Organization (FAO). (2008). <i>The state of food and agriculture.</i> Retrieved from: <a href="http://www.fao.org/docrep/018/i3300e/i3300e.pdf">http://www.fao.org/docrep/018/i3300e/i3300e.pdf</a></font><br><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance
Team:CIDEB-UANL Mexico/project resistance
2014-06-19T15:26:48Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project<br />
</title><br />
<style>body{margin: 0px; width: 100%;padding: 0px;background: #2056ac;font-family: 'Oxygen', sans-serif;font-size: 12pt;background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);}h1, h2, h3{margin: 0;padding-bottom: 5px;color: #404040;}p, ol, ul{margin-top: 0;}ol, ul{padding: 0;list-style: none;}p{line-height: 1.60em;padding- right: 3em;}strong{}a{color: #2056ac;}a:hover{text-decoration: none;}.container{margin: 0px auto;width: 1200px;}.container-text{margin: 0px auto;width: 75%;padding: 0px;font-family: 'Oxygen', sans-serif;font-size: 12pt; text-align: justify;}.wrapper{overflow: hidden;padding: 0em 0em 1em 0em;background: #FFF;}#wrapper1{background: #FFF;}#wrapper2{overflow: hidden;background: #F3F3F3;padding: 5em 0em;text-align: center;}#wrapper3{overflow: hidden;padding: 0em 0em 0em 0em;background: #FFF;}#wrapper4{}#banner{padding-top: 2em;}#welcome{overflow: hidden;width: 1000px;padding: 0em 100px 0em 100px;text-align: center;}#welcome .content{padding: 0em 8em;}#welcome .title h2{}#welcome a,#welcome strong{}.title{margin-bottom: 1em;}.title h2{font-size: 2em;}.title .byline{font-size: 1.1em;color: #6F6F6F#;}#three-column{overflow: hidden;margin-top: 5em;padding-top: 1em;border-top: 1px solid rgba(0,0,0,0.2);text-align: center;}#three-column h2{margin: 1em 0em;font-size: 1.5em;font-weight: 700;}#three-column .icon{position: relative;display: block;margin: 0px auto 0.80em auto;background: none;line-height: 150px;font-size: 4em;width: 150px;height: 100px;border-radius: 100px;border: 6px solid #67128F;text-align: center;color: #FFF;}#three-column #tbox1,#three-column #tbox2,#three-column #tbox3{float: left;width: 320px;padding: 30px 40px 50px 40px;}#three-column .title{text-align: center;}#three-column .title h2{font-size: 1.60em;}#three-column .title .byline{padding-top: 0.50em;font-size: 0.90em;color: #858585;}#three-column .arrow-down{border-top-color: #292929;}ul.tools{margin: 0;padding: 0em 0em 0em 0em;list-style: none;}ul.tools li{display: inline-block;padding: 0em .2em;font-size: 4em;}ul.tools li span{display: none;margin: 0;padding: 0;}ul.tools li a{color: #FFF;}ul.tools li a:before{display: inline-block;background: #1ABC9C;width: 120px;height: 120px;border-radius: 50%;line-height: 120px;text-align: center;color: #FFFFFF;}.button{display: inline-block;margin-top: 2em;padding: 0.8em 2em;background: #64ABD1;line-height: 1.8em;letter-spacing: 1px;text-decoration: none;font-size: 1em;color: #FFF;}.button:before{display: inline-block;background: #8DCB89;margin-right: 1em;width: 40px;height: 40px;line-height: 40px;border-radius: 20px;text-align: center;color: #272925;}.button-small{}#portfolio{overflow: hidden;padding-top: 5em;border-top: 1px solid rgba(0,0,0,0.2);}#portfolio .box{text-align: center;color: rgba(0,0,0,0.5);}#portfolio h3{display: block;padding-bottom: 1em;font-size: 1em;color: rgba(0,0,0,0.6);}#portfolio .title{text-align: center;}#portfolio .title h2{color: rgba(0,0,0,0.8);}.column1,.column2,.column3,.column4{width: 282px;}.column1,.column2,.column3{float: left;margin-right: 24px;}.column4{float: right;}<br />
</style><br />
<br />
<body><br />
<br />
<div class="wrapper"><br />
<br />
<div id="welcome" class="container"> <br />
<br />
<div class="title"> <h2>Resistance Module</h2> <br />
</div><br />
</div><br />
<br />
<div class="container-text"><br />
<table width=100%><br />
<tr><br />
<td><br />
<br />
<p>Because our project is a biofilter which allows to remove salt from water, the bacteria needs to survive to extreme environmental conditions which normally it can’t do. We need <i>E. coli</i> to survive a high salinity environment to allow it to capture sodium ions and to remove the salt concentration of the water.</p><br />
<br />
<p>In order to accomplish our project goal, we have to change <i>E. coli</i> metabolism and make it stronger, more resistant and more efficient than in normal <i>E. coli</i> bacteria.</p><br />
</td><br />
<td style="padding-left:12px;"><img width=131 height=140 src="https://static.igem.org/mediawiki/2014hs/8/8e/BeutifulResistance.jpg"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<p>Last discoveries show irrE as a protein capable of change the <i>E. coli</i> metabolism, and giving it the ability to survive to bigger temperatures, bigger UV rays radiation and bigger salt concentration (UCL, 2012).</p><br />
<br><br />
<br />
<p><b><h2>Description</h2></b></p> <br />
<br />
<p>The protein irrE originates from <i>Deinococcus radiodurans</i>, and initially, this gene provides resistance to radiation. But when transformed in <i>E. coli</i>, it protects it against salt, oxidative and thermal shock. (UCL, 2012) Also, different experiments from different iGEM teams, support the idea of the bigger salt resistance in <i>E. coli</i> with this biobrick. </p><center><br />
<br />
<p><img width=564 height=350 src="https://static.igem.org/mediawiki/2014hs/3/3e/Grafica_1_cideb2014.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 1.</b> This graph done by <a herf="https://2012.igem.org/Team:University_College_London">UCL iGEM 2012</a>, shows how irrE biobrick increased the salt concentration resistance in <i>E. coli</i> compared with the results from <a href="https://2010.igem.org/Team:TU_Delft">Tu Delf iGEM 2010</a>.</p></center><br />
<br><br />
<br />
<p>irrE has been demonstrated to up regulate transcription of recA and pprA - genes which encode Recombines A and Radiation Inducible Protein. With respect to salt tolerance, irrE up regulates the production of several stress responsive proteins, protein kinases, metabolic proteins, and detoxification proteins. It also down regulates glycerol degradation. With this global regulatory effect, <i>E. coli</i> becomes more salt tolerant (UCL, 2012).</p><center><br />
<br />
<p><img width=429 height=322 src="https://static.igem.org/mediawiki/2014hs/9/9b/Imagen1cideb2014.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 2.</b> This diagram shows the effect of irrE protein on <i>E. coli</i> metabolism. </p></center><br />
<br />
<p><b><h2>Device</h2></b></p><br />
<br />
<p>Initially, IrrE and L2+AIDA, protein for binding silica (<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union module</a>), were joined together in only one circuit, but we needed to separate them because L2+AIDA has not been proved yet and it could affect the correct production of IrrE (see image 3).</p><center><br />
<br />
<p><img width=529 height=322 src="https://static.igem.org/mediawiki/2014hs/0/05/Circuit_l2_and_irre.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 3.</b> Circuit for our project and for testing resistance and union modules. </p></center><br />
<br><br />
<br />
<p><b><h2>Parts of the Module</h2></b></p><br />
<br><center><br />
<br />
<div><br />
<table class=MsoTable15Grid7ColorfulAccent6 border=1 cellspacing=0 cellpadding=0 width=631 style='width:473.0pt;border-collapse:collapse; border:none;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6; mso-border-themetint:153;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt'> <br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes; height:15.75pt'> <br />
<td width=112 nowrap valign=top style='width:84.0pt;border:none;border-bottom: solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint: 153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor: accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:517'><b><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX;mso-bidi-font-style: italic'>IMAGE<br />
</span></b><b style='mso-bidi-font-weight:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family: "Times New Roman";mso-bidi-font-family:"Times New Roman";mso-fareast-language: ES-MX;mso-bidi-font-style:italic'><o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=119 nowrap valign=top style='width:89.0pt;border:none;border-bottom: solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint: 153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor: accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>CODE<br />
</span></b><b style='mso-bidi-font-weight:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=400 nowrap valign=top style='width:300.0pt;border:none;border-bottom: solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint: 153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor: accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>DESCRIPTION<br />
</span></b><b style='mso-bidi-font-weight:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p><br />
</span></b></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:0;height:60.75pt'> <br />
<td width=112 nowrap valign=top style='width:84.0pt;border:none;border-right: solid #FABF8F 1.0pt;mso-border-right-themecolor:accent6;mso-border-right-themetint: 153;mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6; mso-border-top-themetint:153;mso-border-top-alt:solid #FABF8F .5pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt: solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:60.75pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shapetype id="_x0000_t75" coordsize="21600,21600" o:spt="75" o:preferrelative="t" path="m@4@5l@4@11@9@11@9@5xe" filled="f" stroked="f"> <v:stroke joinstyle="miter"/> <v:formulas> <v:f eqn="if lineDrawn pixelLineWidth 0"/> <v:f eqn="sum @0 1 0"/> <v:f eqn="sum 0 0 @1"/> <v:f eqn="prod @2 1 2"/> <v:f eqn="prod @3 21600 pixelWidth"/> <v:f eqn="prod @3 21600 pixelHeight"/> <v:f eqn="sum @0 0 1"/> <v:f eqn="prod @6 1 2"/> <v:f eqn="prod @7 21600 pixelWidth"/> <v:f eqn="sum @8 21600 0"/> <v:f eqn="prod @7 21600 pixelHeight"/> <v:f eqn="sum @10 21600 0"/> </v:formulas> <v:path o:extrusionok="f" gradientshapeok="t" o:connecttype="rect"/> <o:lock v:ext="edit" aspectratio="t"/> </v:shapetype><v:shape id="_x0031__x0020_Imagen" o:spid="_x0000_s1033" type="#_x0000_t75" style='position:absolute;left:0;text-align:left; margin-left:15.9pt;margin-top:9.9pt;width:61.45pt;height:48.6pt;z-index:251649536; visibility:visible;mso-wrap-style:square;mso-width-percent:0; mso-height-percent:0;mso-wrap-distance-left:9pt;mso-wrap-distance-top:0; mso-wrap-distance-right:9pt;mso-wrap-distance-bottom:0; mso-position-horizontal:absolute;mso-position-horizontal-relative:text; mso-position-vertical:absolute;mso-position-vertical-relative:text; mso-width-percent:0;mso-height-percent:0;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image001.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=82 height=65 src="https://static.igem.org/mediawiki/2014hs/6/62/Promotor.png" align=left hspace=12 v:shapes="_x0031__x0020_Imagen"><![endif]><i><br />
<br />
<span lang=ES-MX style='font-family:Oxygen;color:#E36C0A;mso-themecolor:accent6;mso-themeshade: 191;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p><br />
</span></i></p> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'>&nbsp;</p><br />
</td> <br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor: accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt; mso-border-right-themecolor:accent6;mso-border-right-themetint:153; mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6; mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt; mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt: solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153; background:#FDE9D9;mso-background-themecolor:accent6;mso-background-themetint: 51;padding:0cm 5.4pt 0cm 5.4pt;height:60.75pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a><o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p> <br />
</td> <br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left: none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6; mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor: accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt: solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint: 153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6; mso-border-themetint:153;background:#FDE9D9;mso-background-themecolor:accent6; mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:60.75pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: Arial;color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>In the specific case of our bacteria, it helps to continuously transcribing the <br />
<br />
<span class=SpellE>irrE<br />
</span> gene in order to make bacteria resist high concentration of salt. <br />
</span><br />
<br />
<span class=SpellE><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:#282828;mso-fareast-language:ES-MX'>This<br />
</span><br />
</span><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family: "Times New Roman";mso-bidi-font-family:Arial;color:#282828;mso-fareast-language: ES-MX'> <br />
<br />
<span class=SpellE>promoter<br />
</span> has a <br />
<br />
<span class=SpellE>length<br />
</span> of 35 <br />
<br />
<span class=SpellE>pb<br />
</span>(Anderson, 2006).<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:1;height:75.0pt'> <br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor: accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt: solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:75.0pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="_x0032__x0020_Imagen" o:spid="_x0000_s1032" type="#_x0000_t75" style='position:absolute; left:0;text-align:left;margin-left:23.1pt;margin-top:6.95pt;width:54.25pt; height:49.45pt;z-index:251651584;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image003.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=72 height=66 src="https://static.igem.org/mediawiki/2014hs/5/5d/Cds.png" align=left hspace=12 v:shapes="_x0032__x0020_Imagen"><![endif]><i><br />
<br />
<span style='font-family:Oxygen; color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191;mso-ansi-language: EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p><br />
</span></i></p> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'>&nbsp;</p> <br />
</td> <br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor: accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt; mso-border-right-themecolor:accent6;mso-border-right-themetint:153; mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6; mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt; mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt: solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153; padding:0cm 5.4pt 0cm 5.4pt;height:75.0pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman";color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'><a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a><o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'>&nbsp;</p> <br />
</td> <br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left: none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6; mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor: accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt: solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint: 153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6; mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:75.0pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>This specific is <br />
<br />
<span class=SpellE>RBS<br />
</span> based on <br />
<br />
<span class=SpellE>Elowitz<br />
</span> <br />
<br />
<span class=SpellE>repressilator<br />
</span>. It is very common to see in many <br />
<br />
<span class=SpellE>iGEM<br />
</span> projects.<br />
<br />
<span style='mso-spacerun:yes'> <br />
</span>It has a length of 12 <br />
<br />
<span class=SpellE>pb <br />
</span>(Mahajan, <br />
<br />
<span class=SpellE>Marinescu<br />
</span>, Chow, <br />
<br />
<span class=SpellE>Wissner<br />
</span>-Gross, &amp; Carr, 2003).<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:2;height:90.35pt'> <br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor: accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt: solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:90.35pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shape id="_x0033__x0020_Imagen" o:spid="_x0000_s1031" type="#_x0000_t75" style='position:absolute; left:0;text-align:left;margin-left:23.4pt;margin-top:10pt;width:57pt; height:48pt;z-index:251654656;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image005.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=76 height=64 src="https://static.igem.org/mediawiki/2014hs/9/97/IrrEResistance.png" align=left hspace=12 v:shapes="_x0033__x0020_Imagen"><![endif]></p> <br />
</td> <br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor: accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt; mso-border-right-themecolor:accent6;mso-border-right-themetint:153; mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6; mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt; mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt: solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153; background:#FDE9D9;mso-background-themecolor:accent6;mso-background-themetint: 51;padding:0cm 5.4pt 0cm 5.4pt;height:90.35pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";color:black;mso-ansi-language:EN-US; mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K729001">BBa_K729001</a><o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:3.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";color:black;mso-ansi-language:EN-US; mso-fareast-language:ES-MX'><o:p></o:p><br />
</span></p> <br />
</td> <br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left: none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6; mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor: accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt: solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint: 153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6; mso-border-themetint:153;background:#FDE9D9;mso-background-themecolor:accent6; mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:90.35pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: Arial;color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>Gene that produces <br />
<br />
<span class=SpellE>irrE<br />
</span>, a substance that changes the bacteria’s metabolism and allows bacteria to survive to extreme conditions, some examples could be high UV rays exposition, or high salt concentration levels in an aquatic environment, oxidative or thermal shock.<br />
<br />
<span style='mso-spacerun:yes'> <br />
</span>It has a length of 933pb (<br />
<br />
<span class=SpellE>Sohrabi<br />
</span>, 2012).<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes;height:62.25pt'> <br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor: accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt: solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:62.25pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="_x0034__x0020_Imagen" o:spid="_x0000_s1030" type="#_x0000_t75" style='position:absolute; left:0;text-align:left;margin-left:22.6pt;margin-top:5.5pt;width:54.75pt; height:52.5pt;z-index:251657728;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image006.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=73 height=70 src="https://static.igem.org/mediawiki/2014hs/5/55/TerminatorResistance.png" align=left hspace=12 v:shapes="_x0034__x0020_Imagen"><![endif]><i><br />
<br />
<span style='font-family:Oxygen; color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191;mso-ansi-language: EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p><br />
</span></i><i><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family: "Times New Roman";mso-bidi-font-family:"Times New Roman";color:black; mso-fareast-language:ES-MX'> <o:p></o:p> <br />
</span></i></p> <br />
</td> <br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor: accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt; mso-border-right-themecolor:accent6;mso-border-right-themetint:153; mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6; mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt; mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt: solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153; padding:0cm 5.4pt 0cm 5.4pt;height:62.25pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman";color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a><o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'>&nbsp;</p><br />
</td> <br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left: none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6; mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor: accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt: solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint: 153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6; mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:62.25pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:"Times New Roman"; color:black;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>Part made of 6pb responsible for transcription stop (Huang, 206).<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr><br />
</table><br />
</div></center><br />
<p><b><h2>Justifications</h2></b></p><br />
<br />
<p>The resistance module is very important in our project because it allows the correct function of the bio-filter. Because the objective is to remove the sodium ions from the water, E. CARU, at the beggining of the process, will be surrounded by salt molecules which normally <i>E. coli</i> could not support.</p><br />
<br />
<p>IrrE gives resistance to the high salt concentration of the water, allowing the Nhas gene to function and capture the sodium ions.</p><br />
<br />
<p>Another important aspect in the usage of the IrrE gene, is because the promoter in the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture module</a> is activated with UV rays at 360 wv, intensity that can cause mutations to the bacterium. IrrE protects <i>E. coli </i> from UV rays and allows the bacteria to their work. </p><br />
<br><br />
<br />
<p><b><h2>Other teams that used IRRE</h2></b></p><br />
<br />
<p><b><a href="https://2012.igem.org/Team:University_College_London">UCL 2012</a>:</b> They propose to confer salt tolerance on <i>E. coli</i> by linking the salt tolerance gene encoding the protein irrE (<a href="http://parts.igem.org/Part:BBa_K729001">BBa_K729001</a>) to a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>). </p><center><br />
<br />
<p><img width=661 height=139 src="https://static.igem.org/mediawiki/2014hs/3/33/Gen1cideb2014.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 3.</b> Part designed by <a href="https://2012.igem.org/Team:University_College_London">UCL 2012</a> for the irrE protein.</p></center><br />
<br><br />
<br />
<br />
<p><h2><b>Project Zoom In</b></h2></p></br><center><iframe width="600" height="500" src="//www.youtube.com/embed/qAYmPrq9NsY" frameborder="0" allowfullscreen></iframe></center><br />
<br><br />
<br />
<p><b><h2>Bibliography/References</h2></b></p><font size="2"><br />
<br />
<p>● Antiquity 2013. (2013, January 31). <i>Part:BBa_B0034</i>. Retrieved from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034">http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034</a>.</p><br />
<br />
<p>● Huang, H. (2006, August 30). <i>Part:BBa_B1002</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002">http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002</a>.</p><br />
<br />
<p>● iGEM2006_Berkeley. (2006, August 24). <i>Part:BBa_J23119</i>. Retrieved April 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119">http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119</a>.</p><br />
<br />
<p>● Sohrabi, B. (2012, June 27). <i>Part:BBa_K729001</i>. Retrieved from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K729001">http://parts.igem.org/wiki/index.php?title=Part:BBa_K729001</a>.</p><br />
<br />
<p>● UCLiGEM Team. (2012). <i>IRRE module</i>. Retrieved March 31, 2014. from <a href="https://2012.igem.org/Team:University_College_London/Module_5">https://2012.igem.org/Team:University_College_London/Module_5</a>.</p></font><br />
<br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance#"><font color="blue">Return to the Top</font></a></p><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html>{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance
Team:CIDEB-UANL Mexico/project resistance
2014-06-19T15:26:03Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project<br />
</title><br />
<style>body{margin: 0px; width: 100%;padding: 0px;background: #2056ac;font-family: 'Oxygen', sans-serif;font-size: 12pt;background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);}h1, h2, h3{margin: 0;padding-bottom: 5px;color: #404040;}p, ol, ul{margin-top: 0;}ol, ul{padding: 0;list-style: none;}p{line-height: 1.60em;padding- right: 3em;}strong{}a{color: #2056ac;}a:hover{text-decoration: none;}.container{margin: 0px auto;width: 1200px;}.container-text{margin: 0px auto;width: 75%;padding: 0px;font-family: 'Oxygen', sans-serif;font-size: 12pt; text-align: justify;}.wrapper{overflow: hidden;padding: 0em 0em 1em 0em;background: #FFF;}#wrapper1{background: #FFF;}#wrapper2{overflow: hidden;background: #F3F3F3;padding: 5em 0em;text-align: center;}#wrapper3{overflow: hidden;padding: 0em 0em 0em 0em;background: #FFF;}#wrapper4{}#banner{padding-top: 2em;}#welcome{overflow: hidden;width: 1000px;padding: 0em 100px 0em 100px;text-align: center;}#welcome .content{padding: 0em 8em;}#welcome .title h2{}#welcome a,#welcome strong{}.title{margin-bottom: 1em;}.title h2{font-size: 2em;}.title .byline{font-size: 1.1em;color: #6F6F6F#;}#three-column{overflow: hidden;margin-top: 5em;padding-top: 1em;border-top: 1px solid rgba(0,0,0,0.2);text-align: center;}#three-column h2{margin: 1em 0em;font-size: 1.5em;font-weight: 700;}#three-column .icon{position: relative;display: block;margin: 0px auto 0.80em auto;background: none;line-height: 150px;font-size: 4em;width: 150px;height: 100px;border-radius: 100px;border: 6px solid #67128F;text-align: center;color: #FFF;}#three-column #tbox1,#three-column #tbox2,#three-column #tbox3{float: left;width: 320px;padding: 30px 40px 50px 40px;}#three-column .title{text-align: center;}#three-column .title h2{font-size: 1.60em;}#three-column .title .byline{padding-top: 0.50em;font-size: 0.90em;color: #858585;}#three-column .arrow-down{border-top-color: #292929;}ul.tools{margin: 0;padding: 0em 0em 0em 0em;list-style: none;}ul.tools li{display: inline-block;padding: 0em .2em;font-size: 4em;}ul.tools li span{display: none;margin: 0;padding: 0;}ul.tools li a{color: #FFF;}ul.tools li a:before{display: inline-block;background: #1ABC9C;width: 120px;height: 120px;border-radius: 50%;line-height: 120px;text-align: center;color: #FFFFFF;}.button{display: inline-block;margin-top: 2em;padding: 0.8em 2em;background: #64ABD1;line-height: 1.8em;letter-spacing: 1px;text-decoration: none;font-size: 1em;color: #FFF;}.button:before{display: inline-block;background: #8DCB89;margin-right: 1em;width: 40px;height: 40px;line-height: 40px;border-radius: 20px;text-align: center;color: #272925;}.button-small{}#portfolio{overflow: hidden;padding-top: 5em;border-top: 1px solid rgba(0,0,0,0.2);}#portfolio .box{text-align: center;color: rgba(0,0,0,0.5);}#portfolio h3{display: block;padding-bottom: 1em;font-size: 1em;color: rgba(0,0,0,0.6);}#portfolio .title{text-align: center;}#portfolio .title h2{color: rgba(0,0,0,0.8);}.column1,.column2,.column3,.column4{width: 282px;}.column1,.column2,.column3{float: left;margin-right: 24px;}.column4{float: right;}<br />
</style><br />
<br />
<body><br />
<br />
<div class="wrapper"><br />
<br />
<div id="welcome" class="container"> <br />
<br />
<div class="title"> <h2>Resistance Module</h2> <br />
</div><br />
</div><br />
<br />
<div class="container-text"><br />
<table width=100%><br />
<tr><br />
<td><br />
<br />
<p>Because our project is a biofilter which allows to remove salt from water, the bacteria needs to survive to extreme environmental conditions which normally it can’t do. We need <i>E. coli</i> to survive a high salinity environment to allow it to capture sodium ions and to remove the salt concentration of the water.</p><br />
<br />
<p>In order to accomplish our project goal, we have to change <i>E. coli</i> metabolism and make it stronger, more resistant and more efficient than in normal <i>E. coli</i> bacteria.</p><br />
</td><br />
<td style="padding-left:12px;"><img width=131 height=140 src="https://static.igem.org/mediawiki/2014hs/8/8e/BeutifulResistance.jpg"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<p>Last discoveries show irrE as a protein capable of change the <i>E. coli</i> metabolism, and giving it the ability to survive to bigger temperatures, bigger UV rays radiation and bigger salt concentration (UCL, 2012).</p><br />
<br><br />
<br />
<p><b><h2>Description</h2></b></p> <br />
<br />
<p>The protein irrE originates from <i>Deinococcus radiodurans</i>, and initially, this gene provides resistance to radiation. But when transformed in <i>E. coli</i>, it protects it against salt, oxidative and thermal shock. (UCL, 2012) Also, different experiments from different iGEM teams, support the idea of the bigger salt resistance in <i>E. coli</i> with this biobrick. </p><center><br />
<br />
<p><img width=564 height=350 src="https://static.igem.org/mediawiki/2014hs/3/3e/Grafica_1_cideb2014.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 1.</b> This graph done by <a herf="https://2012.igem.org/Team:University_College_London">UCL iGEM 2012</a>, shows how irrE biobrick increased the salt concentration resistance in <i>E. coli</i> compared with the results from <a href="https://2010.igem.org/Team:TU_Delft">Tu Delf iGEM 2010</a>.</p></center><br />
<br><br />
<br />
<p>irrE has been demonstrated to up regulate transcription of recA and pprA - genes which encode Recombines A and Radiation Inducible Protein. With respect to salt tolerance, irrE up regulates the production of several stress responsive proteins, protein kinases, metabolic proteins, and detoxification proteins. It also down regulates glycerol degradation. With this global regulatory effect, <i>E. coli</i> becomes more salt tolerant (UCL, 2012).</p><center><br />
<br />
<p><img width=429 height=322 src="https://static.igem.org/mediawiki/2014hs/9/9b/Imagen1cideb2014.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 2.</b> This diagram shows the effect of irrE protein on <i>E. coli</i> metabolism. </p></center><br />
<br />
<p><b><h2>Device</h2></b></p><br />
<br />
<p>Initially, IrrE and L2+AIDA, protein for binding silica (<a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union module</a>), were joined together in only one circuit, but we needed to separate them because L2+AIDA has not been proved yet and it could affect the correct production of IrrE (see image 3).</p><center><br />
<br />
<p><img width=529 height=322 src="https://static.igem.org/mediawiki/2014hs/0/05/Circuit_l2_and_irre.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 3.</b> Circuit for our project and for testing resistance and union modules. </p></center><br />
<br><br />
<br />
<p><b><h2>Parts of the Module</h2></b></p><br />
<br><center><br />
<br />
<div><br />
<table class=MsoTable15Grid7ColorfulAccent6 border=1 cellspacing=0 cellpadding=0 width=631 style='width:473.0pt;border-collapse:collapse; border:none;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6; mso-border-themetint:153;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt'> <br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes; height:15.75pt'> <br />
<td width=112 nowrap valign=top style='width:84.0pt;border:none;border-bottom: solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint: 153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor: accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:517'><b><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX;mso-bidi-font-style: italic'>IMAGE<br />
</span></b><b style='mso-bidi-font-weight:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family: "Times New Roman";mso-bidi-font-family:"Times New Roman";mso-fareast-language: ES-MX;mso-bidi-font-style:italic'><o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=119 nowrap valign=top style='width:89.0pt;border:none;border-bottom: solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint: 153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor: accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>CODE<br />
</span></b><b style='mso-bidi-font-weight:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=400 nowrap valign=top style='width:300.0pt;border:none;border-bottom: solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint: 153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor: accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>DESCRIPTION<br />
</span></b><b style='mso-bidi-font-weight:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p><br />
</span></b></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:0;height:60.75pt'> <br />
<td width=112 nowrap valign=top style='width:84.0pt;border:none;border-right: solid #FABF8F 1.0pt;mso-border-right-themecolor:accent6;mso-border-right-themetint: 153;mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6; mso-border-top-themetint:153;mso-border-top-alt:solid #FABF8F .5pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt: solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:60.75pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shapetype id="_x0000_t75" coordsize="21600,21600" o:spt="75" o:preferrelative="t" path="m@4@5l@4@11@9@11@9@5xe" filled="f" stroked="f"> <v:stroke joinstyle="miter"/> <v:formulas> <v:f eqn="if lineDrawn pixelLineWidth 0"/> <v:f eqn="sum @0 1 0"/> <v:f eqn="sum 0 0 @1"/> <v:f eqn="prod @2 1 2"/> <v:f eqn="prod @3 21600 pixelWidth"/> <v:f eqn="prod @3 21600 pixelHeight"/> <v:f eqn="sum @0 0 1"/> <v:f eqn="prod @6 1 2"/> <v:f eqn="prod @7 21600 pixelWidth"/> <v:f eqn="sum @8 21600 0"/> <v:f eqn="prod @7 21600 pixelHeight"/> <v:f eqn="sum @10 21600 0"/> </v:formulas> <v:path o:extrusionok="f" gradientshapeok="t" o:connecttype="rect"/> <o:lock v:ext="edit" aspectratio="t"/> </v:shapetype><v:shape id="_x0031__x0020_Imagen" o:spid="_x0000_s1033" type="#_x0000_t75" style='position:absolute;left:0;text-align:left; margin-left:15.9pt;margin-top:9.9pt;width:61.45pt;height:48.6pt;z-index:251649536; visibility:visible;mso-wrap-style:square;mso-width-percent:0; mso-height-percent:0;mso-wrap-distance-left:9pt;mso-wrap-distance-top:0; mso-wrap-distance-right:9pt;mso-wrap-distance-bottom:0; mso-position-horizontal:absolute;mso-position-horizontal-relative:text; mso-position-vertical:absolute;mso-position-vertical-relative:text; mso-width-percent:0;mso-height-percent:0;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image001.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=82 height=65 src="https://static.igem.org/mediawiki/2014hs/6/62/Promotor.png" align=left hspace=12 v:shapes="_x0031__x0020_Imagen"><![endif]><i><br />
<br />
<span lang=ES-MX style='font-family:Oxygen;color:#E36C0A;mso-themecolor:accent6;mso-themeshade: 191;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p><br />
</span></i></p> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'>&nbsp;</p><br />
</td> <br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor: accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt; mso-border-right-themecolor:accent6;mso-border-right-themetint:153; mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6; mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt; mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt: solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153; background:#FDE9D9;mso-background-themecolor:accent6;mso-background-themetint: 51;padding:0cm 5.4pt 0cm 5.4pt;height:60.75pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a><o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p> <br />
</td> <br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left: none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6; mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor: accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt: solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint: 153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6; mso-border-themetint:153;background:#FDE9D9;mso-background-themecolor:accent6; mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:60.75pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: Arial;color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>In the specific case of our bacteria, it helps to continuously transcribing the <br />
<br />
<span class=SpellE>irrE<br />
</span> gene in order to make bacteria resist high concentration of salt. <br />
</span><br />
<br />
<span class=SpellE><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:#282828;mso-fareast-language:ES-MX'>This<br />
</span><br />
</span><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family: "Times New Roman";mso-bidi-font-family:Arial;color:#282828;mso-fareast-language: ES-MX'> <br />
<br />
<span class=SpellE>promoter<br />
</span> has a <br />
<br />
<span class=SpellE>length<br />
</span> of 35 <br />
<br />
<span class=SpellE>pb<br />
</span>(Anderson, 2006).<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:1;height:75.0pt'> <br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor: accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt: solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:75.0pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="_x0032__x0020_Imagen" o:spid="_x0000_s1032" type="#_x0000_t75" style='position:absolute; left:0;text-align:left;margin-left:23.1pt;margin-top:6.95pt;width:54.25pt; height:49.45pt;z-index:251651584;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image003.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=72 height=66 src="https://static.igem.org/mediawiki/2014hs/5/5d/Cds.png" align=left hspace=12 v:shapes="_x0032__x0020_Imagen"><![endif]><i><br />
<br />
<span style='font-family:Oxygen; color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191;mso-ansi-language: EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p><br />
</span></i></p> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'>&nbsp;</p> <br />
</td> <br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor: accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt; mso-border-right-themecolor:accent6;mso-border-right-themetint:153; mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6; mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt; mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt: solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153; padding:0cm 5.4pt 0cm 5.4pt;height:75.0pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman";color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'><a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a><o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'>&nbsp;</p> <br />
</td> <br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left: none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6; mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor: accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt: solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint: 153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6; mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:75.0pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>This specific is <br />
<br />
<span class=SpellE>RBS<br />
</span> based on <br />
<br />
<span class=SpellE>Elowitz<br />
</span> <br />
<br />
<span class=SpellE>repressilator<br />
</span>. It is very common to see in many <br />
<br />
<span class=SpellE>iGEM<br />
</span> projects.<br />
<br />
<span style='mso-spacerun:yes'> <br />
</span>It has a length of 12 <br />
<br />
<span class=SpellE>pb <br />
</span>(Mahajan, <br />
<br />
<span class=SpellE>Marinescu<br />
</span>, Chow, <br />
<br />
<span class=SpellE>Wissner<br />
</span>-Gross, &amp; Carr, 2003).<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:2;height:90.35pt'> <br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor: accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt: solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:90.35pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shape id="_x0033__x0020_Imagen" o:spid="_x0000_s1031" type="#_x0000_t75" style='position:absolute; left:0;text-align:left;margin-left:23.4pt;margin-top:10pt;width:57pt; height:48pt;z-index:251654656;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image005.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=76 height=64 src="https://static.igem.org/mediawiki/2014hs/9/97/IrrEResistance.png" align=left hspace=12 v:shapes="_x0033__x0020_Imagen"><![endif]></p> <br />
</td> <br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor: accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt; mso-border-right-themecolor:accent6;mso-border-right-themetint:153; mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6; mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt; mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt: solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153; background:#FDE9D9;mso-background-themecolor:accent6;mso-background-themetint: 51;padding:0cm 5.4pt 0cm 5.4pt;height:90.35pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";color:black;mso-ansi-language:EN-US; mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K729001">BBa_K729001</a><o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:3.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";color:black;mso-ansi-language:EN-US; mso-fareast-language:ES-MX'><o:p></o:p><br />
</span></p> <br />
</td> <br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left: none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6; mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor: accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt: solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint: 153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6; mso-border-themetint:153;background:#FDE9D9;mso-background-themecolor:accent6; mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:90.35pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: Arial;color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>Gene that produces <br />
<br />
<span class=SpellE>irrE<br />
</span>, a substance that changes the bacteria’s metabolism and allows bacteria to survive to extreme conditions, some examples could be high UV rays exposition, or high salt concentration levels in an aquatic environment, oxidative or thermal shock.<br />
<br />
<span style='mso-spacerun:yes'> <br />
</span>It has a length of 933pb (<br />
<br />
<span class=SpellE>Sohrabi<br />
</span>, 2012).<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes;height:62.25pt'> <br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor: accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt: solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:62.25pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="_x0034__x0020_Imagen" o:spid="_x0000_s1030" type="#_x0000_t75" style='position:absolute; left:0;text-align:left;margin-left:22.6pt;margin-top:5.5pt;width:54.75pt; height:52.5pt;z-index:251657728;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image006.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=73 height=70 src="https://static.igem.org/mediawiki/2014hs/5/55/TerminatorResistance.png" align=left hspace=12 v:shapes="_x0034__x0020_Imagen"><![endif]><i><br />
<br />
<span style='font-family:Oxygen; color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191;mso-ansi-language: EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p><br />
</span></i><i><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family: "Times New Roman";mso-bidi-font-family:"Times New Roman";color:black; mso-fareast-language:ES-MX'> <o:p></o:p> <br />
</span></i></p> <br />
</td> <br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor: accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt; mso-border-right-themecolor:accent6;mso-border-right-themetint:153; mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6; mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt; mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt: solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153; padding:0cm 5.4pt 0cm 5.4pt;height:62.25pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family: "Times New Roman";color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a><o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'>&nbsp;</p><br />
</td> <br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left: none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6; mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor: accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt; mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt: solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint: 153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6; mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:62.25pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:"Times New Roman"; color:black;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>Part made of 6pb responsible for transcription stop (Huang, 206).<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr><br />
</table><br />
</div></center><br />
<p><b><h2>Justifications</h2></b></p><br />
<br />
<p>The resistance module is very important in our project because it allows the correct function of the bio-filter. Because the objective is to remove the sodium ions from the water, E. CARU, at the beggining of the process, will be surrounded by salt molecules which normally <i>E. coli</i> could not support.</p><br />
<br />
<p>IrrE gives resistance to the high salt concentration of the water, allowing the Nhas gene to function and capture the sodium ions.</p><br />
<br />
<p>Another important aspect in the usage of the IrrE gene, is because the promoter in the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture module</a> is activated with UV rays at 360 wv, intensity that can cause mutations to the bacterium. IrrE protects <i>E. coli </i> from UV rays and allows the bacteria to their work. </p><br />
<br />
<p><b><h2>Other teams that used IRRE</h2></b></p><br />
<br />
<p><b><a href="https://2012.igem.org/Team:University_College_London">UCL 2012</a>:</b> They propose to confer salt tolerance on <i>E. coli</i> by linking the salt tolerance gene encoding the protein irrE (<a href="http://parts.igem.org/Part:BBa_K729001">BBa_K729001</a>) to a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>). </p><center><br />
<br />
<p><img width=661 height=139 src="https://static.igem.org/mediawiki/2014hs/3/33/Gen1cideb2014.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 3.</b> Part designed by <a href="https://2012.igem.org/Team:University_College_London">UCL 2012</a> for the irrE protein.</p></center><br />
<br><br />
<br />
<br />
<p><h2><b>Project Zoom In</b></h2></p></br><center><iframe width="600" height="500" src="//www.youtube.com/embed/qAYmPrq9NsY" frameborder="0" allowfullscreen></iframe></center><br />
<br><br />
<br />
<p><b><h2>Bibliography/References</h2></b></p><font size="2"><br />
<br />
<p>● Antiquity 2013. (2013, January 31). <i>Part:BBa_B0034</i>. Retrieved from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034">http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034</a>.</p><br />
<br />
<p>● Huang, H. (2006, August 30). <i>Part:BBa_B1002</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002">http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002</a>.</p><br />
<br />
<p>● iGEM2006_Berkeley. (2006, August 24). <i>Part:BBa_J23119</i>. Retrieved April 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119">http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119</a>.</p><br />
<br />
<p>● Sohrabi, B. (2012, June 27). <i>Part:BBa_K729001</i>. Retrieved from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K729001">http://parts.igem.org/wiki/index.php?title=Part:BBa_K729001</a>.</p><br />
<br />
<p>● UCLiGEM Team. (2012). <i>IRRE module</i>. Retrieved March 31, 2014. from <a href="https://2012.igem.org/Team:University_College_London/Module_5">https://2012.igem.org/Team:University_College_London/Module_5</a>.</p></font><br />
<br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance#"><font color="blue">Return to the Top</font></a></p><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html>{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_race
Team:CIDEB-UANL Mexico/hp race
2014-06-19T15:23:12Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Race for Science</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=290 height=139 src=" https://static.igem.org/mediawiki/2014hs/b/b2/CIDEBHPcarrera1.png"/><br />
</td><br />
<td><br />
<p> As it is said: <i>“Mens sana in corpore sano” </i> (healthy mind in a healthy body), we, as a team, believe that everyone should enjoy a healthy life, in which there is a balance between study and physical activity.</p><br />
<p>So after making the “Explosion”, once people knew what we do in iGEM, we wanted to expand the knowledge and interest of people about our project. That's why we decided to organize this "Carrera por la Ciencia" (Race for Science), which included a circuit of about 4 kilometers and at the end a fair with entertaining games related to the project in a way that people could spend time together as a family and learn at the same time. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p>Thus, the event gave us the ability to combine the information about our project and synthetic biology, with physical exercise. This last concept is particularly important for us, especially in Mexico, where the rates of obesity and sedentary lifestyle are disturbing. </p><br />
<br />
<p><b><h2> Objectives</h2></b></p> <br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=280 height=174 src="https://static.igem.org/mediawiki/2014hs/0/02/CIDEBHPcarrera3.jpg"/><br />
</td><br />
<td><br />
<p> According to an article from the United Nations Food and Agricultural Organization (FAO), Mexico is considered as the world's fattest country with a 32.8 percent adult obesity rate, surpassing United States' 31.8 obesity rate. About 70 percent of Mexican adults are considered to be overweight.</p><br />
<p>Monterrey is an industrial city where most people lead stressful and sedentary lifestyles. We, as a part of this society, are too familiar with the dangers of obesity and the prevalent lack of healthy diet and exercise habits. </p><br />
<p>This, combined with the need to develop our project in the Human Practices area, is the reason why we felt motivated to organize this Race for Science. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<p><b> The main purposes of the Race for Science were:</p></b><br />
<p> • To spread information about the project within both the academic and non-academic community, in a fun, innovating and accessible way </p><br />
<p> • To promote physical activities that have a beneficial impact on human health and thus, help cultivate a balance between body and mind </p><br />
<br />
<p>The event was promoted through a personal invitation to the people in our high school, and they were suggested to invite their family members and/or friends to join them. Posters were also made with all the information about the event; they were placed in different parts of the school and simultaneously posted digitally on the official page of the iGEM CIDEB team on Facebook. </p><br />
<br><br />
<p><b><h2> 1st Stage of the Race: Physical Activity</h2></b></p> <br />
<br />
<p>The race was held within the “Mederos” campus of the UANL. The attendees were asked to arrive at 6:30 a.m., so that the event could start at 7:00 a.m. We welcomed about 600 participants, ranging in age from 7 years old to third age.</p><br />
<br />
<p>At 7:00 am a warm-up session was performed. The session was developed with the help of a professional, who lead a dance for about 30 minutes, turning conventional exercises into something fun. The mascot of our team had a very active participation in the warm-up, which encouraged the people to do the exercises properly and enthusiastically. </p><br />
<br />
<p>We then proceeded to take the participants to the start area. The women’s group was the first one to start running, followed 5 minutes later by the men’s group.</p><br />
<br />
<p>The start of the route was the main entrance to our school. Then, the road stretched by the campus’ internal streets to the Faculty of Economics, and then the participants resumed their route in the opposite direction of the streets to return to the entrance of the school. </p><br />
<br></div><br />
<br />
<center><table width=80%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:px;"><img width=400 height=270 src="https://static.igem.org/mediawiki/2014hs/e/e5/CIDEBHPcarrera4.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://static.igem.org/mediawiki/2014hs/0/01/CIDEBHPcarrera5.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://static.igem.org/mediawiki/2014hs/5/5c/CIDEBHPcarrera6.png"/></td><br />
<br />
</tr></table></center><br />
<br />
<br><br />
<div class="container-text"><br />
<p><b><h2> 2nd Stage of the Race: Project information</h2></b></p><br />
<br />
<p>Along the route, there were people on the sidewalks with informative signs about different synthetic biology fun facts, general information about the project, about the impact that our project would have on society, etc... At the halfway point, several people could be found giving away small bags of water to hydrate the runners.</p><br />
<br />
<p>At this point, we had already accomplished one of the main objectives of the race (to promote physical activity). The next step was encouraging people to learn more about our project (and have some fun while doing so). </p><br />
<br />
<p> At the end of the route, the participants returned to the starting point (the parking of the school). In this place, there were different modules with information relevant to our project. Each module included an allusive game to every action of the bacterium (Capture, Union, Resistance and Aroma), so that people could learn in an easy and interactive way. Thus, while participants took a break, they could observe and receive a brief explanation of our project, and they could play and get coupons which could be exchanged for prizes. </p><br />
<br />
<center><table width=80%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:px;"><img width=252 height=395 src="https://static.igem.org/mediawiki/2014hs/0/03/CIDEBHPcarrera7.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=544 height=387 src="https://static.igem.org/mediawiki/2014hs/9/9c/CIDEBHPcarrera8.jpg"/></td><br />
<br />
<br />
</tr></table></center><br />
<br />
<p><b><h2>Impact</h2></b></p> <br />
<br />
<p>Two weeks before, the students learned from the DNA WEEK what was our project about, so they made comments such as “Hi E.CARU!” to our costume, or “Is this from iGEM?” and “How can I get in?” to our team members. Even in the game time, when looking at it, some of them were able to recognize easily the parts referring to our project. (Each game was created to give a reference about our project, its modules and their function). </p><br />
<br />
<p>People, who were not students and hadn’t received those talks, were asking about the iGEM team and the project that we are working on. They asked how does it work, how did we do it, what will it be able to do, and more. They were very interested; even though they did not want to play because they were older, they were paying attention while the younger ones were playing and listened to the explanation that the team members gave.</p><br />
<br />
<p>The race was a complete success. We had received supportive comments during it, and we realized that people were interested in what we are doing. The assistants gained knowledge about our project while having a good time, spending time with their families and friends.</p><br />
<br />
<br />
<p><b><h2>Bibliography</h2></b></p> <br />
United Nations Food and Agricultural Organization (FAO). (2008). <i>The state of food and agriculture.</i> Retrieved from http://www.fao.org/docrep/018/i3300e/i3300e.pdf<br><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_race
Team:CIDEB-UANL Mexico/hp race
2014-06-19T14:57:27Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Race for Science</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=290 height=139 src=" https://static.igem.org/mediawiki/2014hs/b/b2/CIDEBHPcarrera1.png"/><br />
</td><br />
<td><br />
<p> As it is said: <i>“Mens sana in corpore sano” </i> (healthy mind in a healthy body), we, as a team, believe that everyone should enjoy a healthy life, in which there is a balance between study and physical activity.</p><br />
<p>So after making the “Explosion”, once people knew what we do in iGEM, we wanted to expand the knowledge and interest of people about our project. That's why we decided to organize this "Carrera por la Ciencia" (Race for Science), which included a circuit of about 4 kilometers and at the end a fair with entertaining games related to the project in a way that people could spend time together as a family and learn at the same time. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p>Thus, the event gave us the ability to combine the information about our project and synthetic biology, with physical exercise. This last concept is particularly important for us, especially in Mexico, where the rates of obesity and sedentary lifestyle are disturbing. </p><br />
<br />
<p><b><h2> Objectives</h2></b></p> <br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=280 height=174 src="https://static.igem.org/mediawiki/2014hs/0/02/CIDEBHPcarrera3.jpg"/><br />
</td><br />
<td><br />
<p> According to an article from the United Nations Food and Agricultural Organization (FAO), Mexico is considered as the world's fattest country with a 32.8 percent adult obesity rate, surpassing United States' 31.8 obesity rate. About 70 percent of Mexican adults are considered to be overweight.</p><br />
<p>Monterrey is an industrial city where most people lead stressful and sedentary lifestyles. We, as a part of this society, are too familiar with the dangers of obesity and the prevalent lack of healthy diet and exercise habits. </p><br />
<p>This, combined with the need to develop our project in the Human Practices area, is the reason why we felt motivated to organize this Race for Science. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<p> The main purposes od the Race for Science were:</p><br />
<p> • To spread information about the project within both the academic and non-academic community, in a fun, innovating and accessible way </p><br />
<p> • To promote physical activities that have a beneficial impact on human health and thus, help cultivate a balance between body and mind </p><br />
<br />
<p>The event was promoted through a personal invitation to the people in our high school, and they were suggested to invite their family members and/or friends to join them. Posters were also made with all the information about the event; they were placed in different parts of the school and simultaneously posted digitally on the official page of the iGEM CIDEB team on Facebook. </p><br />
<br><br />
<p><b><h2> 1st Stage of the Race: Physical Activity</h2></b></p> <br />
<br />
<p>The race was held within the “Mederos” campus of the UANL. The attendees were asked to arrive at 6:30 a.m., so that the event could start at 7:00 a.m. We welcomed about 600 participants, ranging in age from 7 years old to third age.</p><br />
<br />
<p>At 7:00 am a warm-up session was performed. The session was developed with the help of a professional, who lead a dance for about 30 minutes, turning conventional exercises into something fun. The mascot of our team had a very active participation in the warm-up, which encouraged the people to do the exercises properly and enthusiastically. </p><br />
<br />
<p>We then proceeded to take the participants to the start area. The women’s group was the first one to start running, followed 5 minutes later by the men’s group.</p><br />
<br />
<p>The start of the route was the main entrance to our school. Then, the road stretched by the campus’ internal streets to the Faculty of Economics, and then the participants resumed their route in the opposite direction of the streets to return to the entrance of the school. </p><br />
<br></div><br />
<br />
<center><table width=80%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:px;"><img width=400 height=270 src="https://static.igem.org/mediawiki/2014hs/e/e5/CIDEBHPcarrera4.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://static.igem.org/mediawiki/2014hs/0/01/CIDEBHPcarrera5.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://static.igem.org/mediawiki/2014hs/5/5c/CIDEBHPcarrera6.png"/></td><br />
<br />
</tr></table></center><br />
<br />
<br><br />
<div class="container-text"><br />
<p><b><h2> 2nd Stage of the Race: Project information</h2></b></p><br />
<br />
<p>Along the route, there were people on the sidewalks with informative signs about different synthetic biology fun facts, general information about the project, about the impact that our project would have on society, etc... At the halfway point, several people could be found giving away small bags of water to hydrate the runners.</p><br />
<br />
<p>At this point, we had already accomplished one of the main objectives of the race (to promote physical activity). The next step was encouraging people to learn more about our project (and have some fun while doing so). </p><br />
<br />
<p> At the end of the route, the participants returned to the starting point (the parking of the school). In this place, there were different modules with information relevant to our project. Each module included an allusive game to every action of the bacterium (Capture, Union, Resistance and Aroma), so that people could learn in an easy and interactive way. Thus, while participants took a break, they could observe and receive a brief explanation of our project, and they could play and get coupons which could be exchanged for prizes. </p><br />
<br />
<center><table width=80%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:px;"><img width=252 height=395 src="https://static.igem.org/mediawiki/2014hs/0/03/CIDEBHPcarrera7.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=544 height=387 src="https://static.igem.org/mediawiki/2014hs/9/9c/CIDEBHPcarrera8.jpg"/></td><br />
<br />
<br />
</tr></table></center><br />
<br />
<p><b><h2>Impact</h2></b></p> <br />
<br />
<p>Two weeks before, the students learned from the DNA WEEK what was our project about, so they made comments such as “Hi E.CARU!” to our costume, or “Is this from iGEM?” and “How can I get in?” to our team members. Even in the game time, when looking at it, some of them were able to recognize easily the parts referring to our project. (Each game was created to give a reference about our project, its modules and their function). </p><br />
<br />
<p>People, who were not students and hadn’t received those talks, were asking about the iGEM team and the project that we are working on. They asked how does it work, how did we do it, what will it be able to do, and more. They were very interested; even though they did not want to play because they were older, they were paying attention while the younger ones were playing and listened to the explanation that the team members gave.</p><br />
<br />
<p>The race was a complete success. We had received supportive comments during it, and we realized that people were interested in what we are doing. The assistants gained knowledge about our project while having a good time, spending time with their families and friends.</p><br />
<br />
<br />
<p><b><h2>Bibliography</h2></b></p> <br />
United Nations Food and Agricultural Organization (FAO). (2008). <i>The state of food and agriculture.</i> Retrieved from http://www.fao.org/docrep/018/i3300e/i3300e.pdf<br><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma
Team:CIDEB-UANL Mexico/project aroma
2014-06-18T16:52:25Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project<br />
</title><br />
<style>body{margin: 0px; width: 100%;padding: 0px;dubackground: #2056ac;font-family: 'Oxygen', sans-serif;font-size: 12pt;background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);}h1, h2, h3{margin: 0;padding-bottom: 5px;color: #404040;}p, ol, ul{margin-top: 0;}ol, ul{padding: 0;list-style: none;}p{line-height: 1.60em;padding- right: 3em;}strong{}a{color: #2056ac;}a:hover{text-decoration: none;}.container{margin: 0px auto;width: 1200px;}.container-text{margin: 0px auto;width: 75%;padding: 0px;font-family: 'Oxygen', sans-serif;font-size: 12pt; text-align: justify;}.wrapper{overflow: hidden;padding: 0em 0em 1em 0em;background: #FFF;}#wrapper1{background: #FFF;}#wrapper2{overflow: hidden;background: #F3F3F3;padding: 5em 0em;text-align: center;}#wrapper3{overflow: hidden;padding: 0em 0em 0em 0em;background: #FFF;}#wrapper4{}#banner{padding-top: 2em;}#welcome{overflow: hidden;width: 1000px;padding: 0em 100px 0em 100px;text-align: center;}#welcome .content{padding: 0em 8em;}#welcome .title h2{}#welcome a,#welcome strong{}.title{margin-bottom: 1em;}.title h2{font-size: 2em;}.title .byline{font-size: 1.1em;color: #6F6F6F#;}#three-column{overflow: hidden;margin-top: 5em;padding-top: 1em;border-top: 1px solid rgba(0,0,0,0.2);text-align: center;}#three-column h2{margin: 1em 0em;font-size: 1.5em;font-weight: 700;}#three-column .icon{position: relative;display: block;margin: 0px auto 0.80em auto;background: none;line-height: 150px;font-size: 4em;width: 150px;height: 100px;border-radius: 100px;border: 6px solid #67128F;text-align: center;color: #FFF;}#three-column #tbox1,#three-column #tbox2,#three-column #tbox3{float: left;width: 320px;padding: 30px 40px 50px 40px;}#three-column .title{text-align: center;}#three-column .title h2{font-size: 1.60em;}#three-column .title .byline{padding-top: 0.50em;font-size: 0.90em;color: #858585;}#three-column .arrow-down{border-top-color: #292929;}ul.tools{margin: 0;padding: 0em 0em 0em 0em;list-style: none;}ul.tools li{display: inline-block;padding: 0em .2em;font-size: 4em;}ul.tools li span{display: none;margin: 0;padding: 0;}ul.tools li a{color: #FFF;}ul.tools li a:before{display: inline-block;background: #1ABC9C;width: 120px;height: 120px;border-radius: 50%;line-height: 120px;text-align: center;color: #FFFFFF;}.button{display: inline-block;margin-top: 2em;padding: 0.8em 2em;background: #64ABD1;line-height: 1.8em;letter-spacing: 1px;text-decoration: none;font-size: 1em;color: #FFF;}.button:before{display: inline-block;background: #8DCB89;margin-right: 1em;width: 40px;height: 40px;line-height: 40px;border-radius: 20px;text-align: center;color: #272925;}.button-small{}#portfolio{overflow: hidden;padding-top: 5em;border-top: 1px solid rgba(0,0,0,0.2);}#portfolio .box{text-align: center;color: rgba(0,0,0,0.5);}#portfolio h3{display: block;padding-bottom: 1em;font-size: 1em;color: rgba(0,0,0,0.6);}#portfolio .title{text-align: center;}#portfolio .title h2{color: rgba(0,0,0,0.8);}.column1,.column2,.column3,.column4{width: 282px;}.column1,.column2,.column3{float: left;margin-right: 24px;}.column4{float: right;}<br />
</style><br />
<br />
<body><br />
<br />
<div class="wrapper"><br />
<br />
<div id="welcome" class="container"> <br />
<br />
<div class="title"> <h2>Aroma Module</h2> <br />
</div><br />
</div><br />
<br />
<div class="container-text"><br />
<table width=100%><br />
<tr><br />
<td><br />
<br />
<p>Since the beginning of iGEM project, the use of fluorescent reporters has been used in each one of the proposed projects in previous years, trying to test the theoretical presence of other proteins in <i>E. coli</i>. For our iGEM 2014 project, this module proposed to promote the usage of aroma reporters, instead of fluorescent ones.</p><br />
</td><br />
<td style="padding-left:12px;"><img width=131 height=127 src="https://static.igem.org/mediawiki/2014hs/5/5c/HandsomeAroma.jpg"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<p><b>How is the Aroma module composed?</b></p><br />
<br />
<p>This gene is composed by the following parts (see <b>figure 1A</b>): (1) a constitutive promoter, (2) a RNA thermometer, also called ribo-switch; used to regulate the WinterGreen-odor protein production through temperature, (3) a Wintergreen-odor enzyme generator, used to allow the production of methyl salicylate, induced by salicylic acid, and (4) a terminator. All of these parts are ligated by an 8-bp scar (TACTAGAG).</p><center><br />
<br />
<p><img width=507 height=221 src="https://static.igem.org/mediawiki/2014hs/5/56/AromaFigure1Aa.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 1.</b> Aroma Module</p></center><br />
<br />
<p>Different to fluorescent reporters, this module was made in order to (in the future) perform as an aroma reporter and also to test the correct function of the bacteria, for its future usage as a new reporter and functional part (CDS). It is desired to use this part in the project to replace the red fluorescent protein (RFP) in the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture module</a>. But it was preferable to test it apart to demonstrate its effectiveness. Similarly, this piece is also helpful for <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union module</a>, because when performing the filtration by silica, WinterGreen can demonstrate the presence of bacteria in the beads. The team added the RNA thermometer for regulating the production of the aroma in the project. Another reason for selecting the RNA thermometer as a regulator was to continue the <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico">CIDEB UANL 2013 </a> work with it.</p><br />
<br><br />
<br />
<p><b>How does it work?</b></p><center><br />
<br />
<p><img width=334 height=232 src="https://static.igem.org/mediawiki/2014hs/6/6e/AromaFigure1Bb.png "align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 2.</b> Production of Wintergreen Odor</p></center><br />
<br />
<p>This module has a constitutive promoter which will be regulated by temperature with the use of the RNA thermometer. When adding salicylic acid to the bacteria in a 32° Celsius environment, the production of the WinterGreen protein will begin.</p><br />
<br><br />
<br />
<p><b>Parts of the module</b></p><br />
<br><center><br />
<br />
<div><br />
<table class=MsoTable15Grid7ColorfulAccent3 border=1 cellspacing=0 cellpadding=0 width=625 style='width:468.55pt;border-collapse:collapse; border:none;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt'> <br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes; height:15.0pt'> <br />
<td width=88 nowrap valign=top style='width:66.1pt;border:none;border-bottom: solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint: 153;mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:517'><b><br />
<br />
<span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX;mso-bidi-font-style: italic'>IMAGE<br />
</span></b><br />
<br />
<span lang=ES-MX style='font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:"Times New Roman"; mso-fareast-language:ES-MX;mso-bidi-font-style:italic'><o:p></o:p><br />
</span></p> <br />
</td> <br />
<td width=119 valign=top style='width:89.0pt;border:none;border-bottom:solid #C2D69B 1.0pt; mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint:153; mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><br />
<br />
<span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>CODE<br />
</span></b><br />
<br />
<span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p><br />
</span></p> <br />
</td> <br />
<td width=418 nowrap valign=top style='width:313.45pt;border:none;border-bottom: solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint: 153;mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;background:white;mso-background-themecolor: background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><br />
<br />
<span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>DESCRIPTION<br />
</span></b><br />
<br />
<span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:0;height:83.15pt'> <br />
<td width=88 nowrap valign=top style='width:66.1pt;border:none;border-right: solid #C2D69B 1.0pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:83.15pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1029" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:10.95pt;margin-top:3.2pt;width:66pt;height:48pt; z-index:251660800;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image007.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=88 height=64 src="https://static.igem.org/mediawiki/2014hs/4/43/PConsAroma.png" align=left hspace=12 v:shapes="_x0000_s1029"><![endif]></p> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><i><br />
<br />
<span lang=ES-MX style='font-family:Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade: 191;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p>&nbsp;</o:p><br />
</span></i></p> <br />
</td> <br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; background:#EAF1DD;mso-background-themecolor:accent3;mso-background-themetint: 51;padding:0cm 5.4pt 0cm 5.4pt;height:83.15pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119A</a><br />
</span><br />
<br />
<span lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'><o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p> <br />
</td> <br />
<td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3; mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:83.15pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>In the specific case of our aroma module, it will help the bacteria to continuously transcribe the <br />
<br />
<span class=SpellE>WinterGreen<br />
</span> gene in order to allow the bacteria to continuously produce the aroma. <br />
</span><br />
<br />
<span class=SpellE><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size: 11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'>This<br />
</span><br />
</span><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family: Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; color:black;mso-fareast-language:ES-MX'> <br />
<br />
<span class=SpellE>promoter<br />
</span> has a <br />
<br />
<span class=SpellE>length<br />
</span> of 35bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:1;height:77.45pt'> <br />
<td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:77.45pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1028" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:16.95pt;margin-top:4.25pt;width:57.75pt; height:44.25pt;z-index:251662848;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image009.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=77 height=59 src="https://static.igem.org/mediawiki/2014hs/b/b0/RNAthermAroma.png" align=left hspace=12 v:shapes="_x0000_s1028"><![endif]><i><br />
<br />
<span lang=ES-MX style='font-family: Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade:191;mso-fareast-language: ES-MX;mso-no-proof:yes'><o:p></o:p><br />
</span></i></p><br />
</td> <br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; padding:0cm 5.4pt 0cm 5.4pt;height:77.45pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K115017">BBa_K115017</a><o:p></o:p><br />
</span></p><br />
</td> <br />
<td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:77.45pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span style='font-size:12.0pt;mso-bidi-font-size: 11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>A RNA thermometer, used for temperature post-transcriptional regulation (thermo sensor), and is designed to initiate transcription around 32°C.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:2;height:190.6pt'> <br />
<td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:190.6pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:68'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1027" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:13.95pt;margin-top:3.2pt;width:63pt;height:51.75pt; z-index:251664896;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image011.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=84 height=69 src="https://static.igem.org/mediawiki/2014hs/b/b1/WinterGreenAroma.png" align=left hspace=12 v:shapes="_x0000_s1027"><![endif]><i><br />
<br />
<span style='font-size:3.0pt;font-family: Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade:191;mso-ansi-language: EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p><br />
</span></i></p><br />
</td> <br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; background:#EAF1DD;mso-background-themecolor:accent3;mso-background-themetint: 51;padding:0cm 5.4pt 0cm 5.4pt;height:190.6pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:Oxygen; mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; mso-ansi-language:EN-US;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K1255001:Design">BBa_K1255001</a><o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p> <br />
</td> <br />
<td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3; mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:190.6pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-yfti-cnfc:64'><br />
<br />
<span style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>Produces a <br />
<br />
<span class=SpellE>transferase<br />
</span> to convert salicylic acid into methyl salicylate (<br />
<br />
<span class=SpellE>WinterGreen<br />
</span> odor). The wintergreen odor generator requires of 2mM of salicylic acid to produce methyl salicylate. BSMT1 (<a href="http://parts.igem.org/Part:BBa_J45004">BBa_J45004</a>), <br />
<br />
<span class=SpellE>WinterGreen<br />
</span> Odor Generator original name, was created by <a href="https://2006.igem.org/wiki/index.php/MIT_2006">MIT 2006</a>. This year, the team optimized the sequence for <i>Escherichia coli</i>. <br />
</span><br />
<br />
<span class=SpellE><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'>The<br />
</span><br />
</span><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family: Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial; color:black;mso-fareast-language:ES-MX'> new <br />
<br />
<span class=SpellE>biobrick<br />
</span> has a <br />
<br />
<span class=SpellE>length<br />
</span> of 1,074bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes;height:70.7pt'> <br />
<td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left: none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt: solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint: 153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt; height:70.7pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-yfti-cnfc:4'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1026" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:18pt;margin-top:1.85pt;width:59.1pt;height:49.4pt; z-index:251666944;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="TablasAromaYResistencia_archivos/image013.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=79 height=66 src="https://static.igem.org/mediawiki/2014hs/6/62/TerminatorAroma.png" align=left hspace=12 v:shapes="_x0000_s1026"><![endif]></p> <br />
</td> <br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none; border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor: accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt; mso-border-right-themecolor:accent3;mso-border-right-themetint:153; mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3; mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt; mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt: solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153; padding:0cm 5.4pt 0cm 5.4pt;height:70.7pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><br />
<br />
<span lang=ES-MX style='font-size:12.0pt; mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a><o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'>&nbsp;</p> <br />
</td> <br />
<td width=418 valign=top style='width:313.45pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3; mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor: accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt; mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt: solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint: 153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3; mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:70.7pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal'><br />
<br />
<span style='font-size:12.0pt;mso-bidi-font-size: 11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman"; mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language: ES-MX'>Part made of 6bp, responsible for transcription stop. The terminator stops the production of methyl salicylate. <o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr><br />
</table><br />
</div></center><br />
<br><br />
<br />
<p><b>Full Device:</b></p><br />
<br />
<p>These 4 genetic parts form the Aroma device of the project (see <b>Figure 3</b>). The full device's length is 1,251bp (including restriction sites).</p><center><br />
<br />
<p><img width=629 height=106 src="https://static.igem.org/mediawiki/2014hs/3/3a/AromaFigure4.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 3.</b> Aroma Device</p></center><br />
<br />
<p><b>Other teams that use RNA thermometer and WinterGreen (BSMT1)</b></p><br />
<br />
<p><i>RNA thermometer</i></p><br />
<br />
<p class=MsoListParagraph style='margin-top:0cm;margin-right:0cm;margin-bottom:5.0pt;margin-left:21.3pt;'><![if !supportLists]><br />
<br />
<spanstyle='font-size:12.0pt;font-family:Symbol;mso-fareast-font-family:Symbol;mso-bidi-font-family:Symbol'><br />
<br />
<span style='mso-list:Ignore'>·<br />
<br />
<spanstyle='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span><br />
</span><br />
</span><![endif]><br />
<br />
<span class=SpellE><b style='mso-bidi-font-weight:normal'><br />
<br />
<span><a href="https://2008.igem.org/Team:TUDelft">TUDelft <br />
</span></b><br />
</span><bstyle='mso-bidi-font-weight:normal'><br />
<br />
<span> 2008:</a><br />
</span></b><br />
<br />
<span> Temperature-sensing bacteria that changescolor at different temperatures; as a temperature reporter system inlarge-scale fermentations, or as a temperature-inducible protein productionsystem. <o:p></o:p><br />
</span></p><center><br />
<br />
<p><img width=571 height=129 src="https://static.igem.org/mediawiki/2014hs/e/e0/AromaFigure5.png"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 4.</b> RNA Thermometer circuit, excerpted from <a href="https://2008.igem.org/Team:TUDelft">TUDelft 2008</a> team</p></center><br />
<br />
<p class=MsoListParagraph style='margin-top:0cm;margin-right:0cm;margin-bottom:5.0pt;margin-left:21.3pt;'><![if !supportLists]><br />
<br />
<spanstyle='font-size:12.0pt;font-family:Symbol;mso-fareast-font-family:Symbol;mso-bidi-font-family:Symbol'><br />
<br />
<span style='mso-list:Ignore'>·<br />
<br />
<spanstyle='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span><br />
</span><br />
</span><![endif]><br />
<br />
<span class=SpellE><b style='mso-bidi-font-weight:normal'><br />
<br />
<span> <a href="https://2009.igem.org/Team:VictoriaBC">VictoriaBC<br />
</span></b><br />
</span><bstyle='mso-bidi-font-weight:normal'><br />
<br />
<span> 2009: </a><br />
</span></b><br />
<br />
<span>NAND logic gate using the ribo-key/ribo-lock system designed by <a href="https://2006.igem.org/wiki/index.php/Berkeley">Berkeley 2006</a> team , producing RFP except when the cells are grown in the presence of both arabinose and IPTG, also coupling fluorescent outputs with the ribo-thermometers made by <a href="https://2008.igem.org/Team:TUDelft">TUDelft 2008</a> team. <o:p></o:p><br />
</span></p><br />
<br />
<p class=MsoListParagraph style='margin-top:0cm;margin-right:0cm;margin-bottom:5.0pt;margin-left:21.3pt;'><![if !supportLists]><br />
<br />
<spanstyle='font-size:12.0pt;font-family:Symbol;mso-fareast-font-family:Symbol;mso-bidi-font-family:Symbol'><br />
<br />
<span style='mso-list:Ignore'>·<br />
<br />
<spanstyle='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span><br />
</span><br />
</span><![endif]><br />
<br />
<span class=SpellE><b style='mso-bidi-font-weight:normal'><br />
<br />
<span><a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico">iGEM_CIDEB <br />
</span></b><br />
</span><bstyle='mso-bidi-font-weight:normal'><br />
<br />
<span>2013:</a><br />
</span></b><br />
<br />
<span> Production of Vip3ca3, which acts as a pesticide protein, regulated by specific temperatures in order to avoid overproduction and it will show activity against target organisms Coleoptera and Lepidoptera. <o:p></o:p><br />
</span></p><center><br />
<br />
<p><img width=474 height=146 src="https://static.igem.org/mediawiki/2014hs/3/3f/AromaFigure6.jpg "align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 5.</b> Circuit from <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico">iGEM CIDEB UANL 2013</a> team</p></center><br />
<br />
<p><i>WinterGreen (BSMT1)</i></p><br />
<br />
<p class=MsoListParagraph style='margin-top:0cm;margin-right:0cm;margin-bottom:5.0pt;margin-left:21.3pt;'><![if !supportLists]><br />
<br />
<spanstyle='font-size:12.0pt;font-family:Symbol;mso-fareast-font-family:Symbol;mso-bidi-font-family:Symbol'><br />
<br />
<span style='mso-list:Ignore'>·<br />
<br />
<spanstyle='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span><br />
</span><br />
</span><![endif]><br />
<br />
<span class=SpellE><b style='mso-bidi-font-weight:normal'><br />
<br />
<span><a href="https://2006.igem.org/wiki/index.php/MIT_2006">MIT 2006</a>:<br />
</span></b><br />
</span><br />
<br />
<span> This device produces methyl salicylate in the presence of salicylic acid. Methyl salicylate smells strongly of mint (wintergreen). Production of methyl salicylate was verified both by scent and by gas chromatography: E. coli with no WGD did not produce methyl salicylate when SA was added to the medium, while E. coli with the WGD did produce methyl salicylate when SA was added to the medium. <o:p></o:p><br />
</span></p><center><br />
<br />
<p><img width=533 height=198 src="https://static.igem.org/mediawiki/2014hs/9/98/AromaFigure7.jpg"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 6.</b> Wintergreen odor enzyme (BSMT1) generator circuit by <a href="https://2006.igem.org/wiki/index.php/MIT_2006">MIT 2006</a></p></center><br />
<br />
<p><center><iframe width="600" height="500" src="//www.youtube.com/embed/fd9EQNCOr2k" frameborder="0" allowfullscreen></iframe></center></p><br />
<br><br />
<br />
<p><b>Bibliography/References</b></p><font size="2"><br />
<br />
<p>● Huang, H. (2006, August 30). <i>Part:BBa_B1002. </i> Retrieved August 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002"> http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002</a>.</p><br />
<br />
<p>● iGEM2006_Berkeley. (2006). <i>Part:BBa_J23100</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_J23100"> http://parts.igem.org/Part:BBa_J23100</a>.</p><br />
<br />
<p>● iGEM2006_MIT. (2006). <i>Part:BBa_J45004</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_J45004"> http://parts.igem.org/Part:BBa_J45004</a>. </p><br />
<br />
<p>● iGEM CIDEB Team. (2013). <i>iGEM CIDEB UANL 2013</i>. Retrieved on March 31th, 2014. <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico/Project"> https://2013hs.igem.org/Team:CIDEB-UANL_Mexico/Project</a>. </p><br />
<br />
<p>● iGEM08_TUDelft. (2008). <i>Part:BBa_K115017</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_K115017"> http://parts.igem.org/Part:BBa_K115017</a>. </p><br />
<br />
<p>● MIT IGEM Team. (2006). <i>MIT 2006</i>. Retrieved on March 31th, 2014, from: <a href="https://2006.igem.org/wiki/index.php/MIT_2006"> https://2006.igem.org/wiki/index.php/MIT_2006</a>. </p><br />
<br />
<p>● TUDelft iGEM Team. (2008). <i>TUDelft 2008</i>. Retrieved on March 31th, 2014, from: <a href="https://2008.igem.org/Team:TUDelft"> https://2008.igem.org/Team:TUDelft</a>. </p><br />
<br />
<p>● VictoriaBC. (2009). <i>VictoriaBC 2009</i>. Retrieved on March 31th, 2014, from: <a href="https://2009.igem.org/Team:VictoriaBC"> https://2009.igem.org/Team:VictoriaBC</a>. </p><br />
<br />
<p>● Zubieta, Chole et al. (2003). <i>Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family</i>. Manuscript submitted for publication. Retrieved from <a href="www.plantcell.org"> www.plantcell.org</a>. </p></font><br />
<br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma#"><font color="blue">Return to the Top</font></a></p><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html>{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_race
Team:CIDEB-UANL Mexico/hp race
2014-06-17T22:50:06Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Race for Science</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=290 height=139 src=" https://static.igem.org/mediawiki/2014hs/b/b2/CIDEBHPcarrera1.png"/><br />
</td><br />
<td><br />
<p> As it is said: <i>“Mens sana in corpore sano” </i> (healthy mind in a healthy body), we, as a team, believe that everyone should enjoy a healthy life, in which there is a balance between study and physical activity.</p><br />
<p>So after making the “Explosion”, once people knew what we do in iGEM, we wanted to expand the knowledge and interest of people about our project. That's why we decided to organize this "Carrera por la Ciencia" (Race for Science), which included a circuit of about 4 kilometers and at the end a fair with entertaining games related to the project in a way that people could spend time together as a family and learn at the same time. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p>Thus, the event gave us the ability to combine the information about our project and synthetic biology, with physical exercise. This last concept is particularly important for us, especially in Mexico, where the rates of obesity and sedentary lifestyle are disturbing. </p><br />
<br />
<p><b><h2> Objectives</h2></b></p> <br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=280 height=174 src="https://static.igem.org/mediawiki/2014hs/0/02/CIDEBHPcarrera3.jpg"/><br />
</td><br />
<td><br />
<p> According to an article from the United Nations Food and Agricultural Organization (FAO), Mexico is considered as the world's fattest country with a 32.8 percent adult obesity rate, surpassing United States' 31.8 obesity rate. About 70 percent of Mexican adults are considered to be overweight.</p><br />
<p>Monterrey is an industrial city where most people lead stressful and sedentary lifestyles. We, as a part of this society, are too familiar with the dangers of obesity and the prevalent lack of healthy diet and exercise habits. </p><br />
<p>This, combined with the need to develop our project in the Human Practices area, is the reason why we felt motivated to organize this Race for Science. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<p> The main purposes od the Race for Science were:</p><br />
<p> • To spread information about the project within both the academic and non-academic community, in a fun, innovating and accessible way </p><br />
<p> • To promote physical activities that have a beneficial impact on human health and thus, help cultivate a balance between body and mind </p><br />
<br />
<p>The event was promoted through a personal invitation to the people in our high school, and they were suggested to invite their family members and/or friends to join them. Posters were also made with all the information about the event; they were placed in different parts of the school and simultaneously posted digitally on the official page of the iGEM CIDEB team on Facebook. </p><br />
<br><br />
<p><b><h2> 1st Stage of the Race: Physical Activity</h2></b></p> <br />
<br />
<p>The race was held within the “Mederos” campus of the UANL. The attendees were asked to arrive at 6:30 a.m., so that the event could start at 7:00 a.m. We welcomed about 600 participants, ranging in age from 7 years old to third age.</p><br />
<br />
<p>At 7:00 am a warm-up session was performed. The session was developed with the help of a professional, who lead a dance for about 30 minutes, turning conventional exercises into something fun. The mascot of our team had a very active participation in the warm-up, which encouraged the people to do the exercises properly and enthusiastically. </p><br />
<br />
<p>We then proceeded to take the participants to the start area. The women’s group was the first one to start running, followed 5 minutes later by the men’s group.</p><br />
<br />
<p>The start of the route was the main entrance to our school. Then, the road stretched by the campus’ internal streets to the Faculty of Economics, and then the participants resumed their route in the opposite direction of the streets to return to the entrance of the school. </p><br />
<br><br />
<br />
<center><table width=100%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:50px;"><img width=400 height=270 src="https://static.igem.org/mediawiki/2014hs/e/e5/CIDEBHPcarrera4.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://static.igem.org/mediawiki/2014hs/0/01/CIDEBHPcarrera5.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=370 height=270 src="https://static.igem.org/mediawiki/2014hs/5/5c/CIDEBHPcarrera6.png"/></td><br />
<br />
</tr></table></center><br />
<br />
<br><br />
<br />
<p><b><h2> 2nd Stage of the Race: Project information</h2></b></p><br />
<br />
<p>Along the route, there were people on the sidewalks with informative signs about different synthetic biology fun facts, general information about the project, about the impact that our project would have on society, etc... At the halfway point, several people could be found giving away small bags of water to hydrate the runners.</p><br />
<br />
<p>At this point, we had already accomplished one of the main objectives of the race (to promote physical activity). The next step was encouraging people to learn more about our project (and have some fun while doing so). </p><br />
<br />
<p> At the end of the route, the participants returned to the starting point (the parking of the school). In this place, there were different modules with information relevant to our project. Each module included an allusive game to every action of the bacterium (Capture, Union, Resistance and Aroma), so that people could learn in an easy and interactive way. Thus, while participants took a break, they could observe and receive a brief explanation of our project, and they could play and get coupons which could be exchanged for prizes. </p><br />
<br />
<center><table width=100%><br />
<tr><br />
<td><br />
</td><br />
<br />
<td style="padding-left:200px;"><img width=252 height=395 src="https://static.igem.org/mediawiki/2014hs/0/03/CIDEBHPcarrera7.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=544 height=387 src="https://static.igem.org/mediawiki/2014hs/9/9c/CIDEBHPcarrera8.jpg"/></td><br />
<br />
<br />
</tr></table></center><br />
<br />
<p><b><h2>Impact</h2></b></p> <br />
<br />
<p>Two weeks before, the students learned from the DNA WEEK what was our project about, so they made comments such as “Hi E.CARU!” to our costume, or “Is this from iGEM?” and “How can I get in?” to our team members. Even in the game time, when looking at it, some of them were able to recognize easily the parts referring to our project. (Each game was created to give a reference about our project, its modules and their function). </p><br />
<br />
<p>People, who were not students and hadn’t received those talks, were asking about the iGEM team and the project that we are working on. They asked how does it work, how did we do it, what will it be able to do, and more. They were very interested; even though they did not want to play because they were older, they were paying attention while the younger ones were playing and listened to the explanation that the team members gave.</p><br />
<br />
<p>The race was a complete success. We had received supportive comments during it, and we realized that people were interested in what we are doing. The assistants gained knowledge about our project while having a good time, spending time with their families and friends.</p><br />
<br />
<br />
<p><b><h2>Bibliography</h2></b></p> <br />
United Nations Food and Agricultural Organization (FAO). (2008). <i>The state of food and agriculture.</i> Retrieved from http://www.fao.org/docrep/018/i3300e/i3300e.pdf<br><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/File:CIDEBHPcarrera6.png
File:CIDEBHPcarrera6.png
2014-06-17T22:20:23Z
<p>UnicornioMagico: uploaded a new version of &quot;File:CIDEBHPcarrera6.png&quot;</p>
<hr />
<div></div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_race
Team:CIDEB-UANL Mexico/hp race
2014-06-17T22:04:08Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Race for Science</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=290 height=139 src=" https://static.igem.org/mediawiki/2014hs/b/b2/CIDEBHPcarrera1.png"/><br />
</td><br />
<td><br />
<p> As it is said: <i>“Mens sana in corpore sano” </i> (healthy mind in a healthy body), we, as a team, believe that everyone should enjoy a healthy life, in which there is a balance between study and physical activity.</p><br />
<p>So after making the “Explosion”, once people knew what we do in iGEM, we wanted to expand the knowledge and interest of people about our project. That's why we decided to organize this "Carrera por la Ciencia" (Race for Science), which included a circuit of about 4 kilometers and at the end a fair with entertaining games related to the project in a way that people could spend time together as a family and learn at the same time. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p>Thus, the event gave us the ability to combine the information about our project and synthetic biology, with physical exercise. This last concept is particularly important for us, especially in Mexico, where the rates of obesity and sedentary lifestyle are disturbing. </p><br />
<br />
<p><b><h2> Objectives</h2></b></p> <br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=280 height=174 src="https://static.igem.org/mediawiki/2014hs/0/02/CIDEBHPcarrera3.jpg"/><br />
</td><br />
<td><br />
<p> According to an article from the United Nations Food and Agricultural Organization (FAO), Mexico is considered as the world's fattest country with a 32.8 percent adult obesity rate, surpassing United States' 31.8 obesity rate. About 70 percent of Mexican adults are considered to be overweight.</p><br />
<p>Monterrey is an industrial city where most people lead stressful and sedentary lifestyles. We, as a part of this society, are too familiar with the dangers of obesity and the prevalent lack of healthy diet and exercise habits. </p><br />
<p>This, combined with the need to develop our project in the Human Practices area, is the reason why we felt motivated to organize this Race for Science. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<p> The main purposes od the Race for Science were:</p><br />
<p> • To spread information about the project within both the academic and non-academic community, in a fun, innovating and accessible way </p><br />
<p> • To promote physical activities that have a beneficial impact on human health and thus, help cultivate a balance between body and mind </p><br />
<br />
<p>The event was promoted through a personal invitation to the people in our high school, and they were suggested to invite their family members and/or friends to join them. Posters were also made with all the information about the event; they were placed in different parts of the school and simultaneously posted digitally on the official page of the iGEM CIDEB team on Facebook. </p><br />
<br />
<p><b><h2> 1st Stage of the Race: Physical Activity</h2></b></p> <br />
<br />
<p>The race was held within the “Mederos” campus of the UANL. The attendees were asked to arrive at 6:30 a.m., so that the event could start at 7:00 a.m. We welcomed about 600 participants, ranging in age from 7 years old to third age.</p><br />
<br />
<p>At 7:00 am a warm-up session was performed. The session was developed with the help of a professional, who lead a dance for about 30 minutes, turning conventional exercises into something fun. The mascot of our team had a very active participation in the warm-up, which encouraged the people to do the exercises properly and enthusiastically. </p><br />
<br />
<p>We then proceeded to take the participants to the start area. The women’s group was the first one to start running, followed 5 minutes later by the men’s group.</p><br />
<br />
<p>The start of the route was the main entrance to our school. Then, the road stretched by the campus’ internal streets to the Faculty of Economics, and then the participants resumed their route in the opposite direction of the streets to return to the entrance of the school. </p><br />
<br />
<p><b><h2> 2nd Stage of the Race: Project information</h2></b></p><br />
<br />
<p>Along the route, there were people on the sidewalks with informative signs about different synthetic biology fun facts, general information about the project, about the impact that our project would have on society, etc... At the halfway point, several people could be found giving away small bags of water to hydrate the runners.</p><br />
<br />
<p>At this point, we had already accomplished one of the main objectives of the race (to promote physical activity). The next step was encouraging people to learn more about our project (and have some fun while doing so). </p><br />
<br />
<p> At the end of the route, the participants returned to the starting point (the parking of the school). In this place, there were different modules with information relevant to our project. Each module included an allusive game to every action of the bacterium (Capture, Union, Resistance and Aroma), so that people could learn in an easy and interactive way. Thus, while participants took a break, they could observe and receive a brief explanation of our project, and they could play and get coupons which could be exchanged for prizes. </p><br />
<br />
<br />
<p><b><h2>Impact</h2></b></p> <br />
<br />
<p>Two weeks before, the students learned from the DNA WEEK what was our project about, so they made comments such as “Hi E.CARU!” to our costume, or “Is this from iGEM?” and “How can I get in?” to our team members. Even in the game time, when looking at it, some of them were able to recognize easily the parts referring to our project. (Each game was created to give a reference about our project, its modules and their function). </p><br />
<br />
<p>People, who were not students and hadn’t received those talks, were asking about the iGEM team and the project that we are working on. They asked how does it work, how did we do it, what will it be able to do, and more. They were very interested; even though they did not want to play because they were older, they were paying attention while the younger ones were playing and listened to the explanation that the team members gave.</p><br />
<br />
<p>The race was a complete success. We had received supportive comments during it, and we realized that people were interested in what we are doing. The assistants gained knowledge about our project while having a good time, spending time with their families and friends.</p><br />
<br />
<br />
<p><b><h2>Bibliography</h2></b></p> <br />
United Nations Food and Agricultural Organization (FAO). (2008). <i>The state of food and agriculture.</i> Retrieved from http://www.fao.org/docrep/018/i3300e/i3300e.pdf<br><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_explosion
Team:CIDEB-UANL Mexico/hp explosion
2014-06-16T15:50:29Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Mascot & iGEM Explosion</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b><h2><center>iGEM Mascot</center></h2></b></p><br />
<br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p>With the purpose of obtaining information of how our high school and the public in general sees iGEM and our iGEM CIDEB project we created our own iGEM mascot. According to the divulgation objective, the group has developed activities with the goal of showing an overview of synthetic biology, as an initiative and entertaining visual recognition, a mascot was elaborated. The importance and objective of the mascot is to generate interest among people, causing them to come and see paraphernalia explaining our project (posters, bracelets bearing an explanation of our project, etc.) There are two main activities where the motley was used; the first one is called DNA Week – it took place inside a high school, and consisted of several activities that promoted synthetic biology. The second activity was called Race 4 Science, and consisted in a series of modules concerning synthetic biology and its different areas.</p><br />
</td><br />
<td style="padding-left:12px;"><img width=160 height=240 src="https://static.igem.org/mediawiki/2014hs/a/a3/CIDEBHPbotarga1.jpg"/></td><br />
</tr></table><br />
<br />
<br><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:100px;"><img width=324 height=216 src="https://static.igem.org/mediawiki/2014hs/9/94/CIDEBHPbotarga2.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=320 height=213 src="https://static.igem.org/mediawiki/2014hs/c/cf/CIDEBHPbotarga3.jpg"/></td><br />
<br />
</tr></table><br />
<br />
<br><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:100px;"><img width=320 height=240 src="https://static.igem.org/mediawiki/2014hs/6/63/CIDEBHPbotarga4.jpg"/></td><br />
<br />
<td style="padding-left:px;"><img width=324 height=216 src="https://static.igem.org/mediawiki/2014hs/0/07/CIDEBHPbotarga5.jpg"/></td><br />
<br />
</tr></table><br />
<br />
<br><br />
<br />
<p><b><h2><center>iGEM Explosion</center></h2></b></p><br />
<br><br />
<p><b><h2>Objective and Description</h2></b></p><br />
<br />
<p>When we started our project, we noticed that the students, teachers and administrative employees in our high school, were not involved in our project and in the iGEM competition as we wanted them to be. For this reason, we decided to make the iGEM “Explosion” to inform everyone in our high school about iGEM and stimulate their curiosity.</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:60px;"><img width=282 height=95 src="https://static.igem.org/mediawiki/2014hs/e/e1/CIDEBHPexplosion1.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=192 height=174 src="https://static.igem.org/mediawiki/2014hs/7/7a/CIDEBHPexplosion2.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=198 height=106 src="https://static.igem.org/mediawiki/2014hs/6/66/CIDEBHPexplosion3.png"/></td><br />
<br />
</tr></table><br />
<br />
<p>Our activities were all focused in giving them a little bit of information about us in a creative way.</p><br />
<br />
<p>For this “Explosion”, we designed several posters with images related to iGEM and some more with information about our project. After this, on the first day after vacations, we placed these posters all over our high school building in commonly visited areas. With this we could make the students to pass and look what the posters said, inciting curiosity towards iGEM.</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:60px;"><img width=173 height=126 src="https://static.igem.org/mediawiki/2014hs/5/53/CIDEBHPexplosion4.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=173 height=160 src="https://static.igem.org/mediawiki/2014hs/b/bf/CIDEBHPexplosion5.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=113 height=196 src="https://static.igem.org/mediawiki/2014hs/1/1f/CIDEBHPexplosion6.png"/></td><br />
<br />
</tr></table><br />
<br />
<p>We also made a Facebook page and Twitter account with the purpose of uploading pictures of the team working, several science related images, information related to our project and updates of our activities in laboratory, so people could see all of our progress in an easy way.</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:100px;"><img width=274 height=257 src="https://static.igem.org/mediawiki/2014hs/6/62/CIDEBHPexplosion7.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=343 height=224 src="https://static.igem.org/mediawiki/2014hs/8/81/CIDEBHPexplosion8.png"/></td><br />
<br />
</tr></table><br />
<br />
<p>We wanted everyone to have something personal and related to us, so we made bracelets and sold them. Both of the designs we made had the caption “IGEM” on them, the blue bracelets also had some little figures representing the 4 modules or our project and a tiny E.CARU with its representative snorkel. The other design was either given in green and white (iGEM colors) or purple and yellow (our High School colors), they looked like the DNA structure and were hand-made by us!</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:100px;"><img width=256 height=166 src="https://static.igem.org/mediawiki/2014hs/6/62/CIDEBHPexplosion9.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=230 height=172 src="https://static.igem.org/mediawiki/2014hs/9/9b/CIDEBHPexplosion10.png"/></td><br />
<br />
</tr></table><br />
<br />
<p><b><h2>Impact</h2></b></p><br />
<br />
<br />
<p>The posters gained the attention of the people who were walking nearby. Teachers and students stopped and after reading them they continued their way. Now people had the opportunity of learning what our project is about just by walking through the high school halls.</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:100px;"><img width=282 height=187 src="https://static.igem.org/mediawiki/2014hs/a/ae/CIDEBHPexplosion11.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=230 height=200 src="https://static.igem.org/mediawiki/2014hs/2/2c/CIDEBHPexplosion12.png"/></td><br />
<br />
</tr></table><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:100px;"><img width=280 height=180 src="https://static.igem.org/mediawiki/2014hs/4/44/CIDEBHPexplosion13.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=230 height=160 src="https://static.igem.org/mediawiki/2014hs/5/53/CIDEBHPexplosion14.png"/></td><br />
<br />
</tr></table><br />
<br><br />
<br />
<br />
<p>With the purpose of motivating second semester students, we planned and exposed an informative conference for the people who were interested in being part of next year’s iGEM CIDEB team. We introduced them the idea that our project should continue in our high school. With activities like “Explosion”, we caught their attention because they could find out what an iGEM project is, what it consists of, and how exciting it can be. The conference was in our high school auditorium. When the set hour arrived, students were already inside; they showed real interest of being part of this, because they discovered what iGEM is about. </p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
</td><br />
<td style="padding-left:60px;"><img width=258 height=181 src="https://static.igem.org/mediawiki/2014hs/5/5d/CIDEBHPexplosion15.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=260 height=162 src="https://static.igem.org/mediawiki/2014hs/a/a0/CIDEBHPexplosion16.png"/></td><br />
<br />
<td style="padding-left:px;"><img width=273 height=183 src="https://static.igem.org/mediawiki/2014hs/f/f5/CIDEBHPexplosion17.png"/></td><br />
<br />
</tr></table><br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_explosion#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_dnaweek
Team:CIDEB-UANL Mexico/hp dnaweek
2014-06-16T15:43:53Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
}<br />
<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>DNA Week</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b><h2>Objective and Description</h2></b></p><br />
<br />
<p>Even though iGEM has been in our high school since 2012, most students still didn’t know what it is about. We have as a goal that future generations inside CIDEB show more interest and curiosity towards biology, and as a consequence, towards iGEM. </p><br />
<br />
<p>We, as a team, consider important that if we want everybody to know what iGEM is and that our high school is involved in it, the starting point must be inside our own institution.</p> <br />
<br />
<p>With the purpose of spreading iGEM and our project, and taking advantage of the international DNA Day (April 25th), we organized the DNA Week.</p><br />
<br />
<br><center><p><img width=700 height=150 src="https://static.igem.org/mediawiki/2014hs/1/16/DNAweekCIDEB2.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<p>Our DNA week consisted of a series of presentations and activities, which were given to all classes of the generation that has a chance to be part of the next iGEM CIDEB team. We asked permission to 3 different biology teachers, and we organized the dates and hours in a 4-day schedule, in May 12th, 13th, 14th, and 16th. We did a Power Point Presentation with information about iGEM and our project. We also performed two activities referring to synthetic biology and to our project between the information given, with the purpose of keeping the audience interested in what we were talking about.</p><br />
<br />
<br><center><table class=MsoTable15Grid4Accent3 border=1 cellspacing=0 cellpadding=0<br />
style='border-collapse:collapse;border:none;mso-border-alt:solid #C2D69B .5pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;mso-yfti-tbllook:1184;<br />
mso-padding-alt:0cm 5.4pt 0cm 5.4pt'><br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes;<br />
height:15.3pt'><br />
<td width=612 colspan=2 valign=top style='width:459.0pt;border:solid #9BBB59 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-alt:solid #9BBB59 .5pt;mso-border-themecolor:<br />
accent3;background:#9BBB59;mso-background-themecolor:accent3;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:15.3pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:5'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Aharoni;color:white;mso-themecolor:<br />
background1;mso-ansi-language:EN-US'>THE PRESENTATION CONSISTED ON:<o:p></o:p></span></b></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:0'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:<br />
accent3;mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>What is IGEM?</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:115%;mso-yfti-cnfc:64'><span lang=EN-US style='font-size:<br />
12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;<br />
mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>A general explanation of<br />
the <span class=SpellE>iGEM</span> competition.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:1'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>What is synthetic biology?</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:115%'><span lang=EN-US style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;mso-bidi-font-family:<br />
Arial;mso-ansi-language:EN-US'>The creation of biological machines in order<br />
to give new features to organisms.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:2'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:<br />
accent3;mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>Talking about DNA</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:115%;mso-yfti-cnfc:64'><span lang=EN-US style='font-size:<br />
12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;<br />
mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>A brief explanation of<br />
DNA and genes, which make every organism different from each other. <o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:3'><br />
<td width=612 colspan=2 valign=top style='width:459.0pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>GAME TIME<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>The<br />
first game represented the insertion of modified plasmids to the bacteria.<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>They<br />
used toy guns to shoot the different plasmids into three different bacteria,<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><span class=GramE><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>taking</span></b></span><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><br />
into account the difference between red, green, and yellow fluorescence proteins<br />
in each bacteria.<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></b></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:4'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:<br />
accent3;mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>IGEM in our high school</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:115%;mso-yfti-cnfc:64'><span lang=EN-US style='font-size:<br />
12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;<br />
mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>CIDEB_UANL has<br />
participated in the <span class=SpellE>iGEM</span> competition for the last 2<br />
years, obtaining the 3<sup>rd</sup> place in each one.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:5'><br />
<td width=192 valign=top style='width:143.8pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:4'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;mso-themecolor:<br />
text2;mso-themeshade:191;mso-ansi-language:EN-US'>CIDEB 2014’s project</span></b><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><o:p></o:p></span></b></p><br />
</td><br />
<td width=420 valign=top style='width:315.2pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>E.CARU consists in 4 modules:<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>- The capture of Na<sup>+ </sup>ions<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>- The productions of an aroma (Wintergreen)<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>- Resistance to different environmental conditions <o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:<br />
EN-US'>- Binding to silica pearls. <o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:6;mso-yfti-lastrow:yes'><br />
<td width=612 colspan=2 valign=top style='width:459.0pt;border:solid #C2D69B 1.0pt;<br />
mso-border-themecolor:accent3;mso-border-themetint:153;border-top:none;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:<br />
accent3;mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:<br />
accent3;mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><i style='mso-bidi-font-style:<br />
normal'><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;<br />
line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;color:#17365D;<br />
mso-themecolor:text2;mso-themeshade:191;mso-ansi-language:EN-US'><br><br />
</span></i></b><b><span lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:<br />
11.0pt;line-height:115%;font-family:Oxygen;mso-bidi-font-family:Arial;<br />
color:#17365D;mso-themecolor:text2;mso-themeshade:191;mso-ansi-language:EN-US'>LET’S<br />
PLAY<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>The<br />
last game consisted of a bacteria which two students had to <i<br />
style='mso-bidi-font-style:normal'>transform<o:p></o:p></i></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>into<br />
E.CARU, placing in it the characteristics that make it unique:<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><b><span lang=EN-US<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:115%;<br />
font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>muscles<br />
of resistance, a drawn silica pearl representing the binding<o:p></o:p></span></b></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:115%;mso-yfti-cnfc:68'><span class=GramE><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>of</span></b></span><b><span<br />
lang=EN-US style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:<br />
115%;font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'><br />
the bacteria, leafs of aroma and a sodium (Na<sup>+</sup>), which represented<br />
the capture of the ions.<o:p></o:p></span></b></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
115%;mso-yfti-cnfc:68'><b><span lang=EN-US style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;line-height:115%;font-family:Oxygen;mso-bidi-font-family:<br />
Arial;mso-ansi-language:EN-US'><span style='mso-spacerun:yes'> </span><o:p></o:p></span></b></p><br />
</td><br />
</tr><br />
</table></center><br />
<br />
<br><br />
<br />
<p><b><h2>Impact</h2></b></p><br />
<br />
<br />
<table width=100%><br />
<br />
<tr><br />
<td><br />
<br />
<td style="padding-left:12px;"> <p>We achieved our objective. During the explanation, the students appeared<br />
surprised and interested about the IGEM competition and our project.<br />
The response given by the rest of the students, of curiosity and participation, is<br />
a very important approach because we awoke their scientific interest and their<br />
enthusiasm to do something related to it.By listening to us and playing the games, students became closer to the<br />
team members asking more about how we were doing with our project, what should<br />
they do if they want to participate, what do we do in each one of our sub teams<br />
(math model, human practices, safety, etc.), and they were even asking us about<br />
the posters we collocated around the school. They showed a lot of interest.<br />
Even teachers approached the team to know about our work.</p><br />
<p align: justify>While<br />
the last year’s project was only known by a few students, this year is a<br />
completely different situation. Now, thanks to activities like this, most of<br />
the students at CIDEB know about <span class=SpellE>iGEM</span>. This is a good<br />
thing because some of them will form the new <span class=SpellE>iGEM</span><br />
CIDEB generation next year, and the possibilities of gaining members who are<br />
really interested has increased, since they are expecting to approach it.</p><br />
</td><br />
<td style="padding-left:12px;"> <img width=507 height=390 src="https://static.igem.org/mediawiki/2014hs/4/4f/DNAweekCIDEB.jpg"<br />
align=center hspace=9 alt="IMG_0317"></p><br />
<br />
</td><br />
</tr></table><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_dnaweek#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_labsafetycards
Team:CIDEB-UANL Mexico/safety labsafetycards
2014-06-16T02:41:27Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_safety}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Lab Safety Cards</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p><b><h2>Objective and Description</h2></b></p><br />
<br />
<p><b>Objective:</b> Safety Team did this activity in order to accomplish two targets: (1) to make people understand the importance of safety in a laboratory and (2) to help students keep in mind the correct ways to work on laboratory practices</p><br><br />
<br />
<p><b>Description: </b>Safety involves all the activities performed in the laboratory and gives safe methods for working on them to avoid accidents or injuries, not only for iGEM contestants, but also for general students. For this reason, Safety Team from iGEM CIDEB 2014 designed and distributed some cards that included general information about how people must work on the laboratory in order to perform successfully their practices. </p><br />
</td><br />
<td style="padding-left:px;"><img width=280 height=200 src="https://static.igem.org/mediawiki/2014hs/3/3e/CardCIDEB.JPG"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<p>The structure for each card was of 12cm x 7cm, including eight recommendations that discussed about how students should follow and perform their practices, including images.</p><br />
<br />
<p>These cards were delivered by Safety team before an Experimental Science Laboratory practice to students of second semester. The team told them the importance of safety while performing lab work; they also encouraged them to work safer and proceed to give them the cards.</p><br><br />
<br />
<center><p><img width=361 height=241 src="https://static.igem.org/mediawiki/2014hs/4/47/LabCardCIDEB.JPG" hspace=12><br />
<br />
<img width=10><br />
<br />
<img width=360 height=241 src="https://static.igem.org/mediawiki/2014hs/c/c4/LabCardStudentsCIDEB.JPG"<br />
hspace=12 ></p></center><br />
<br />
<br><p>The information contained in the cards was the following:</p><br />
<br />
<p style='text-align:justify;text-indent:-18.0pt;mso-list:l1 level1 lfo2'><![if !supportLists]><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
Oxygen;mso-bidi-font-family:Oxygen;mso-ansi-language:EN-US'><span<br />
style='mso-list:Ignore'>1.<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span></span></span><![endif]><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-ansi-language:EN-US'>Remember to always use a lab coat,<br />
long pants, closed shoes and, in case of the girls, tied hair. It’s very<br />
important to avoid accidents with every type of reactive you work with. <o:p></o:p></span></p><br />
<br />
<p class=MsoListParagraphCxSpMiddle style='text-align:justify;text-indent:-18.0pt;mso-list:l1 level1 lfo2'><![if !supportLists]><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
Oxygen;mso-bidi-font-family:Oxygen;mso-ansi-language:EN-US'><span<br />
style='mso-list:Ignore'>2.<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span></span></span><![endif]><span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'>Whenever dangerous substances are being worked with it’s necessary to use gloves and protective lenses. Skin and<br />
eyes are very sensitive. <o:p></o:p></span></p><br />
<br />
<p class=MsoListParagraphCxSpMiddle style='text-align:justify;text-indent:-18.0pt; mso-list:l1 level1 lfo2'><![if !supportLists]><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
Oxygen;mso-bidi-font-family:Oxygen;mso-ansi-language:EN-US'><span<br />
style='mso-list:Ignore'>3.<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span></span></span><![endif]><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-ansi-language:EN-US'>While doing a practice you should<br />
be conscious of what you’re doing. Follow instructions and if you have any<br />
doubt, ask before acting.<o:p></o:p></span></p><br />
<br />
<p class=MsoListParagraphCxSpMiddle style='text-align:justify;text-indent:-18.0pt;mso-list:l1 level1 lfo2'><![if !supportLists]><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
Oxygen;mso-bidi-font-family:Oxygen;mso-ansi-language:EN-US'><span<br />
style='mso-list:Ignore'>4.<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span></span></span><![endif]><span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'>If you observe that something<br />
unusual is happening, don’t hesitate to communicate it to the teacher or to a<br />
lab assistant.<o:p></o:p></span></p><br />
<br />
<p class=MsoListParagraphCxSpMiddle style='text-align:justify;text-indent:-18.0pt;mso-list:l1 level1 lfo2'><![if !supportLists]><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
Oxygen;mso-bidi-font-family:Oxygen;mso-ansi-language:EN-US'><span<br />
style='mso-list:Ignore'>5.<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span></span></span><![endif]><span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'>Remember that some materials are<br />
heat conductors. If you heat something in the Bunsen burner, wait until it<br />
cools down and take it carefully in order to avoid skin burns.<o:p></o:p></span></p><br />
<br />
<p class=MsoListParagraphCxSpMiddle style='text-align:justify;text-indent:-18.0pt;<br />
mso-list:l1 level1 lfo2'><![if !supportLists]><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
Oxygen;mso-bidi-font-family:Oxygen;mso-ansi-language:EN-US'><span<br />
style='mso-list:Ignore'>6.<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span></span></span><![endif]><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-ansi-language:EN-US'>Hazardous materials are never<br />
thrown away in the drainage.<o:p></o:p></span></p><br />
<br />
<p class=MsoListParagraphCxSpMiddle style='text-align:justify;text-indent:-18.0pt;<br />
mso-list:l1 level1 lfo2'><![if !supportLists]><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
Oxygen;mso-bidi-font-family:Oxygen;mso-ansi-language:EN-US'><span<br />
style='mso-list:Ignore'>7.<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span></span></span><![endif]><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-ansi-language:EN-US'>Never… Never add water to an acid.<br />
When preparing a solution like that, the water goes first, followed by the<br />
acid. <o:p></o:p></span></p><br />
<br />
<p class=MsoListParagraphCxSpMiddle style='text-align:justify;text-indent:-18.0pt;mso-list:l1 level1 lfo2'><![if !supportLists]><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
Oxygen;mso-bidi-font-family:Oxygen;mso-ansi-language:EN-US'><span<br />
style='mso-list:Ignore'>8.<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span></span></span><![endif]><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-ansi-language:EN-US'>Whenever you finish a practice<br />
remember to leave your workplace and the material clean and in order.<o:p></o:p></span></p><br />
<br />
<p><b><h2>Design</h2></b></p><br />
<br />
<p>The cards had the following design:</p></br><br />
<br />
<center><p><img width=254 height=354 src="https://static.igem.org/mediawiki/2014hs/6/69/Lab_cardCIDEB.jpg"<br />
align=center hspace=12 alt="IMG_0317"></center></br><br />
<br />
<p><b><h2>Impact</h2></b></p><br />
<br />
<br />
<p>The students showed interest in the cards and it was observed that all of them read the information before the laboratory practice began, that was a good sign because they were able to keep in mind the information given while working. </p><br />
<br />
<p>Since they kept the cards with the information, they became aware that safety was not just for that moment, but for all the future lab practices in their lives.</p><br />
<br />
</td><br />
</tr><br />
</table><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_labsafetycards#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_posters
Team:CIDEB-UANL Mexico/safety posters
2014-06-15T22:44:33Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_safety}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding-left: 3em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Bacteria and Viruses Posters</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<p><b>Objective:</b> To increase student’s curiosity and knowledge about the microscopic world, as well as the transmission and risks that could happen if contagion with different bacteria or viruses occur according to the risk group they belong.</p><br />
<br />
<br />
<table style=width="100%><br />
<tr><br />
<td><br />
<p><b>Description: </b>We consider visual knowledge as one of the most important ways for people to get interested and learn about something. Safety from iGEM CIDEB 2014 decided to design and print 10 different posters measuring 11 inches of length and 17 inches of height with information including risk group, type, medical symptoms if infection occurred, affected organs and transmission of 10 different interesting bacteria or viruses.</p><br />
</td><br />
<td style="padding-left:12px;"><img width=300 height=250 src="https://static.igem.org/mediawiki/2014hs/0/08/Postercideb2014.jpg"/></td><br />
</tr></table><br />
<br />
<p>Each poster included a different bacteria or virus. The organisms described were the following:</p><br />
<br />
<p><img width=203 height=318 src="https://static.igem.org/mediawiki/2014hs/1/13/PosterEColiCIDEB.jpg" align=left hspace=12><br />
<br />
<p>● <i>B. Anthracis</i></p><br />
<br />
<p>● <i>Campylobacter jejuni</i></p><br />
<br />
<p>● <i>Clostridium tetani</i></p><br />
<br />
<p>● <i>Ebola virus</i></p><br />
<br />
<p>● <i>Escherichia coli</i></p><br />
<br />
<p>● <i>HIV</i></p><br />
<br />
<p>● <i>Marburgo virus</i></p><br />
<br />
<p>● <i>Mycobacterium leprae</i></p><br />
<br />
<p>● <i>Mycobacterium tuberculosis</i></p><br />
<br />
<p>● <i>Salmonella</i></p><br />
<br />
</br><br />
<br />
<p>The posters were placed in the main stairs of the entrance of our school, that way we assured most, for not saying all, of the people that entered the building would saw them.</p><br />
<br />
<p><b><h2>Design</h2></b></p> <br />
<br />
<p>You can see all of the posters here:</p><br />
<br />
<div style="width:300px;height:500px;text-align:center;margin:auto;" ><object width="300" height="500" classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://download.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=6,0,40,0"> <param name="flashvars" value="offsite=true&amp;lang=en-us&amp;page_show_url=%2Fphotos%2F125091096%40N05%2Fsets%2F72157645084592055%2Fshow&amp;page_show_back_url=%2Fphotos%2F125091096%40N05%2Fsets%2F72157645084592055%2F&amp;set_id=72157645084592055" /> <param name="allowFullScreen" value="true" /> <param name="src" value="https://www.flickr.com/apps/slideshow/show.swf?v=71649" /> <embed width="300" height="500" type="application/x-shockwave-flash" src="https://www.flickr.com/apps/slideshow/show.swf?v=71649" flashvars="offsite=true&amp;lang=en-us&amp;page_show_url=%2Fphotos%2F125091096%40N05%2Fsets%2F72157645084592055%2Fshow&amp;page_show_back_url=%2Fphotos%2F125091096%40N05%2Fsets%2F72157645084592055%2F&amp;set_id=72157645084592055" allowFullScreen="true" /> </object><br /><small>Created with <a href="http://www.flickrslideshow.com">flickr slideshow</a>.</small></div><br />
<br />
</br><br />
<br />
<center><p><img width=455 height=303 src="https://static.igem.org/mediawiki/2014hs/a/aa/PostersStudentsCIDEB.JPG"<br />
align=center hspace=12 alt="IMG_0317"><p></center><br />
<br />
<img width=30><br />
<br />
<center><p><img width=457 height=305 src="https://static.igem.org/mediawiki/2014hs/6/66/StudentsPostersCIDEB.JPG" align=center<br />
hspace=12 alt="IMG_0326"></p></center><br />
<br />
<p><b><h2> Impact</h2></b></p> <br />
<br />
<p>Since the first day the posters were placed, the team observed that they caught people, teachers and student’s attention. They would stop their walk in order to take a look and read them. We consider this happened because some of the posters contained information that people are interested in for different reasons, like Ebola virus or HIV. Some students and teachers asked different members of the team about the posters, and became interested in what we do at iGEM.</p><br />
<br />
<p>The posters had a great response in the CIDEB community.<p><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/safety_posters#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_race
Team:CIDEB-UANL Mexico/hp race
2014-06-15T21:55:52Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Race for Science</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=290 height=139 src=" https://static.igem.org/mediawiki/2014hs/b/b2/CIDEBHPcarrera1.png"/><br />
</td><br />
<td><br />
<p> As it is said: <i>“Mens sana in corpore sano” </i> (healthy mind in a healthy body), we, as a team, believe that everyone should enjoy a healthy life, in which there is a balance between study and physical activity.</p><br />
<p>So after making the “Explosion”, once people knew what we do in iGEM, we wanted to expand the knowledge and interest of people about our project. That's why we decided to organize this "Carrera por la Ciencia" (Race 4 Science), which included a circuit of about 4 kilometers and at the end a fair with entertaining games related to the project.</p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p> Thus, the event gave us the ability to combine physical exercise with information about our project and synthetic biology, in a way that people could spend time together as a family and learn at the same time.</p><br />
<br><br />
<table width=100%><br />
<tr><br />
<td><br />
<p><b><h2> Objectives</h2></b></p> <br />
<p> The objectives of the race were:</p><br />
<p> • Spreading the project information in both the academic and non-academic community, in a fun, innovating and accessible way</p><br />
<p> • Promoting physical activities that have a beneficial impact on human health and helping cultivate a balance between body and mind</p><br />
<p>This last concept seems particularly important for us, especially in Mexico, where the rates of obesity and sedentary lifestyle are disturbing. </p><br />
<br />
</td><br />
<td style="padding-left:12px;"><img width=288 height=192 src="https://static.igem.org/mediawiki/2014hs/8/8b/CIDEBHPcarrera2.png"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=360 height=174 src="https://static.igem.org/mediawiki/2014hs/0/0a/CIDEBHPcarrera3.png"/><br />
</td><br />
<td><br />
<p> According to an article from University Herald, Mexico is considered as the world's fattest country with a 32.8 percent adult obesity rate, surpassing United States' 31.8 obesity rate, according to a study released, June by the United Nations Food and Agricultural Organization (FAO). About 70 percent of Mexican adults are considered to be overweight.</p><br />
</td><br />
</tr><br />
</table><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p><b><h2> Logistics</h2></b></p> <br />
<p> The race was held within the campus “Mederos” of the UANL. The attendees were summoned at 6:30 am, so that the event could start at 7:00 am. We welcomed about 600 participants, ranging in age from 7 years to third age.</p><br />
<p>The event was promoted through a personal invitation to the people in our high school, and it was suggested to invite their other family members or friends to join them. Posters were also made with all the information about the event; they were pasted in different parts of the school and simultaneously posted digitally on the official page of the iGEM CIDEB team on Facebook. </p><br />
</td><br />
<td style="padding-left:12px;"><img width=400 height=269 src=" https://static.igem.org/mediawiki/2014hs/e/e5/CIDEBHPcarrera4.jpg"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=269 height=179 src="https://static.igem.org/mediawiki/2014hs/0/01/CIDEBHPcarrera5.png"/><br />
</td><br />
<td><br />
<p> At 7:00 am a warm-up session was performed. The session was developed with the help of a professional, who lead a dance for about 30 minutes, replacing conventional exercises by turning it into something fun. The mascot of our team had a very active participation warming-up with the attendees, which contributed to do the exercises correctly and with encouragement. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p> We then proceeded to take the participants to the start area. The first whom started running were the women, 5 minutes later, the men.</p><br />
<p> The start of the route was the main entrance to our school. Then, the road stretched by the campus’ internal streets to the Faculty of Economics, and then the participants resumed their route in the opposite direction of the streets to return to the entrance of the school. </p><br />
</td><br />
<td style="padding-left:12px;"><img width=269 height=179 src="https://static.igem.org/mediawiki/2014hs/5/5c/CIDEBHPcarrera6.png"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=141 height=212 src="https://static.igem.org/mediawiki/2014hs/0/03/CIDEBHPcarrera7.png"/><br />
</td><br />
<td><br />
<p> Along the route, there were people placed on the sidewalk with informational posters about different synthetic biology fun facts, general information about the project, information on the impact that our project would have on society, etc. At the halfway point, several people could be found giving away small bags of water to hydrate the runners. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<br><br />
<p> At the end, the participants returned to the starting point (the front of the school building). In this place, there were different modules with information relevant to our project. Each module included an allusive game to every action of the bacterium (Capture, Union, Resistance and Aroma), this in order that people could learn in an easy and interactive way. Thus, while participants rested, they could observe and receive a brief explanation of our project, and they could play and get vouchers which could be exchanged for prizes.</p><br />
<br />
<br><br />
<center><object width="600" height="450"> <param name="flashvars" value="offsite=true&lang=es-us&page_show_url=%2Fphotos%2F125091096%40N05%2Fsets%2F72157645103124014%2Fshow%2Fwith%2F14394157672%2F&page_show_back_url=%2Fphotos%2F125091096%40N05%2Fsets%2F72157645103124014%2Fwith%2F14394157672%2F&set_id=72157645103124014&jump_to=14394157672"></param> <param name="movie" value="https://www.flickr.com/apps/slideshow/show.swf?v=143270"></param> <param name="allowFullScreen" value="true"></param><embed type="application/x-shockwave-flash" src="https://www.flickr.com/apps/slideshow/show.swf?v=143270" allowFullScreen="true" flashvars="offsite=true&lang=es-us&page_show_url=%2Fphotos%2F125091096%40N05%2Fsets%2F72157645103124014%2Fshow%2Fwith%2F14394157672%2F&page_show_back_url=%2Fphotos%2F125091096%40N05%2Fsets%2F72157645103124014%2Fwith%2F14394157672%2F&set_id=72157645103124014&jump_to=14394157672" width="600" height="450"></embed></object></center><br />
<br><br />
<br />
<table width=100%><br />
<p><b><h2> Impact</h2></b></p> <br />
<td><p> Two weeks before, the students learned from the DNA WEEK what was our project about, so they made comments such as “Hi E.CARU!” to our costume, or “Is this from iGEM?” and “How can I get in?” to our team members. Even in the game time, when looking at it, some of them were able to recognize easily the parts referring to our project. (Each game was created to give a reference about our project, its modules and their function).</p><br />
<p>People, who were not students and hadn’t received those talks, were asking about the iGEM team and the project that we are doing. They asked how does it work, how did we do it, what will it be able to do, and more. They were very interested; even though they did not want to play because they were older, they were paying attention when the younger ones were playing and also to the explanation that the team members gave</p></td><br />
<td style="padding-right:0px;"><img width=400 height=300 src="https://static.igem.org/mediawiki/2014hs/9/9c/CIDEBHPcarrera8.jpg"/></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<br />
<p>The race was a complete success. We had received supportive comments during it, and we realized that people were interested in what we are doing, that they are also having more knowledge about it, and they also had a good time, spending time with their families and friends</p><br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_race
Team:CIDEB-UANL Mexico/hp race
2014-06-15T06:35:25Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Race for Science</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=290 height=139 src=" https://static.igem.org/mediawiki/2014hs/b/b2/CIDEBHPcarrera1.png"/><br />
</td><br />
<td><br />
<p> As it is said: <i>“Mens sana in corpore sano” </i> (healthy mind in a healthy body), we, as a team, believe that everyone should enjoy a healthy life, in which there is a balance between study and physical activity.</p><br />
<p>So after making the “Explosion”, once people knew what we do in iGEM, we wanted to expand the knowledge and interest of people about our project. That's why we decided to organize this "Carrera por la Ciencia" (Race 4 Science), which included a circuit of about 4 kilometers and at the end a fair with entertaining games related to the project.</p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p> Thus, the event gave us the ability to combine physical exercise with information about our project and synthetic biology, in a way that people could spend time together as a family and learn at the same time.</p><br />
<br><br />
<table width=100%><br />
<tr><br />
<td><br />
<p> <b>The objectives of the race were: </b></p><br />
<p> • Spreading the project information in both the academic and non-academic community, in a fun, innovating and accessible way</p><br />
<p> • Promoting physical activities that have a beneficial impact on human health and helping cultivate a balance between body and mind</p><br />
<p>This last concept seems particularly important for us, especially in Mexico, where the rates of obesity and sedentary lifestyle are disturbing. </p><br />
<br />
</td><br />
<td style="padding-left:12px;"><img width=288 height=192 src="https://static.igem.org/mediawiki/2014hs/8/8b/CIDEBHPcarrera2.png"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=360 height=174 src="https://static.igem.org/mediawiki/2014hs/0/0a/CIDEBHPcarrera3.png"/><br />
</td><br />
<td><br />
<p> According to an article from University Herald, Mexico is considered as the world's fattest country with a 32.8 percent adult obesity rate, surpassing United States' 31.8 obesity rate, according to a study released, June by the United Nations Food and Agricultural Organization (FAO). About 70 percent of Mexican adults are considered to be overweight.</p><br />
</td><br />
</tr><br />
</table><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p> <b>Logistics:</b> </p><br />
<p> The race was held within the campus “Mederos” of the UANL. The attendees were summoned at 6:30 am, so that the event could start at 7:00 am. We welcomed about 600 participants, ranging in age from 7 years to third age.</p><br />
<p>The event was promoted through a personal invitation to the people in our high school, and it was suggested to invite their other family members or friends to join them. Posters were also made with all the information about the event; they were pasted in different parts of the school and simultaneously posted digitally on the official page of the iGEM CIDEB team on Facebook. </p><br />
</td><br />
<td style="padding-left:12px;"><img width=400 height=269 src=" https://static.igem.org/mediawiki/2014hs/e/e5/CIDEBHPcarrera4.jpg"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=269 height=179 src="https://static.igem.org/mediawiki/2014hs/0/01/CIDEBHPcarrera5.png"/><br />
</td><br />
<td><br />
<p> At 7:00 am a warm-up session was performed. The session was developed with the help of a professional, who lead a dance for about 30 minutes, replacing conventional exercises by turning it into something fun. The mascot of our team had a very active participation warming-up with the attendees, which contributed to do the exercises correctly and with encouragement. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p> We then proceeded to take the participants to the start area. The first whom started running were the women, 5 minutes later, the men.</p><br />
<p> The start of the route was the main entrance to our school. Then, the road stretched by the campus’ internal streets to the Faculty of Economics, and then the participants resumed their route in the opposite direction of the streets to return to the entrance of the school. </p><br />
</td><br />
<td style="padding-left:12px;"><img width=269 height=179 src="https://static.igem.org/mediawiki/2014hs/5/5c/CIDEBHPcarrera6.png"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=141 height=212 src="https://static.igem.org/mediawiki/2014hs/0/03/CIDEBHPcarrera7.png"/><br />
</td><br />
<td><br />
<p> Along the route, there were people placed on the sidewalk with informational posters about different synthetic biology fun facts, general information about the project, information on the impact that our project would have on society, etc. At the halfway point, several people could be found giving away small bags of water to hydrate the runners. </p><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<p> At the end, the participants returned to the starting point (the front of the school building). In this place, there were different modules with information relevant to our project. Each module included an allusive game to every action of the bacterium (Capture, Union, Resistance and Aroma), this in order that people could learn in an easy and interactive way. Thus, while participants rested, they could observe and receive a brief explanation of our project, and they could play and get vouchers which could be exchanged for prizes.</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p> <p><b>Impact:</b></p><br />
<p> Two weeks before, the students learned from the DNA WEEK what was our project about, so they made comments such as “Hi E.CARU!” to our costume, or “Is this from iGEM?” and “How can I get in?” to our team members. Even in the game time, when looking at it, some of them were able to recognize easily the parts referring to our project. (Each game was created to give a reference about our project, its modules and their function).</p><br />
<p>People, who were not students and hadn’t received those talks, were asking about the iGEM team and the project that we are doing. They asked how does it work, how did we do it, what will it be able to do, and more. They were very interested; even though they did not want to play because they were older, they were paying attention when the younger ones were playing and also to the explanation that the team members gave</p><br />
</td><br />
<td style="padding-left:12px;"><img width=436 height=312 src="https://static.igem.org/mediawiki/2014hs/9/9c/CIDEBHPcarrera8.jpg"/><br />
<br />
<p>The race was a complete success. We had received supportive comments during it, and we realized that people were interested in what we are doing, that they are also having more knowledge about it, and they also had a good time, spending time with their families and friends</p><br />
<br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_race
Team:CIDEB-UANL Mexico/hp race
2014-06-15T05:04:54Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_HP}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Race for Science</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=290 height=139 src=" https://static.igem.org/mediawiki/2014hs/b/b2/CIDEBHPcarrera1.png"/><br />
</td><br />
<td><br />
<p> As it is said: <i>“Mens sana in corpore sano” </i> (healthy mind in a healthy body), we, as a team, believe that everyone should enjoy a healthy life, in which there is a balance between study and physical activity.</p><br />
<p>So after making the “Explosion”, once people knew what we do in iGEM, we wanted to expand the knowledge and interest of people about our project. That's why we decided to organize this "Carrera por la Ciencia" (Race 4 Science), which included a circuit of about 4 kilometers and at the end a fair with entertaining games related to the project.</p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p> Thus, the event gave us the ability to combine physical exercise with information about our project and synthetic biology, in a way that people could spend time together as a family and learn at the same time.</p><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p> <b>The objectives of the race were: </b></p><br />
<p> • Spreading the project information in both the academic and non-academic community, in a fun, innovating and accessible way</p><br />
<p> • Promoting physical activities that have a beneficial impact on human health and helping cultivate a balance between body and mind</p><br />
<p>This last concept seems particularly important for us, especially in Mexico, where the rates of obesity and sedentary lifestyle are disturbing. </p><br />
<br />
</td><br />
<td style="padding-left:12px;"><img width=288 height=192 src="https://static.igem.org/mediawiki/2014hs/8/8b/CIDEBHPcarrera2.png"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<table width=100%><br />
<tr><br />
<td style="padding-left:12px;"><img width=360 height=174 src="https://static.igem.org/mediawiki/2014hs/0/0a/CIDEBHPcarrera3.png"/><br />
</td><br />
<td><br />
<p> According to an article from University Herald, Mexico is considered as the world's fattest country with a 32.8 percent adult obesity rate, surpassing United States' 31.8 obesity rate, according to a study released, June by the United Nations Food and Agricultural Organization (FAO). About 70 percent of Mexican adults are considered to be overweight.</p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p>The event was promoted through a personal invitation to the people in our high school, and it was suggested to invite their other family members or friends to join them. Posters were also made with all the information about the event; they were pasted in different parts of the school and simultaneously posted digitally on the official page of the iGEM CIDEB team on Facebook. </p><br />
<br />
<br />
<br><div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/hp_collaborations#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union
Team:CIDEB-UANL Mexico/project union
2014-06-15T03:54:47Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Union Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<center><iframe width="640" height="390" src="//www.youtube.com/embed/PC6pQ6gfT9A" frameborder="0" allowfullscreen></iframe></center><br />
<br><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p><i>E. coli</i> needs to resist saline environments, UV rays and temperature changes in order to capture Na+ ions, and produce an aroma as a reporter, everything in the water. But after <i>E. coli</i> performs its tasks, it is necessary to remove it from the water in order to obtain usable water; it was easy to do it through a biofilter.</p><br />
<p>We chose silica as the material for our biofilter, so that <i>E. coli</i> expressed a membrane protein which could have the ability for binding silica, and in that way remove <i>E. coli</i> from the water. This was possible for the circuit created by <a href="https://2012hs.igem.org/Team:CIDEB-UANL_Mexico">UANL Mexico 2012</a> team; they created a circuit to make <i>E. coli</i> attached to silica, but as they did not proved it, we want to determine if it really works or not.</p><br />
</td><br />
<td style="padding-left:12px;"><img width=154 height=133 src="https://static.igem.org/mediawiki/2014hs/c/cf/Logo_silica.png"/></td><br />
</tr></table><br />
<br />
<br><p><b>How is the Union module composed?</b></p><br />
<br />
<p>The binding circuit consists mainly in a fusion protein (a set which includes the CDS L2 with its peptide signal and AIDA) in order to make the protein for binding silica, a membrane protein. In that way <i>E. coli</i> would attach to silica.</p><br />
<br />
<center><p><img width=463 height=101 src="https://static.igem.org/mediawiki/2014hs/9/92/Composicion_silica.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<center><p><b>Figure 1.</b> Union circuit</p></center><br />
<br />
<br><p><b>How does L2 and AIDA act together?</b></p><br />
<br />
<p>The gene L2 encodes for a protein able to attach to silica. Taniguchi et al. reported in 2007 that the L2 ribosomal protein from <i>E. coli</i> strongly adsorbs to silica surfaces, up to 200 times tighter than poliarginine tags commonly used for protein purification. In their work, Taniguchiet al. 2007, constructed a fusion protein of L2 and green fluorescent protein (GFP) which adsorbed to a silica surface even after washing for 24 hours with a buffer containing 1 M NaCl (<b>Figure 2</b>). <a href="https://2012hs.igem.org/Team:CIDEB-UANL_Mexico">UANL Mexico 2012</a> did not have this piece in stock, so we decided to synthetize L2.</p><br />
<br />
<center><p><img width=237 height=140 src="https://static.igem.org/mediawiki/2014hs/0/05/Silica_washed.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 2.</b> Proteins absorbed to a silica slide and washed for 24 hours a)GFP b) L2-GFP fusion c) R9-GFP fusion. Taken from Taniguchi (2007)</p></center><br />
<br><br />
<p>AIDA-I is an <i>E. coli</i> membrane protein with a passenger domain of 76 kDa exposed to the extracellular space and a transmembrane beta-barrel domain of 45 kDa; the latter has been used to express functional proteins in the cell-membrane of up to 65 kDa (van Bloois et al., 2011). Furthermore passengers coupled to AIDA-I have been reported to reach an expression level of more than 100,000 copies per cell in the outer membrane (Jose and Meyer, 2007). AIDA-1 allows the expression of proteins larger than small peptides in the outer membrane what makes it the best option to use with L2. AIDA-I was obtained by PCR for <a href="https://2012hs.igem.org/Team:CIDEB-UANL_Mexico">UANL Mexico 2012</a>, so we use their piece for our project.</p><br />
<br />
<center><p><img width=226 height=251 src="https://static.igem.org/mediawiki/2014hs/a/a2/Aida_system.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 3.</b> Schematic representation of AIDA-I carrier protein</p></center><br />
<br />
<br><p><b>How important to use BgIII and BamHI to link L2 and AIDA-I?</b></p><br />
<br />
<p>As we need to join both proteins in order to make a fusion protein we cannot use SpeI and XbaI to join them because the reading frame would change making a completely different protein. So in order to avoid such problem we use BgIII and BamHI instead which can join AIDA and L2 without changing the reading frame. The scar produced between BamHI and BgIII, as is shown in the figure 2, is formed by six bases respecting the reading frame from both proteins in order to synthetize the correct protein.</p><br><br />
<br />
<center><p><img width=397 height=222 src="https://static.igem.org/mediawiki/2014hs/b/b5/Bg_y_bam_III.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 4.</b> Example of a ligation using BamHI and BgIII</p></center><br />
<br />
<p><b>How to know if <i>E.coli</i> binds to silica?</b></p><br />
<br />
<p>We will use a silica biofilter to remove <i>E. coli</i> from water, but in order to observe if really <i>E. coli</i> would attach to it we wanted to use a Wintergreen aroma as reporter. This would lead us know if the bacteria are in the biofilter by adding salicylic acid and changing the temperature; but as we will test this module alone we needed to design a new way to observe if L2+AIDA works. We decided to transform <i>E. coli</i> with two plasmids, one with RFP and the other containing the fusion protein (<b>figure 6</b>); if the biofilter becomes red it would mean <i>E. coli</i> is attached to it.</p><br />
<br />
<center><p><img width=401 height=243 src="https://static.igem.org/mediawiki/2014hs/c/c3/E.COLI_RFP.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 5.</b> <i>E. coli</i> containing the fusion (L2+AIDA) and RFP proteins</p></center><br />
<br />
<br><p><b>How to create a biofilter?</b></p><br />
<br />
<p>Although <i>E. coli</i> could acquire the ability for binding silica, we need to create a biofilter to remove bacteria from water. Our proposal as biofilter is shown in the next figure:</p><br />
<br />
<center><p><img width=236 height=346 src="https://static.igem.org/mediawiki/2014hs/e/e2/Biofiltro.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
<center><p><b>Figure 6.</b> Our proposed biofilter model</p></center> <br />
<br />
<p><b>Parts of the module</b></p><br><br />
<br />
<center><div><br />
<table border=0 cellspacing=0<br />
cellpadding=0 width=700 style='width:441.4pt;margin-left:25.5pt;border-collapse:<br />
collapse;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh:<br />
.5pt solid windowtext;mso-border-insidev:.5pt solid windowtext'><br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes'><br />
<td width=120 valign=top style='width:89.95pt;border:none;border-bottom:solid #AE78D6 1.0pt;<br />
mso-border-bottom-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:517'><b style='mso-bidi-font-weight:<br />
normal'><span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;<br />
mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font:major-fareast;<br />
mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font:major-bidi;<br />
mso-bidi-font-style:italic'>IMAGE<o:p></o:p></span></b></p><br />
</td><br />
<td width=122 valign=top style='width:91.85pt;border:none;border-bottom:solid #934BC9 1.0pt;<br />
mso-border-bottom-alt:solid #934BC9 .5pt;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:1'><b style='mso-bidi-font-weight:<br />
normal'><span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;<br />
mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font:major-fareast;<br />
mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font:major-bidi;<br />
mso-bidi-font-style:italic'>CODE<o:p></o:p></span></b></p><br />
</td><br />
<td width=346 valign=top style='width:259.6pt;border:none;border-bottom:solid #AE78D6 1.0pt;<br />
mso-border-bottom-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal;tab-stops:85.15pt center 130.35pt;mso-yfti-cnfc:1'><b<br />
style='mso-bidi-font-weight:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font:<br />
major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font:<br />
major-bidi;mso-bidi-font-style:italic'><span style='mso-tab-count:2'> </span>DESCRIPTION<o:p></o:p></span></b></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:0'><br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt;<br />
mso-border-top-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #AE78D6 .5pt;<br />
mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape<br />
id="_x0000_s1062" type="#_x0000_t75" style='position:absolute;left:0;<br />
text-align:left;margin-left:11.6pt;margin-top:3.55pt;width:54.05pt;height:41.3pt;<br />
z-index:251671552;mso-position-horizontal-relative:text;<br />
mso-position-vertical-relative:text;mso-width-relative:page;<br />
mso-height-relative:page'><br />
<v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image013.png"<br />
o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush"<br />
ShapeID="_x0000_s1062" DrawAspect="Content" ObjectID="_1464162125"><br />
</o:OLEObject><br />
<![endif]><![endif]--><![if !vml]><img width=72 height=55<br />
src="https://static.igem.org/mediawiki/2014hs/e/e0/PromoterCIDEB.jpg" align=left<br />
hspace=12 v:shapes="_x0000_s1062"><![endif]><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-fareast-theme-font:major-fareast;mso-bidi-font-family:"Times New Roman";<br />
mso-bidi-theme-font:major-bidi;mso-ansi-language:EN-US;mso-bidi-font-style:<br />
italic'><o:p></o:p></span></p></td><br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left:<br />
none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt;<br />
mso-border-top-alt:solid #934BC9 .5pt;mso-border-left-alt:solid #AE78D6 .5pt;<br />
mso-border-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #934BC9 .5pt;<br />
background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_J23119">BBa_J23119</a></span><span<br />
style='font-size:7.0pt;mso-bidi-font-size:12.0pt;font-family:Oxygen;<br />
color:red;mso-ansi-language:EN-US'> </span></p><br />
</td><br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left:<br />
none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt;<br />
mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt;<br />
mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal;mso-yfti-cnfc:64'><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen'>The J23119 is the most effective<br />
and common constitutive promoter used. It has a length of 35bp.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:1'><br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt;<br />
mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape<br />
id="Picture_x0020_11" o:spid="_x0000_s1067" type="#_x0000_t75" style='position:absolute;<br />
left:0;text-align:left;margin-left:12.55pt;margin-top:1.55pt;width:52.6pt;<br />
height:49.9pt;z-index:251669504;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image015.png"<br />
o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=70 height=67<br />
src="https://static.igem.org/mediawiki/2014hs/3/30/CDSCIDEB.jpg" align=left<br />
hspace=12 v:shapes="Picture_x0020_11"><![endif]></p></td><br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left:<br />
none;border-bottom:solid #934BC9 1.0pt;border-right:solid #AE78D6 1.0pt;<br />
mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt;<br />
mso-border-alt:solid #AE78D6 .5pt;mso-border-bottom-alt:solid #934BC9 .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa%C2%AD_B0034">BBa_B0034</a></span></p><br />
</td><br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left:<br />
none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt;<br />
mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt;<br />
mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
font-family:Oxygen'>This specific RBS is based on Elowitz repressilator. It<br />
has a length of 12bp.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:2'><br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt;<br />
mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape<br />
id="_x0000_s1063" type="#_x0000_t75" style='position:absolute;left:0;<br />
text-align:left;margin-left:8.4pt;margin-top:2.55pt;width:52.8pt;height:39.05pt;<br />
z-index:251673600;mso-position-horizontal-relative:text;<br />
mso-position-vertical-relative:text;mso-width-relative:page;<br />
mso-height-relative:page'><br />
<v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image017.png"<br />
o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush"<br />
ShapeID="_x0000_s1063" DrawAspect="Content" ObjectID="_1464162126"><br />
</o:OLEObject><br />
<![endif]><![endif]--><![if !vml]><img width=70 height=52<br />
src="https://static.igem.org/mediawiki/2014hs/5/54/CDS2CIDEB.jpg" align=left<br />
hspace=12 v:shapes="_x0000_s1063"><![endif]></p><br />
</td><br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left:<br />
none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt;<br />
mso-border-top-alt:solid #934BC9 .5pt;mso-border-left-alt:solid #AE78D6 .5pt;<br />
mso-border-alt:solid #AE78D6 .5pt;mso-border-top-alt:solid #934BC9 .5pt;<br />
background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888000">BBa_K888000</a></span></p><br />
</td><br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left:<br />
none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt;<br />
mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt;<br />
mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-ansi-language:EN-US'>L2. This CDS gives the property<br />
for binding silica and glass surfaces to <i>E. coli</i>, it has a length of 819 bp.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:3'><br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt;<br />
mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape<br />
id="_x0000_s1064" type="#_x0000_t75" style='position:absolute;left:0;<br />
text-align:left;margin-left:8.65pt;margin-top:2.15pt;width:52.55pt;height:40.65pt;<br />
z-index:251675648;mso-position-horizontal-relative:text;<br />
mso-position-vertical-relative:text;mso-width-relative:page;<br />
mso-height-relative:page'><br />
<v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image019.png"<br />
o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush"<br />
ShapeID="_x0000_s1064" DrawAspect="Content" ObjectID="_1464162127"><br />
</o:OLEObject><br />
<![endif]><![endif]--><![if !vml]><img width=70 height=54<br />
src="https://static.igem.org/mediawiki/2014hs/f/f2/CDS3CIDEB.jpg" align=left<br />
hspace=12 v:shapes="_x0000_s1064"><i><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-fareast-theme-font:major-fareast;mso-bidi-font-family:"Times New Roman";<br />
mso-bidi-theme-font:major-bidi;mso-ansi-language:EN-US'><br />
<o:p></o:p></span></i></p><br />
</td><br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left:<br />
none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt;<br />
mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt;<br />
mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888001">BBa_K888001 </a></span></p><br />
</td><br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left:<br />
none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt;<br />
mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt;<br />
mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
font-family:Oxygen'>AIDA-I is synthetized as a 132 kDa pre-protein featuring<br />
a signal peptide which is cleaved during transport trough the inner membrane,<br />
a 78 kDa adhesin (passenger) domain, and a 45 kDa translocator. This<br />
autotransporter has a large capability in translocating relatively large<br />
passengers from 12-65 kDa by showing a N-terminal type of fusion. Coupled with<br />
a passenger domain and a signal peptide (<a href="http://parts.igem.org/Part:BBa_K888005">K888005</a>), it is possible to express<br />
functional proteins in the outer membrane of <i>E. coli</i>.<span<br />
style='mso-spacerun:yes'> </span>It has a length of 1482 bp.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:4;height:122.1pt'><br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt;<br />
mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:122.1pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'>&nbsp;</p><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape<br />
id="_x0000_s1065" type="#_x0000_t75" style='position:absolute;left:0;<br />
text-align:left;margin-left:9.8pt;margin-top:3.6pt;width:50.05pt;height:38.05pt;<br />
z-index:251677696;mso-position-horizontal-relative:text;<br />
mso-position-vertical-relative:text;mso-width-relative:page;<br />
mso-height-relative:page'><br />
<v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image021.png"<br />
o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush"<br />
ShapeID="_x0000_s1065" DrawAspect="Content" ObjectID="_1464162128"><br />
</o:OLEObject><br />
<![endif]><![endif]--><![if !vml]><img width=67 height=51<br />
src="https://static.igem.org/mediawiki/2014hs/d/d5/CIDEBCDS5.jpg" align=left<br />
hspace=12 v:shapes="_x0000_s1065"><![endif]><i><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font:<br />
major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font:<br />
major-bidi;mso-ansi-language:EN-US'><o:p></o:p></span></i></p><br />
</td><br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left:<br />
none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt;<br />
mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt;<br />
mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:122.1pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_K888005">BBa_K888005</a><br />
</span></p><br />
</td><br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left:<br />
none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt;<br />
mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt;<br />
mso-border-alt:solid #AE78D6 .5pt;background:#F3DEFC;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:122.1pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal;mso-yfti-cnfc:64'><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen'>When this part is coupled with a<br />
passenger attached to AIDA-I translocator domain (<a href="http://parts.igem.org/Part:BBa_K888005">K888001</a>), it is possible to<br />
express functional proteins in the outer membrane of <i>E. coli</i>. The signal<br />
peptide is naturally cleaved during transport trough the inner membrane (Li<br />
et al. 2007; van Bloois et al. 2011).It has a length of 147 bp.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:5;mso-yfti-lastrow:yes;height:51.65pt'><br />
<td width=120 valign=top style='width:89.95pt;border:none;border-right:solid #AE78D6 1.0pt;<br />
mso-border-right-alt:solid #AE78D6 .5pt;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape<br />
id="_x0000_s1066" type="#_x0000_t75" style='position:absolute;left:0;<br />
text-align:left;margin-left:17.8pt;margin-top:3.2pt;width:32.25pt;height:44.6pt;<br />
z-index:251679744;mso-position-horizontal-relative:text;<br />
mso-position-vertical-relative:text;mso-width-relative:page;<br />
mso-height-relative:page'><br />
<v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image023.png"<br />
o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush"<br />
ShapeID="_x0000_s1066" DrawAspect="Content" ObjectID="_1464162130"><br />
</o:OLEObject><br />
<![endif]><![endif]--><![if !vml]><img width=43 height=59<br />
src="https://static.igem.org/mediawiki/2014hs/d/d7/STOP.jpg" align=left<br />
hspace=12 v:shapes="_x0000_s1066"><![endif]><i><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-fareast-theme-font:<br />
major-fareast;mso-bidi-font-family:"Times New Roman";mso-bidi-theme-font:<br />
major-bidi;mso-ansi-language:EN-US'><br />
<o:p></o:p></span></i></p><br />
</td><br />
<td width=122 valign=top style='width:91.85pt;border-top:none;border-left:<br />
none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt;<br />
mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt;<br />
mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:_BBa_B1002">BBa_B1002</a></span></p><br />
</td><br />
<td width=346 valign=top style='width:259.6pt;border-top:none;border-left:<br />
none;border-bottom:solid #AE78D6 1.0pt;border-right:solid #AE78D6 1.0pt;<br />
mso-border-top-alt:solid #AE78D6 .5pt;mso-border-left-alt:solid #AE78D6 .5pt;<br />
mso-border-alt:solid #AE78D6 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:51.65pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal'><span style='font-size:12.0pt;font-family:Oxygen;<br />
mso-ansi-language:EN-US'>Part made of 6bp, responsible for stopping<br />
transcription.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
</div></center><br />
<br />
<br><p><b>Other teams that used it:</b></p><br />
<br />
<p><b><a href="https://2012hs.igem.org/Team:CIDEB-UANL_Mexico">UANL México 2012</a>:</b> They proposed the fusion protein for using it to binding silica after detect and capture arsenic acid in groundwater, and in that way removed the pollutant arsenic acid from the water, as part of water bioremediation, but they did not finish it. That is why we want to determine if it will work.</p><br />
<br />
<br><p><b>Bibliography</b></p><br />
<br />
<font size="2"><br />
<p>● Antiquity. (2003). <i>Part:BBa_B0034</i>. Retrieved March 30th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034">http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034</a>.</p><br />
<p>● iGEM2006_Berkeley. (2006). <i>Part:BBa_J23119</i>. Retrieved April 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119">http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119</a>.</p><br />
<p>● iGEM12_UANL_Mty-Mexico. (2012). <i>Part BBa_K888000</i>. Retrieved March 29th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888000">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888000</a>.</p> <br />
<p>● iGEM12_UANL_Mty-Mexico. (2012). <i>Part BBa_K888001</i>. Retrieved March 29th, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888001">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888001</a>.</p> <br />
<p>● iGEM12_UANL_Mty-Mexico. (2012) <i>Part BBa_K888005</i>. Retrieved March 29th,2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K888005">http://parts.igem.org/wiki/index.php?title=Part:BBa_K888005</a>.</p> <br />
<p>● UANL Mexico. (2012). <i>Recovery module</i>. Retrieved March 28th,2014, from <a href="https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery">https://2012.igem.org/Team:UANL_Mty-Mexico/Project/recovery</a>.</p> </p><br />
</font><br />
<br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance
Team:CIDEB-UANL Mexico/project resistance
2014-06-15T03:50:29Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Resistance Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<br />
<p>Because our project is a biofilter which allows to remove salt from water, the bacteria needs to survive to extreme environmental conditions which normally it can’t do. We need <i>E. Coli</i> to survive a high salinity environment to allow it to capture sodium ions and to remove the salt concentration of the water.</p><p>In order to accomplish our project goal, we have to change <i>E. Coli</i> metabolism and make it stronger, more resistant and more efficient than in normal <i>E.coli</i> bacteria.</p><br />
</td><br />
<td style="padding-left:12px;"><img width=131 height=127 src="https://static.igem.org/mediawiki/2014hs/8/8e/BeutifulResistance.jpg"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<p>Last discoveries show irrE as a protein capable of change the <i>E. Coli</i> metabolism, and giving it the ability to survive to bigger temperatures, bigger UV rays radiation and bigger salt concentration (UCL, 2012).</p><br />
<br />
<br><p><b>What does irrE do?</b></p><br />
<br />
<p>The protein irrE originates from <i>Deinococcusradiodurans</i>, and initially, this gene provides resistance to radiation. But when transformed in <i>E. Coli</i>, it protects it against salt, oxidative and thermal shock. (UCL, 2012) Also, different experiments from different iGEM teams, support the idea of the bigger salt resistance in <i>E. Coli</i> with this biobrick. </p><br />
<br />
<center><p><img width=564 height=350 src="https://static.igem.org/mediawiki/2014hs/3/3e/Grafica_1_cideb2014.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 1.</b> This graph done by <a herf="https://2012.igem.org/Team:University_College_London">UCL iGEM 2012</a>, shows how irrE biobrick increased the salt concentration resistance in <i>E. Coli</i> compared with the results from <a href="https://2010.igem.org/Team:TU_Delft">Tu Delf iGEM 2010</a>.</p></center><br />
<br />
<br><p><b>How it works?</b></p><br />
<br />
<p>irrE has been demonstrated to up regulate transcription of recA and pprA - genes which encode Recombines A and Radiation Inducible Protein. With respect to salt tolerance, irrE up regulates the production of several stress responsive proteins, protein kinases, metabolic proteins, and detoxification proteins. It also down regulates glycerol degradation. With this global regulatory effect, <i>E. Coli</i> becomes more salt tolerant (UCL, 2012).</p><br />
<br />
<center><p><img width=429 height=322 src="https://static.igem.org/mediawiki/2014hs/9/9b/Imagen1cideb2014.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 2.</b> This diagram shows the effect of irrE protein on <i>E. Coli</i> metabolism. </p></center><br />
<br />
<br><p><b>Other teams that used it:</b></p><br />
<br />
<p><b><a href="https://2012.igem.org/Team:University_College_London">UCL 2012</a>:</b> They propose to confer salt tolerance on <i>E. Coli</i> by linking the salt tolerance gene encoding the protein irrE (<a href="http://parts.igem.org/Part:BBa_K729001">BBa_K729001</a>) to a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>). </p><br />
<br />
<center><p><img width=661 height=139 src="https://static.igem.org/mediawiki/2014hs/3/33/Gen1cideb2014.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 3.</b> Part designed by <a href="https://2012.igem.org/Team:University_College_London">UCL 2012</a> for the irrE protein.</p></center><br />
<br />
<br><p><b>irrE's parts description :</b></p><br><br />
<br />
<center><div><br />
<table class=MsoTable15Grid7ColorfulAccent6 border=1 cellspacing=0<br />
cellpadding=0 width=631 style='width:473.0pt;border-collapse:collapse;<br />
border:none;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt'><br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes;<br />
height:15.75pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border:none;border-bottom:<br />
solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint:<br />
153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:517'><b><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX;mso-bidi-font-style:<br />
italic'>IMAGE</span></b><b style='mso-bidi-font-weight:normal'><span<br />
lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
"Times New Roman";mso-bidi-font-family:"Times New Roman";mso-fareast-language:<br />
ES-MX;mso-bidi-font-style:italic'><o:p></o:p></span></b></p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border:none;border-bottom:<br />
solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint:<br />
153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>CODE</span></b><b<br />
style='mso-bidi-font-weight:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></b></p><br />
</td><br />
<td width=400 nowrap valign=top style='width:300.0pt;border:none;border-bottom:<br />
solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint:<br />
153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>DESCRIPTION</span></b><b<br />
style='mso-bidi-font-weight:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></b></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:0;height:60.75pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border:none;border-right:<br />
solid #FABF8F 1.0pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:60.75pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shapetype<br />
id="_x0000_t75" coordsize="21600,21600" o:spt="75" o:preferrelative="t"<br />
path="m@4@5l@4@11@9@11@9@5xe" filled="f" stroked="f"><br />
<v:stroke joinstyle="miter"/><br />
<v:formulas><br />
<v:f eqn="if lineDrawn pixelLineWidth 0"/><br />
<v:f eqn="sum @0 1 0"/><br />
<v:f eqn="sum 0 0 @1"/><br />
<v:f eqn="prod @2 1 2"/><br />
<v:f eqn="prod @3 21600 pixelWidth"/><br />
<v:f eqn="prod @3 21600 pixelHeight"/><br />
<v:f eqn="sum @0 0 1"/><br />
<v:f eqn="prod @6 1 2"/><br />
<v:f eqn="prod @7 21600 pixelWidth"/><br />
<v:f eqn="sum @8 21600 0"/><br />
<v:f eqn="prod @7 21600 pixelHeight"/><br />
<v:f eqn="sum @10 21600 0"/><br />
</v:formulas><br />
<v:path o:extrusionok="f" gradientshapeok="t" o:connecttype="rect"/><br />
<o:lock v:ext="edit" aspectratio="t"/><br />
</v:shapetype><v:shape id="_x0031__x0020_Imagen" o:spid="_x0000_s1033"<br />
type="#_x0000_t75" style='position:absolute;left:0;text-align:left;<br />
margin-left:15.9pt;margin-top:9.9pt;width:61.45pt;height:48.6pt;z-index:251649536;<br />
visibility:visible;mso-wrap-style:square;mso-width-percent:0;<br />
mso-height-percent:0;mso-wrap-distance-left:9pt;mso-wrap-distance-top:0;<br />
mso-wrap-distance-right:9pt;mso-wrap-distance-bottom:0;<br />
mso-position-horizontal:absolute;mso-position-horizontal-relative:text;<br />
mso-position-vertical:absolute;mso-position-vertical-relative:text;<br />
mso-width-percent:0;mso-height-percent:0;mso-width-relative:page;<br />
mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image001.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=82 height=65<br />
src="https://static.igem.org/mediawiki/2014hs/6/62/Promotor.png" align=left hspace=12<br />
v:shapes="_x0031__x0020_Imagen"><![endif]><i><span lang=ES-MX<br />
style='font-family:Oxygen;color:#E36C0A;mso-themecolor:accent6;mso-themeshade:<br />
191;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'>&nbsp;</p></td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;<br />
mso-border-right-themecolor:accent6;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt;<br />
mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt:<br />
solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153;<br />
background:#FDE9D9;mso-background-themecolor:accent6;mso-background-themetint:<br />
51;padding:0cm 5.4pt 0cm 5.4pt;height:60.75pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p><br />
</td><br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left:<br />
none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;<br />
mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint:<br />
153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;background:#FDE9D9;mso-background-themecolor:accent6;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:60.75pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
Arial;color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>In<br />
the specific case of our bacteria, it helps to continuously transcribing the <span<br />
class=SpellE>irrE</span> gene in order to make bacteria resist high<br />
concentration of salt. </span><span class=SpellE><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:#282828;mso-fareast-language:ES-MX'>This</span></span><span<br />
lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
"Times New Roman";mso-bidi-font-family:Arial;color:#282828;mso-fareast-language:<br />
ES-MX'> <span class=SpellE>promoter</span> has a <span class=SpellE>length</span><br />
of 35 <span class=SpellE>pb</span>(Anderson, 2006).<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:1;height:75.0pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:75.0pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape<br />
id="_x0032__x0020_Imagen" o:spid="_x0000_s1032" type="#_x0000_t75" style='position:absolute;<br />
left:0;text-align:left;margin-left:23.1pt;margin-top:6.95pt;width:54.25pt;<br />
height:49.45pt;z-index:251651584;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image003.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=72 height=66<br />
src="https://static.igem.org/mediawiki/2014hs/5/5d/Cds.png" align=left hspace=12<br />
v:shapes="_x0032__x0020_Imagen"><![endif]><i><span style='font-family:Oxygen;<br />
color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191;mso-ansi-language:<br />
EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'>&nbsp;</p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;<br />
mso-border-right-themecolor:accent6;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt;<br />
mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt:<br />
solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153;<br />
padding:0cm 5.4pt 0cm 5.4pt;height:75.0pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-ansi-language:EN-US;mso-fareast-language:<br />
ES-MX'><a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'>&nbsp;</p><br />
</td><br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left:<br />
none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;<br />
mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint:<br />
153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:75.0pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal'><span style='font-size:12.0pt;font-family:Oxygen;<br />
mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial;<br />
color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>This<br />
specific is <span class=SpellE>RBS</span> based on <span class=SpellE>Elowitz</span><br />
<span class=SpellE>repressilator</span>. It is very common to see in many <span<br />
class=SpellE>iGEM</span> projects.<span style='mso-spacerun:yes'> </span>It<br />
has a length of 12 <span class=SpellE>pb </span>(Mahajan, <span<br />
class=SpellE>Marinescu</span>, Chow, <span class=SpellE>Wissner</span>-Gross,<br />
&amp; Carr, 2003).<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:2;height:90.35pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:90.35pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape<br />
id="_x0033__x0020_Imagen" o:spid="_x0000_s1031" type="#_x0000_t75" style='position:absolute;<br />
left:0;text-align:left;margin-left:23.4pt;margin-top:10pt;width:57pt;<br />
height:48pt;z-index:251654656;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image005.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=76 height=64<br />
src="https://static.igem.org/mediawiki/2014hs/9/97/IrrEResistance.png" align=left hspace=12<br />
v:shapes="_x0033__x0020_Imagen"><![endif]></p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;<br />
mso-border-right-themecolor:accent6;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt;<br />
mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt:<br />
solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153;<br />
background:#FDE9D9;mso-background-themecolor:accent6;mso-background-themetint:<br />
51;padding:0cm 5.4pt 0cm 5.4pt;height:90.35pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-ansi-language:EN-US;<br />
mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K729001">BBa_K729001</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span<br />
style='font-size:3.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-ansi-language:EN-US;<br />
mso-fareast-language:ES-MX'><o:p></o:p></span></p><br />
</td><br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left:<br />
none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;<br />
mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint:<br />
153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;background:#FDE9D9;mso-background-themecolor:accent6;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:90.35pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
Arial;color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>Gene<br />
that produces <span class=SpellE>irrE</span>, a substance that changes the<br />
bacteria’s metabolism and allows bacteria to survive to extreme conditions,<br />
some examples could be high UV rays exposition, or high salt concentration<br />
levels in an aquatic environment, oxidative or thermal shock.<span<br />
style='mso-spacerun:yes'> </span>It has a length of 933pb (<span<br />
class=SpellE>Sohrabi</span>, 2012).<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes;height:62.25pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:62.25pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape<br />
id="_x0034__x0020_Imagen" o:spid="_x0000_s1030" type="#_x0000_t75" style='position:absolute;<br />
left:0;text-align:left;margin-left:22.6pt;margin-top:5.5pt;width:54.75pt;<br />
height:52.5pt;z-index:251657728;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image006.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=73 height=70<br />
src="https://static.igem.org/mediawiki/2014hs/5/55/TerminatorResistance.png" align=left hspace=12<br />
v:shapes="_x0034__x0020_Imagen"><![endif]><i><span style='font-family:Oxygen;<br />
color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191;mso-ansi-language:<br />
EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i><i><span<br />
lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
"Times New Roman";mso-bidi-font-family:"Times New Roman";color:black;<br />
mso-fareast-language:ES-MX'> <br />
<o:p></o:p><br />
</span></i></p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;<br />
mso-border-right-themecolor:accent6;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt;<br />
mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt:<br />
solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153;<br />
padding:0cm 5.4pt 0cm 5.4pt;height:62.25pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'>&nbsp;</p></td><br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left:<br />
none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;<br />
mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint:<br />
153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:62.25pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal'><span style='font-size:12.0pt;font-family:Oxygen;<br />
mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:"Times New Roman";<br />
color:black;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>Part made of<br />
6pb responsible for transcription stop (Huang, 206).<o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
</div></center><br />
<br />
<br><p><b>Bibliography</b></p><br />
<br />
<font size="2"><br />
<p>● Antiquity 2013. (2013, January 31). <i>Part:BBa_B0034</i>. Retrieved from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034">http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034</a>.</p><br />
<p>● Huang, H. (2006, August 30). <i>Part:BBa_B1002</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002">http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002</a>.</p><br />
<p>● iGEM2006_Berkeley. (2006, August 24). <i>Part:BBa_J23119</i>. Retrieved April 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119">http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119</a>.</p><br />
<p>● Sohrabi, B. (2012, June 27). <i>Part:BBa_K729001</i>. Retrieved from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K729001">http://parts.igem.org/wiki/index.php?title=Part:BBa_K729001</a>.</p><br />
<p>● UCLiGEM Team. (2012). <i>IRRE module</i>. Retrieved March 31, 2014. from <a href="https://2012.igem.org/Team:University_College_London/Module_5">https://2012.igem.org/Team:University_College_London/Module_5</a>.</p><br />
</font><br />
<br />
<br><br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance
Team:CIDEB-UANL Mexico/project resistance
2014-06-15T03:48:39Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Resistance Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<br />
<p>Because our project is a biofilter which allows to remove salt from water, the bacteria needs to survive to extreme environmental conditions which normally it can’t do. We need <i>E. Coli</i> to survive a high salinity environment to allow it to capture sodium ions and to remove the salt concentration of the water.</p><br />
</td><br />
<td style="padding-left:12px;"><img width=131 height=127 src="https://static.igem.org/mediawiki/2014hs/8/8e/BeutifulResistance.jpg"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<p>In order to accomplish our project goal, we have to change <i>E. Coli</i> metabolism and make it stronger, more resistant and more efficient than in normal <i>E.coli</i> bacteria.</p><br />
<br />
<p>Last discoveries show irrE as a protein capable of change the <i>E. Coli</i> metabolism, and giving it the ability to survive to bigger temperatures, bigger UV rays radiation and bigger salt concentration (UCL, 2012).</p><br />
<br />
<br><p><b>What does irrE do?</b></p><br />
<br />
<p>The protein irrE originates from <i>Deinococcusradiodurans</i>, and initially, this gene provides resistance to radiation. But when transformed in <i>E. Coli</i>, it protects it against salt, oxidative and thermal shock. (UCL, 2012) Also, different experiments from different iGEM teams, support the idea of the bigger salt resistance in <i>E. Coli</i> with this biobrick. </p><br />
<br />
<center><p><img width=564 height=350 src="https://static.igem.org/mediawiki/2014hs/3/3e/Grafica_1_cideb2014.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 1.</b> This graph done by <a herf="https://2012.igem.org/Team:University_College_London">UCL iGEM 2012</a>, shows how irrE biobrick increased the salt concentration resistance in <i>E. Coli</i> compared with the results from <a href="https://2010.igem.org/Team:TU_Delft">Tu Delf iGEM 2010</a>.</p></center><br />
<br />
<br><p><b>How it works?</b></p><br />
<br />
<p>irrE has been demonstrated to up regulate transcription of recA and pprA - genes which encode Recombines A and Radiation Inducible Protein. With respect to salt tolerance, irrE up regulates the production of several stress responsive proteins, protein kinases, metabolic proteins, and detoxification proteins. It also down regulates glycerol degradation. With this global regulatory effect, <i>E. Coli</i> becomes more salt tolerant (UCL, 2012).</p><br />
<br />
<center><p><img width=429 height=322 src="https://static.igem.org/mediawiki/2014hs/9/9b/Imagen1cideb2014.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 2.</b> This diagram shows the effect of irrE protein on <i>E. Coli</i> metabolism. </p></center><br />
<br />
<br><p><b>Other teams that used it:</b></p><br />
<br />
<p><b><a href="https://2012.igem.org/Team:University_College_London">UCL 2012</a>:</b> They propose to confer salt tolerance on <i>E. Coli</i> by linking the salt tolerance gene encoding the protein irrE (<a href="http://parts.igem.org/Part:BBa_K729001">BBa_K729001</a>) to a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a>). </p><br />
<br />
<center><p><img width=661 height=139 src="https://static.igem.org/mediawiki/2014hs/3/33/Gen1cideb2014.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 3.</b> Part designed by <a href="https://2012.igem.org/Team:University_College_London">UCL 2012</a> for the irrE protein.</p></center><br />
<br />
<br><p><b>irrE's parts description :</b></p><br><br />
<br />
<center><div><br />
<table class=MsoTable15Grid7ColorfulAccent6 border=1 cellspacing=0<br />
cellpadding=0 width=631 style='width:473.0pt;border-collapse:collapse;<br />
border:none;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt'><br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes;<br />
height:15.75pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border:none;border-bottom:<br />
solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint:<br />
153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:517'><b><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX;mso-bidi-font-style:<br />
italic'>IMAGE</span></b><b style='mso-bidi-font-weight:normal'><span<br />
lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
"Times New Roman";mso-bidi-font-family:"Times New Roman";mso-fareast-language:<br />
ES-MX;mso-bidi-font-style:italic'><o:p></o:p></span></b></p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border:none;border-bottom:<br />
solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint:<br />
153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>CODE</span></b><b<br />
style='mso-bidi-font-weight:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></b></p><br />
</td><br />
<td width=400 nowrap valign=top style='width:300.0pt;border:none;border-bottom:<br />
solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint:<br />
153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>DESCRIPTION</span></b><b<br />
style='mso-bidi-font-weight:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></b></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:0;height:60.75pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border:none;border-right:<br />
solid #FABF8F 1.0pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:60.75pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shapetype<br />
id="_x0000_t75" coordsize="21600,21600" o:spt="75" o:preferrelative="t"<br />
path="m@4@5l@4@11@9@11@9@5xe" filled="f" stroked="f"><br />
<v:stroke joinstyle="miter"/><br />
<v:formulas><br />
<v:f eqn="if lineDrawn pixelLineWidth 0"/><br />
<v:f eqn="sum @0 1 0"/><br />
<v:f eqn="sum 0 0 @1"/><br />
<v:f eqn="prod @2 1 2"/><br />
<v:f eqn="prod @3 21600 pixelWidth"/><br />
<v:f eqn="prod @3 21600 pixelHeight"/><br />
<v:f eqn="sum @0 0 1"/><br />
<v:f eqn="prod @6 1 2"/><br />
<v:f eqn="prod @7 21600 pixelWidth"/><br />
<v:f eqn="sum @8 21600 0"/><br />
<v:f eqn="prod @7 21600 pixelHeight"/><br />
<v:f eqn="sum @10 21600 0"/><br />
</v:formulas><br />
<v:path o:extrusionok="f" gradientshapeok="t" o:connecttype="rect"/><br />
<o:lock v:ext="edit" aspectratio="t"/><br />
</v:shapetype><v:shape id="_x0031__x0020_Imagen" o:spid="_x0000_s1033"<br />
type="#_x0000_t75" style='position:absolute;left:0;text-align:left;<br />
margin-left:15.9pt;margin-top:9.9pt;width:61.45pt;height:48.6pt;z-index:251649536;<br />
visibility:visible;mso-wrap-style:square;mso-width-percent:0;<br />
mso-height-percent:0;mso-wrap-distance-left:9pt;mso-wrap-distance-top:0;<br />
mso-wrap-distance-right:9pt;mso-wrap-distance-bottom:0;<br />
mso-position-horizontal:absolute;mso-position-horizontal-relative:text;<br />
mso-position-vertical:absolute;mso-position-vertical-relative:text;<br />
mso-width-percent:0;mso-height-percent:0;mso-width-relative:page;<br />
mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image001.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=82 height=65<br />
src="https://static.igem.org/mediawiki/2014hs/6/62/Promotor.png" align=left hspace=12<br />
v:shapes="_x0031__x0020_Imagen"><![endif]><i><span lang=ES-MX<br />
style='font-family:Oxygen;color:#E36C0A;mso-themecolor:accent6;mso-themeshade:<br />
191;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'>&nbsp;</p></td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;<br />
mso-border-right-themecolor:accent6;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt;<br />
mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt:<br />
solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153;<br />
background:#FDE9D9;mso-background-themecolor:accent6;mso-background-themetint:<br />
51;padding:0cm 5.4pt 0cm 5.4pt;height:60.75pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p><br />
</td><br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left:<br />
none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;<br />
mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint:<br />
153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;background:#FDE9D9;mso-background-themecolor:accent6;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:60.75pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
Arial;color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>In<br />
the specific case of our bacteria, it helps to continuously transcribing the <span<br />
class=SpellE>irrE</span> gene in order to make bacteria resist high<br />
concentration of salt. </span><span class=SpellE><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:#282828;mso-fareast-language:ES-MX'>This</span></span><span<br />
lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
"Times New Roman";mso-bidi-font-family:Arial;color:#282828;mso-fareast-language:<br />
ES-MX'> <span class=SpellE>promoter</span> has a <span class=SpellE>length</span><br />
of 35 <span class=SpellE>pb</span>(Anderson, 2006).<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:1;height:75.0pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:75.0pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape<br />
id="_x0032__x0020_Imagen" o:spid="_x0000_s1032" type="#_x0000_t75" style='position:absolute;<br />
left:0;text-align:left;margin-left:23.1pt;margin-top:6.95pt;width:54.25pt;<br />
height:49.45pt;z-index:251651584;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image003.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=72 height=66<br />
src="https://static.igem.org/mediawiki/2014hs/5/5d/Cds.png" align=left hspace=12<br />
v:shapes="_x0032__x0020_Imagen"><![endif]><i><span style='font-family:Oxygen;<br />
color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191;mso-ansi-language:<br />
EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'>&nbsp;</p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;<br />
mso-border-right-themecolor:accent6;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt;<br />
mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt:<br />
solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153;<br />
padding:0cm 5.4pt 0cm 5.4pt;height:75.0pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-ansi-language:EN-US;mso-fareast-language:<br />
ES-MX'><a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'>&nbsp;</p><br />
</td><br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left:<br />
none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;<br />
mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint:<br />
153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:75.0pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal'><span style='font-size:12.0pt;font-family:Oxygen;<br />
mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial;<br />
color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>This<br />
specific is <span class=SpellE>RBS</span> based on <span class=SpellE>Elowitz</span><br />
<span class=SpellE>repressilator</span>. It is very common to see in many <span<br />
class=SpellE>iGEM</span> projects.<span style='mso-spacerun:yes'> </span>It<br />
has a length of 12 <span class=SpellE>pb </span>(Mahajan, <span<br />
class=SpellE>Marinescu</span>, Chow, <span class=SpellE>Wissner</span>-Gross,<br />
&amp; Carr, 2003).<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:2;height:90.35pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:90.35pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape<br />
id="_x0033__x0020_Imagen" o:spid="_x0000_s1031" type="#_x0000_t75" style='position:absolute;<br />
left:0;text-align:left;margin-left:23.4pt;margin-top:10pt;width:57pt;<br />
height:48pt;z-index:251654656;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image005.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=76 height=64<br />
src="https://static.igem.org/mediawiki/2014hs/9/97/IrrEResistance.png" align=left hspace=12<br />
v:shapes="_x0033__x0020_Imagen"><![endif]></p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;<br />
mso-border-right-themecolor:accent6;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt;<br />
mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt:<br />
solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153;<br />
background:#FDE9D9;mso-background-themecolor:accent6;mso-background-themetint:<br />
51;padding:0cm 5.4pt 0cm 5.4pt;height:90.35pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-ansi-language:EN-US;<br />
mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K729001">BBa_K729001</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span<br />
style='font-size:3.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-ansi-language:EN-US;<br />
mso-fareast-language:ES-MX'><o:p></o:p></span></p><br />
</td><br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left:<br />
none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;<br />
mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint:<br />
153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;background:#FDE9D9;mso-background-themecolor:accent6;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:90.35pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
Arial;color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>Gene<br />
that produces <span class=SpellE>irrE</span>, a substance that changes the<br />
bacteria’s metabolism and allows bacteria to survive to extreme conditions,<br />
some examples could be high UV rays exposition, or high salt concentration<br />
levels in an aquatic environment, oxidative or thermal shock.<span<br />
style='mso-spacerun:yes'> </span>It has a length of 933pb (<span<br />
class=SpellE>Sohrabi</span>, 2012).<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes;height:62.25pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:62.25pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape<br />
id="_x0034__x0020_Imagen" o:spid="_x0000_s1030" type="#_x0000_t75" style='position:absolute;<br />
left:0;text-align:left;margin-left:22.6pt;margin-top:5.5pt;width:54.75pt;<br />
height:52.5pt;z-index:251657728;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image006.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=73 height=70<br />
src="https://static.igem.org/mediawiki/2014hs/5/55/TerminatorResistance.png" align=left hspace=12<br />
v:shapes="_x0034__x0020_Imagen"><![endif]><i><span style='font-family:Oxygen;<br />
color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191;mso-ansi-language:<br />
EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i><i><span<br />
lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
"Times New Roman";mso-bidi-font-family:"Times New Roman";color:black;<br />
mso-fareast-language:ES-MX'> <br />
<o:p></o:p><br />
</span></i></p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;<br />
mso-border-right-themecolor:accent6;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt;<br />
mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt:<br />
solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153;<br />
padding:0cm 5.4pt 0cm 5.4pt;height:62.25pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'>&nbsp;</p></td><br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left:<br />
none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;<br />
mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint:<br />
153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:62.25pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal'><span style='font-size:12.0pt;font-family:Oxygen;<br />
mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:"Times New Roman";<br />
color:black;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>Part made of<br />
6pb responsible for transcription stop (Huang, 206).<o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
</div></center><br />
<br />
<br><p><b>Bibliography</b></p><br />
<br />
<font size="2"><br />
<p>● Antiquity 2013. (2013, January 31). <i>Part:BBa_B0034</i>. Retrieved from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034">http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034</a>.</p><br />
<p>● Huang, H. (2006, August 30). <i>Part:BBa_B1002</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002">http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002</a>.</p><br />
<p>● iGEM2006_Berkeley. (2006, August 24). <i>Part:BBa_J23119</i>. Retrieved April 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119">http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119</a>.</p><br />
<p>● Sohrabi, B. (2012, June 27). <i>Part:BBa_K729001</i>. Retrieved from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K729001">http://parts.igem.org/wiki/index.php?title=Part:BBa_K729001</a>.</p><br />
<p>● UCLiGEM Team. (2012). <i>IRRE module</i>. Retrieved March 31, 2014. from <a href="https://2012.igem.org/Team:University_College_London/Module_5">https://2012.igem.org/Team:University_College_London/Module_5</a>.</p><br />
</font><br />
<br />
<br><br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma
Team:CIDEB-UANL Mexico/project aroma
2014-06-15T03:41:49Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;du<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Aroma Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<br />
<p>Since the beginning of iGEM project, the use of fluorescent reporters has been used in each one of the proposed projects in previous years, trying to test the theoretical presence of other proteins in <i>E. coli</i>. For our iGEM 2014 project, this module proposed to promote the usage of aroma reporters, instead of fluorescent ones.</p><br />
</td><br />
<td style="padding-left:12px;"><img width=131 height=127 src="https://static.igem.org/mediawiki/2014hs/5/5c/HandsomeAroma.jpg"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<p><b>How is the Aroma module composed?</b></p><br />
<br />
<p>This gene is composed by the following parts (see <b>figure 1A</b>): (1) a constitutive promoter, (2) a RNA thermometer, also called ribo-switch; used to regulate the WinterGreen-odor protein production through temperature, (3) a Wintergreen-odor enzyme generator, used to allow the production of methyl salicylate, induced by salicylic acid, and (4) a terminator. All of these parts are ligated by an 8-bp scar (TACTAGAG).</p><br />
<br />
<center><p><img width=507 height=221 src="https://2014hs.igem.org/wiki/imag<br />
es/5/56/AromaFigure1Aa.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 1.</b> Aroma Module</p></center><br />
<br />
<p>Different to fluorescent reporters, this module was made in order to (in the future) perform as an aroma reporter and also to test the correct function of the bacteria, for its future usage as a new reporter and functional part (CDS). It is desired to use this part in the project to replace the red fluorescent protein (RFP) in the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture module</a>. But it was preferable to test it apart to demonstrate its effectiveness. Similarly, this piece is also helpful for <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union module</a>, because when performing the filtration by silica, WinterGreen can demonstrate the presence of bacteria in the beads. The team added the RNA thermometer for regulating the production of the aroma in the project. Another reason for selecting the RNA thermometer as a regulator was to continue the <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico">CIDEB UANL 2013 </a> work with it.</p><br />
<br />
<br><p><b>How does it work?</b></p><br />
<br />
<center><p><img width=334 height=232 src="https://static.igem.org/mediawiki/2014hs/6/6e/AromaFigure1Bb.png "<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 2.</b> Production of Wintergreen Odor</p></center><br />
<br />
<p>This module has a constitutive promoter which will be regulated by temperature with the use of the RNA thermometer. When adding salicylic acid to the bacteria in a 32° Celsius environment, the production of the WinterGreen protein will begin.</p><br />
<br />
<br><p><b>Parts of the module</b></p><br><br />
<br />
<center><div><br />
<table class=MsoTable15Grid7ColorfulAccent3 border=1 cellspacing=0<br />
cellpadding=0 width=625 style='width:468.55pt;border-collapse:collapse;<br />
border:none;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt'><br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes;<br />
height:15.0pt'><br />
<td width=88 nowrap valign=top style='width:66.1pt;border:none;border-bottom:<br />
solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint:<br />
153;mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor:<br />
accent3;mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:517'><b><span lang=ES-MX<br />
style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX;mso-bidi-font-style:<br />
italic'>IMAGE</span></b><span lang=ES-MX style='font-family:Oxygen;<br />
mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:"Times New Roman";<br />
mso-fareast-language:ES-MX;mso-bidi-font-style:italic'><o:p></o:p></span></p><br />
</td><br />
<td width=119 valign=top style='width:89.0pt;border:none;border-bottom:solid #C2D69B 1.0pt;<br />
mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint:153;<br />
mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX<br />
style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>CODE</span></b><span<br />
lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></p><br />
</td><br />
<td width=418 nowrap valign=top style='width:313.45pt;border:none;border-bottom:<br />
solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint:<br />
153;mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor:<br />
accent3;mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX<br />
style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>DESCRIPTION</span></b><span<br />
lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:0;height:83.15pt'><br />
<td width=88 nowrap valign=top style='width:66.1pt;border:none;border-right:<br />
solid #C2D69B 1.0pt;mso-border-right-themecolor:accent3;mso-border-right-themetint:<br />
153;mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:83.15pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape<br />
id="_x0000_s1029" type="#_x0000_t75" style='position:absolute;left:0;<br />
text-align:left;margin-left:10.95pt;margin-top:3.2pt;width:66pt;height:48pt;<br />
z-index:251660800;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image007.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=88 height=64<br />
src="https://static.igem.org/mediawiki/2014hs/4/43/PConsAroma.png" align=left hspace=12<br />
v:shapes="_x0000_s1029"><![endif]></p><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'><i><span lang=ES-MX<br />
style='font-family:Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade:<br />
191;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p>&nbsp;</o:p></span></i></p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:<br />
accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;<br />
mso-border-right-themecolor:accent3;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt;<br />
mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt:<br />
solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153;<br />
background:#EAF1DD;mso-background-themecolor:accent3;mso-background-themetint:<br />
51;padding:0cm 5.4pt 0cm 5.4pt;height:83.15pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span lang=ES-MX<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:Oxygen;<br />
mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial;<br />
color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119A</a></span><span lang=ES-MX<br />
style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p><br />
</td><br />
<td width=418 valign=top style='width:313.45pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:83.15pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language:<br />
ES-MX'>In the specific case of our aroma module, it will help the bacteria to<br />
continuously transcribe the <span class=SpellE>WinterGreen</span> gene in<br />
order to allow the bacteria to continuously produce the aroma. </span><span<br />
class=SpellE><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:<br />
11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'>This</span></span><span<br />
lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:<br />
Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial;<br />
color:black;mso-fareast-language:ES-MX'> <span class=SpellE>promoter</span><br />
has a <span class=SpellE>length</span> of 35bp.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:1;height:77.45pt'><br />
<td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:77.45pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape<br />
id="_x0000_s1028" type="#_x0000_t75" style='position:absolute;left:0;<br />
text-align:left;margin-left:16.95pt;margin-top:4.25pt;width:57.75pt;<br />
height:44.25pt;z-index:251662848;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image009.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=77 height=59<br />
src="https://static.igem.org/mediawiki/2014hs/b/b0/RNAthermAroma.png" align=left hspace=12<br />
v:shapes="_x0000_s1028"><![endif]><i><span lang=ES-MX style='font-family:<br />
Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade:191;mso-fareast-language:<br />
ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p></td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:<br />
accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;<br />
mso-border-right-themecolor:accent3;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt;<br />
mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt:<br />
solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153;<br />
padding:0cm 5.4pt 0cm 5.4pt;height:77.45pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K115017">BBa_K115017</a><o:p></o:p></span></p></td><br />
<td width=418 valign=top style='width:313.45pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:77.45pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal'><span style='font-size:12.0pt;mso-bidi-font-size:<br />
11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language:<br />
ES-MX'>A RNA thermometer, used for temperature post-transcriptional<br />
regulation (thermo sensor), and is designed to initiate transcription around<br />
32°C.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:2;height:190.6pt'><br />
<td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:190.6pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape<br />
id="_x0000_s1027" type="#_x0000_t75" style='position:absolute;left:0;<br />
text-align:left;margin-left:13.95pt;margin-top:3.2pt;width:63pt;height:51.75pt;<br />
z-index:251664896;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image011.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=84 height=69<br />
src="https://static.igem.org/mediawiki/2014hs/b/b1/WinterGreenAroma.png" align=left hspace=12<br />
v:shapes="_x0000_s1027"><![endif]><i><span style='font-size:3.0pt;font-family:<br />
Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade:191;mso-ansi-language:<br />
EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p></td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:<br />
accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;<br />
mso-border-right-themecolor:accent3;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt;<br />
mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt:<br />
solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153;<br />
background:#EAF1DD;mso-background-themecolor:accent3;mso-background-themetint:<br />
51;padding:0cm 5.4pt 0cm 5.4pt;height:190.6pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:Oxygen;<br />
mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial;<br />
mso-ansi-language:EN-US;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K1255001:Design">BBa_K1255001</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p><br />
</td><br />
<td width=418 valign=top style='width:313.45pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:190.6pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language:<br />
ES-MX'>Produces a <span class=SpellE>transferase</span> to convert salicylic<br />
acid into methyl salicylate (<span class=SpellE>WinterGreen</span> odor). The<br />
wintergreen odor generator requires of 2mM of salicylic acid to produce<br />
methyl salicylate. BSMT1 (<a href="http://parts.igem.org/Part:BBa_J45004">BBa_J45004</a>), <span class=SpellE>WinterGreen</span><br />
Odor Generator original name, was created by <a href="https://2006.igem.org/wiki/index.php/MIT_2006">MIT 2006</a>. This year, the team optimized the sequence for <i>Escherichia coli</i>.<br />
</span><span class=SpellE><span lang=ES-MX style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'>The</span></span><span<br />
lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:<br />
Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial;<br />
color:black;mso-fareast-language:ES-MX'> new <span class=SpellE>biobrick</span><br />
has a <span class=SpellE>length</span> of 1,074bp.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes;height:70.7pt'><br />
<td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:70.7pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape<br />
id="_x0000_s1026" type="#_x0000_t75" style='position:absolute;left:0;<br />
text-align:left;margin-left:18pt;margin-top:1.85pt;width:59.1pt;height:49.4pt;<br />
z-index:251666944;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image013.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=79 height=66<br />
src="https://static.igem.org/mediawiki/2014hs/6/62/TerminatorAroma.png" align=left hspace=12<br />
v:shapes="_x0000_s1026"><![endif]></p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:<br />
accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;<br />
mso-border-right-themecolor:accent3;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt;<br />
mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt:<br />
solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153;<br />
padding:0cm 5.4pt 0cm 5.4pt;height:70.7pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'>&nbsp;</p><br />
</td><br />
<td width=418 valign=top style='width:313.45pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:70.7pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal'><span style='font-size:12.0pt;mso-bidi-font-size:<br />
11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language:<br />
ES-MX'>Part made of 6bp, responsible for transcription stop. The terminator<br />
stops the production of methyl salicylate. <o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
</div></center><br />
<br />
<br><p><b>Full Device:</b></p><br />
<br />
<p>These 4 genetic parts form the Aroma device of the project(see <b>Figure 4</b>)The full device's length is 1,251bp (including restriction sites).</p><br />
<br />
<center><p><img width=629 height=106 src="https://static.igem.org/mediawiki/2014hs/3/3a/AromaFigure4.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 3.</b> Aroma Device</p></center><br />
<br />
<p><b>Other teams that use RNA thermometer and WinterGreen (BSMT1)</b></p><br />
<br />
<p><i>RNA thermometer</i></p><br />
<br />
<p class=MsoListParagraph style='margin-top:0cm;margin-right:0cm;margin-bottom:<br />
5.0pt;margin-left:21.3pt;'><![if !supportLists]><span<br />
style='font-size:12.0pt;font-family:Symbol;mso-fareast-font-family:Symbol;<br />
mso-bidi-font-family:Symbol'><span style='mso-list:Ignore'>·<span<br />
style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span></span></span><![endif]><span class=SpellE><b style='mso-bidi-font-weight:<br />
normal'><span><a href="https://2008.igem.org/Team:TUDelft">TUDelft </span></b></span><b<br />
style='mso-bidi-font-weight:normal'><span> 2008:</a></span></b><span> Temperature-sensing bacteria that changes<br />
color at different temperatures; as a temperature reporter system in<br />
large-scale fermentations, or as a temperature-inducible protein production<br />
system. <o:p></o:p></span></p><br />
<br />
<center><p><img width=571 height=129 src="https://static.igem.org/mediawiki/2014hs/e/e0/AromaFigure5.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 4.</b> RNA Thermometer circuit, excerpted from <a href="https://2008.igem.org/Team:TUDelft">TUDelft 2008</a> team</p></center><br />
<br />
<p class=MsoListParagraph style='margin-top:0cm;margin-right:0cm;margin-bottom:<br />
5.0pt;margin-left:21.3pt;'><![if !supportLists]><span<br />
style='font-size:12.0pt;font-family:Symbol;mso-fareast-font-family:Symbol;<br />
mso-bidi-font-family:Symbol'><span style='mso-list:Ignore'>·<span<br />
style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span></span></span><![endif]><span class=SpellE><b style='mso-bidi-font-weight:<br />
normal'><span> <a href="https://2009.igem.org/Team:VictoriaBC">VictoriaBC</span></b></span><b<br />
style='mso-bidi-font-weight:normal'><span> 2009: </a></span></b><span>NAND logic gate using the ribo-key/ribo-lock system designed by <a href="https://2006.igem.org/wiki/index.php/Berkeley">Berkeley 2006</a> team , producing RFP except when the cells are grown in the presence of both arabinose and IPTG, also coupling fluorescent outputs with the ribo-thermometers made by <a href="https://2008.igem.org/Team:TUDelft">TUDelft 2008</a> team. <o:p></o:p></span></p><br />
<br />
<p class=MsoListParagraph style='margin-top:0cm;margin-right:0cm;margin-bottom:<br />
5.0pt;margin-left:21.3pt;'><![if !supportLists]><span<br />
style='font-size:12.0pt;font-family:Symbol;mso-fareast-font-family:Symbol;<br />
mso-bidi-font-family:Symbol'><span style='mso-list:Ignore'>·<span<br />
style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span></span></span><![endif]><span class=SpellE><b style='mso-bidi-font-weight:<br />
normal'><span><a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico">iGEM_CIDEB </span></b></span><b<br />
style='mso-bidi-font-weight:normal'><span>2013:</a></span></b><span> Production of Vip3ca3, which acts as a pesticide protein, regulated by specific temperatures in order to avoid overproduction and it will show activity against target organisms Coleoptera and Lepidoptera. <o:p></o:p></span></p><br />
<br />
<center><p><img width=474 height=146 src="https://static.igem.org/mediawiki/2014hs/3/3f/AromaFigure6.jpg "<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 5.</b> Circuit from <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico">iGEM CIDEB UANL 2013</a> team</p></center><br />
<br />
<p><i>WinterGreen (BSMT1)</i></p><br />
<br />
<p class=MsoListParagraph style='margin-top:0cm;margin-right:0cm;margin-bottom:<br />
5.0pt;margin-left:21.3pt;'><![if !supportLists]><span<br />
style='font-size:12.0pt;font-family:Symbol;mso-fareast-font-family:Symbol;<br />
mso-bidi-font-family:Symbol'><span style='mso-list:Ignore'>·<span<br />
style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span></span></span><![endif]><span class=SpellE><b style='mso-bidi-font-weight:<br />
normal'><span><a href="https://2006.igem.org/wiki/index.php/MIT_2006">MIT 2006</a>:</span></b></span><span> This device produces methyl salicylate in the presence of salicylic acid. Methyl salicylate smells strongly of mint (wintergreen). Production of methyl salicylate was verified both by scent and by gas chromatography: E. coli with no WGD did not produce methyl salicylate when SA was added to the medium, while E. coli with the WGD did produce methyl salicylate when SA was added to the medium. <o:p></o:p></span></p><br />
<br />
<center><p><img width=533 height=198 src="https://static.igem.org/mediawiki/2014hs/9/98/AromaFigure7.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 6.</b> Wintergreen odor enzyme (BSMT1) generator circuit by <a href="https://2006.igem.org/wiki/index.php/MIT_2006">MIT 2006</a></p></center><br />
<br />
<br><p><b>Bibliography</b></p><br />
<br />
<font size="2"><br />
<p>● Huang, H. (2006, August 30). <i>Part:BBa_B1002. </i> Retrieved August 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002"> http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002</a>.</p><br />
<p>● iGEM2006_Berkeley. (2006). <i>Part:BBa_J23100</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_J23100"> http://parts.igem.org/Part:BBa_J23100</a>.</p><br />
<p>● iGEM2006_MIT. (2006). <i>Part:BBa_J45004</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_J45004"> http://parts.igem.org/Part:BBa_J45004</a>. </p><br />
<p>● iGEM CIDEB Team. (2013). <i>iGEM CIDEB UANL 2013</i>. Retrieved on March 31th, 2014. <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico/Project"> https://2013hs.igem.org/Team:CIDEB-UANL_Mexico/Project</a>. </p><br />
<p>● iGEM08_TUDelft. (2008). <i>Part:BBa_K115017</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_K115017"> http://parts.igem.org/Part:BBa_K115017</a>. </p><br />
<p>● MIT IGEM Team. (2006). <i>MIT 2006</i>. Retrieved on March 31th, 2014, from: <a href="https://2006.igem.org/wiki/index.php/MIT_2006"> https://2006.igem.org/wiki/index.php/MIT_2006</a>. </p><br />
<p>● TUDelft iGEM Team. (2008). <i>TUDelft 2008</i>. Retrieved on March 31th, 2014, from: <a href="https://2008.igem.org/Team:TUDelft"> https://2008.igem.org/Team:TUDelft</a>. </p><br />
<p>● VictoriaBC. (2009). <i>VictoriaBC 2009</i>. Retrieved on March 31th, 2014, from: <a href="https://2009.igem.org/Team:VictoriaBC"> https://2009.igem.org/Team:VictoriaBC</a>. </p><br />
<p>● Zubieta, Chole et al. (2003). <i>Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family</i>. Manuscript submitted for publication. Retrieved from <a href="www.plantcell.org"> www.plantcell.org</a>. </p><br />
</font><br />
<br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma
Team:CIDEB-UANL Mexico/project aroma
2014-06-15T03:38:51Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;du<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Aroma Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<br />
<p>Since the beginning of iGEM project, the use of fluorescent reporters has been used in each one of the proposed projects in previous years, trying to test the theoretical presence of other proteins in <i>E. coli</i>. For our iGEM 2014 project, this module proposed to promote the usage of aroma reporters, instead of fluorescent ones.</p><br />
</td><br />
<td style="padding-left:12px;"><img width=131 height=127 src="https://static.igem.org/mediawiki/2014hs/e/ec/CapturemoduleCIDEB.jpg"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<p><b>How is the Aroma module composed?</b></p><br />
<br />
<p>This gene is composed by the following parts (see <b>figure 1A</b>): (1) a constitutive promoter, (2) a RNA thermometer, also called ribo-switch; used to regulate the WinterGreen-odor protein production through temperature, (3) a Wintergreen-odor enzyme generator, used to allow the production of methyl salicylate, induced by salicylic acid, and (4) a terminator. All of these parts are ligated by an 8-bp scar (TACTAGAG).</p><br />
<br />
<center><p><img width=507 height=221 src="https://static.igem.org/mediawiki/2014hs/5/5c/HandsomeAroma.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 1.</b> Aroma Module</p></center><br />
<br />
<p>Different to fluorescent reporters, this module was made in order to (in the future) perform as an aroma reporter and also to test the correct function of the bacteria, for its future usage as a new reporter and functional part (CDS). It is desired to use this part in the project to replace the red fluorescent protein (RFP) in the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture">Capture module</a>. But it was preferable to test it apart to demonstrate its effectiveness. Similarly, this piece is also helpful for <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union">Union module</a>, because when performing the filtration by silica, WinterGreen can demonstrate the presence of bacteria in the beads. The team added the RNA thermometer for regulating the production of the aroma in the project. Another reason for selecting the RNA thermometer as a regulator was to continue the <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico">CIDEB UANL 2013 </a> work with it.</p><br />
<br />
<br><p><b>How does it work?</b></p><br />
<br />
<center><p><img width=334 height=232 src="https://static.igem.org/mediawiki/2014hs/6/6e/AromaFigure1Bb.png "<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 2.</b> Production of Wintergreen Odor</p></center><br />
<br />
<p>This module has a constitutive promoter which will be regulated by temperature with the use of the RNA thermometer. When adding salicylic acid to the bacteria in a 32° Celsius environment, the production of the WinterGreen protein will begin.</p><br />
<br />
<br><p><b>Parts of the module</b></p><br><br />
<br />
<center><div><br />
<table class=MsoTable15Grid7ColorfulAccent3 border=1 cellspacing=0<br />
cellpadding=0 width=625 style='width:468.55pt;border-collapse:collapse;<br />
border:none;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt'><br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes;<br />
height:15.0pt'><br />
<td width=88 nowrap valign=top style='width:66.1pt;border:none;border-bottom:<br />
solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint:<br />
153;mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor:<br />
accent3;mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:517'><b><span lang=ES-MX<br />
style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX;mso-bidi-font-style:<br />
italic'>IMAGE</span></b><span lang=ES-MX style='font-family:Oxygen;<br />
mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:"Times New Roman";<br />
mso-fareast-language:ES-MX;mso-bidi-font-style:italic'><o:p></o:p></span></p><br />
</td><br />
<td width=119 valign=top style='width:89.0pt;border:none;border-bottom:solid #C2D69B 1.0pt;<br />
mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint:153;<br />
mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX<br />
style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>CODE</span></b><span<br />
lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></p><br />
</td><br />
<td width=418 nowrap valign=top style='width:313.45pt;border:none;border-bottom:<br />
solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;mso-border-bottom-themetint:<br />
153;mso-border-bottom-alt:solid #C2D69B .5pt;mso-border-bottom-themecolor:<br />
accent3;mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.0pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX<br />
style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>DESCRIPTION</span></b><span<br />
lang=ES-MX style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:0;height:83.15pt'><br />
<td width=88 nowrap valign=top style='width:66.1pt;border:none;border-right:<br />
solid #C2D69B 1.0pt;mso-border-right-themecolor:accent3;mso-border-right-themetint:<br />
153;mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:83.15pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape<br />
id="_x0000_s1029" type="#_x0000_t75" style='position:absolute;left:0;<br />
text-align:left;margin-left:10.95pt;margin-top:3.2pt;width:66pt;height:48pt;<br />
z-index:251660800;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image007.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=88 height=64<br />
src="https://static.igem.org/mediawiki/2014hs/4/43/PConsAroma.png" align=left hspace=12<br />
v:shapes="_x0000_s1029"><![endif]></p><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'><i><span lang=ES-MX<br />
style='font-family:Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade:<br />
191;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p>&nbsp;</o:p></span></i></p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:<br />
accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;<br />
mso-border-right-themecolor:accent3;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt;<br />
mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt:<br />
solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153;<br />
background:#EAF1DD;mso-background-themecolor:accent3;mso-background-themetint:<br />
51;padding:0cm 5.4pt 0cm 5.4pt;height:83.15pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span lang=ES-MX<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:Oxygen;<br />
mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial;<br />
color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119A</a></span><span lang=ES-MX<br />
style='font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p><br />
</td><br />
<td width=418 valign=top style='width:313.45pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:83.15pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language:<br />
ES-MX'>In the specific case of our aroma module, it will help the bacteria to<br />
continuously transcribe the <span class=SpellE>WinterGreen</span> gene in<br />
order to allow the bacteria to continuously produce the aroma. </span><span<br />
class=SpellE><span lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:<br />
11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'>This</span></span><span<br />
lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:<br />
Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial;<br />
color:black;mso-fareast-language:ES-MX'> <span class=SpellE>promoter</span><br />
has a <span class=SpellE>length</span> of 35bp.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:1;height:77.45pt'><br />
<td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:77.45pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape<br />
id="_x0000_s1028" type="#_x0000_t75" style='position:absolute;left:0;<br />
text-align:left;margin-left:16.95pt;margin-top:4.25pt;width:57.75pt;<br />
height:44.25pt;z-index:251662848;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image009.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=77 height=59<br />
src="https://static.igem.org/mediawiki/2014hs/b/b0/RNAthermAroma.png" align=left hspace=12<br />
v:shapes="_x0000_s1028"><![endif]><i><span lang=ES-MX style='font-family:<br />
Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade:191;mso-fareast-language:<br />
ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p></td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:<br />
accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;<br />
mso-border-right-themecolor:accent3;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt;<br />
mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt:<br />
solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153;<br />
padding:0cm 5.4pt 0cm 5.4pt;height:77.45pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K115017">BBa_K115017</a><o:p></o:p></span></p></td><br />
<td width=418 valign=top style='width:313.45pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:77.45pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal'><span style='font-size:12.0pt;mso-bidi-font-size:<br />
11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language:<br />
ES-MX'>A RNA thermometer, used for temperature post-transcriptional<br />
regulation (thermo sensor), and is designed to initiate transcription around<br />
32°C.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:2;height:190.6pt'><br />
<td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:190.6pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape<br />
id="_x0000_s1027" type="#_x0000_t75" style='position:absolute;left:0;<br />
text-align:left;margin-left:13.95pt;margin-top:3.2pt;width:63pt;height:51.75pt;<br />
z-index:251664896;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image011.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=84 height=69<br />
src="https://static.igem.org/mediawiki/2014hs/b/b1/WinterGreenAroma.png" align=left hspace=12<br />
v:shapes="_x0000_s1027"><![endif]><i><span style='font-size:3.0pt;font-family:<br />
Oxygen;color:#76923C;mso-themecolor:accent3;mso-themeshade:191;mso-ansi-language:<br />
EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p></td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:<br />
accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;<br />
mso-border-right-themecolor:accent3;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt;<br />
mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt:<br />
solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153;<br />
background:#EAF1DD;mso-background-themecolor:accent3;mso-background-themetint:<br />
51;padding:0cm 5.4pt 0cm 5.4pt;height:190.6pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span<br />
style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:Oxygen;<br />
mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial;<br />
mso-ansi-language:EN-US;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K1255001:Design">BBa_K1255001</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p><br />
</td><br />
<td width=418 valign=top style='width:313.45pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;background:#EAF1DD;mso-background-themecolor:accent3;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:190.6pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language:<br />
ES-MX'>Produces a <span class=SpellE>transferase</span> to convert salicylic<br />
acid into methyl salicylate (<span class=SpellE>WinterGreen</span> odor). The<br />
wintergreen odor generator requires of 2mM of salicylic acid to produce<br />
methyl salicylate. BSMT1 (<a href="http://parts.igem.org/Part:BBa_J45004">BBa_J45004</a>), <span class=SpellE>WinterGreen</span><br />
Odor Generator original name, was created by <a href="https://2006.igem.org/wiki/index.php/MIT_2006">MIT 2006</a>. This year, the team optimized the sequence for <i>Escherichia coli</i>.<br />
</span><span class=SpellE><span lang=ES-MX style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:black;mso-fareast-language:ES-MX'>The</span></span><span<br />
lang=ES-MX style='font-size:12.0pt;mso-bidi-font-size:11.0pt;font-family:<br />
Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial;<br />
color:black;mso-fareast-language:ES-MX'> new <span class=SpellE>biobrick</span><br />
has a <span class=SpellE>length</span> of 1,074bp.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes;height:70.7pt'><br />
<td width=88 nowrap valign=top style='width:66.1pt;border-top:solid #C2D69B 1.0pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #C2D69B .5pt;mso-border-right-themecolor:accent3;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:70.7pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape<br />
id="_x0000_s1026" type="#_x0000_t75" style='position:absolute;left:0;<br />
text-align:left;margin-left:18pt;margin-top:1.85pt;width:59.1pt;height:49.4pt;<br />
z-index:251666944;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image013.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=79 height=66<br />
src="https://static.igem.org/mediawiki/2014hs/6/62/TerminatorAroma.png" align=left hspace=12<br />
v:shapes="_x0000_s1026"><![endif]></p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:<br />
accent3;mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;<br />
mso-border-right-themecolor:accent3;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #C2D69B .5pt;mso-border-top-themecolor:accent3;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #C2D69B .5pt;<br />
mso-border-left-themecolor:accent3;mso-border-left-themetint:153;mso-border-alt:<br />
solid #C2D69B .5pt;mso-border-themecolor:accent3;mso-border-themetint:153;<br />
padding:0cm 5.4pt 0cm 5.4pt;height:70.7pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
mso-bidi-font-size:11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'>&nbsp;</p><br />
</td><br />
<td width=418 valign=top style='width:313.45pt;border-top:none;border-left:<br />
none;border-bottom:solid #C2D69B 1.0pt;mso-border-bottom-themecolor:accent3;<br />
mso-border-bottom-themetint:153;border-right:solid #C2D69B 1.0pt;mso-border-right-themecolor:<br />
accent3;mso-border-right-themetint:153;mso-border-top-alt:solid #C2D69B .5pt;<br />
mso-border-top-themecolor:accent3;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #C2D69B .5pt;mso-border-left-themecolor:accent3;mso-border-left-themetint:<br />
153;mso-border-alt:solid #C2D69B .5pt;mso-border-themecolor:accent3;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:70.7pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal'><span style='font-size:12.0pt;mso-bidi-font-size:<br />
11.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:black;mso-ansi-language:EN-US;mso-fareast-language:<br />
ES-MX'>Part made of 6bp, responsible for transcription stop. The terminator<br />
stops the production of methyl salicylate. <o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
</div></center><br />
<br />
<br><p><b>Full Device:</b></p><br />
<br />
<p>These 4 genetic parts form the Aroma device of the project(see <b>Figure 4</b>)The full device's length is 1,251bp (including restriction sites).</p><br />
<br />
<center><p><img width=629 height=106 src="https://static.igem.org/mediawiki/2014hs/3/3a/AromaFigure4.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 3.</b> Aroma Device</p></center><br />
<br />
<p><b>Other teams that use RNA thermometer and WinterGreen (BSMT1)</b></p><br />
<br />
<p><i>RNA thermometer</i></p><br />
<br />
<p class=MsoListParagraph style='margin-top:0cm;margin-right:0cm;margin-bottom:<br />
5.0pt;margin-left:21.3pt;'><![if !supportLists]><span<br />
style='font-size:12.0pt;font-family:Symbol;mso-fareast-font-family:Symbol;<br />
mso-bidi-font-family:Symbol'><span style='mso-list:Ignore'>·<span<br />
style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span></span></span><![endif]><span class=SpellE><b style='mso-bidi-font-weight:<br />
normal'><span><a href="https://2008.igem.org/Team:TUDelft">TUDelft </span></b></span><b<br />
style='mso-bidi-font-weight:normal'><span> 2008:</a></span></b><span> Temperature-sensing bacteria that changes<br />
color at different temperatures; as a temperature reporter system in<br />
large-scale fermentations, or as a temperature-inducible protein production<br />
system. <o:p></o:p></span></p><br />
<br />
<center><p><img width=571 height=129 src="https://static.igem.org/mediawiki/2014hs/e/e0/AromaFigure5.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 4.</b> RNA Thermometer circuit, excerpted from <a href="https://2008.igem.org/Team:TUDelft">TUDelft 2008</a> team</p></center><br />
<br />
<p class=MsoListParagraph style='margin-top:0cm;margin-right:0cm;margin-bottom:<br />
5.0pt;margin-left:21.3pt;'><![if !supportLists]><span<br />
style='font-size:12.0pt;font-family:Symbol;mso-fareast-font-family:Symbol;<br />
mso-bidi-font-family:Symbol'><span style='mso-list:Ignore'>·<span<br />
style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span></span></span><![endif]><span class=SpellE><b style='mso-bidi-font-weight:<br />
normal'><span> <a href="https://2009.igem.org/Team:VictoriaBC">VictoriaBC</span></b></span><b<br />
style='mso-bidi-font-weight:normal'><span> 2009: </a></span></b><span>NAND logic gate using the ribo-key/ribo-lock system designed by <a href="https://2006.igem.org/wiki/index.php/Berkeley">Berkeley 2006</a> team , producing RFP except when the cells are grown in the presence of both arabinose and IPTG, also coupling fluorescent outputs with the ribo-thermometers made by <a href="https://2008.igem.org/Team:TUDelft">TUDelft 2008</a> team. <o:p></o:p></span></p><br />
<br />
<p class=MsoListParagraph style='margin-top:0cm;margin-right:0cm;margin-bottom:<br />
5.0pt;margin-left:21.3pt;'><![if !supportLists]><span<br />
style='font-size:12.0pt;font-family:Symbol;mso-fareast-font-family:Symbol;<br />
mso-bidi-font-family:Symbol'><span style='mso-list:Ignore'>·<span<br />
style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span></span></span><![endif]><span class=SpellE><b style='mso-bidi-font-weight:<br />
normal'><span><a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico">iGEM_CIDEB </span></b></span><b<br />
style='mso-bidi-font-weight:normal'><span>2013:</a></span></b><span> Production of Vip3ca3, which acts as a pesticide protein, regulated by specific temperatures in order to avoid overproduction and it will show activity against target organisms Coleoptera and Lepidoptera. <o:p></o:p></span></p><br />
<br />
<center><p><img width=474 height=146 src="https://static.igem.org/mediawiki/2014hs/3/3f/AromaFigure6.jpg "<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 5.</b> Circuit from <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico">iGEM CIDEB UANL 2013</a> team</p></center><br />
<br />
<p><i>WinterGreen (BSMT1)</i></p><br />
<br />
<p class=MsoListParagraph style='margin-top:0cm;margin-right:0cm;margin-bottom:<br />
5.0pt;margin-left:21.3pt;'><![if !supportLists]><span<br />
style='font-size:12.0pt;font-family:Symbol;mso-fareast-font-family:Symbol;<br />
mso-bidi-font-family:Symbol'><span style='mso-list:Ignore'>·<span<br />
style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</span></span></span><![endif]><span class=SpellE><b style='mso-bidi-font-weight:<br />
normal'><span><a href="https://2006.igem.org/wiki/index.php/MIT_2006">MIT 2006</a>:</span></b></span><span> This device produces methyl salicylate in the presence of salicylic acid. Methyl salicylate smells strongly of mint (wintergreen). Production of methyl salicylate was verified both by scent and by gas chromatography: E. coli with no WGD did not produce methyl salicylate when SA was added to the medium, while E. coli with the WGD did produce methyl salicylate when SA was added to the medium. <o:p></o:p></span></p><br />
<br />
<center><p><img width=533 height=198 src="https://static.igem.org/mediawiki/2014hs/9/98/AromaFigure7.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 6.</b> Wintergreen odor enzyme (BSMT1) generator circuit by <a href="https://2006.igem.org/wiki/index.php/MIT_2006">MIT 2006</a></p></center><br />
<br />
<br><p><b>Bibliography</b></p><br />
<br />
<font size="2"><br />
<p>● Huang, H. (2006, August 30). <i>Part:BBa_B1002. </i> Retrieved August 30, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002"> http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002</a>.</p><br />
<p>● iGEM2006_Berkeley. (2006). <i>Part:BBa_J23100</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_J23100"> http://parts.igem.org/Part:BBa_J23100</a>.</p><br />
<p>● iGEM2006_MIT. (2006). <i>Part:BBa_J45004</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_J45004"> http://parts.igem.org/Part:BBa_J45004</a>. </p><br />
<p>● iGEM CIDEB Team. (2013). <i>iGEM CIDEB UANL 2013</i>. Retrieved on March 31th, 2014. <a href="https://2013hs.igem.org/Team:CIDEB-UANL_Mexico/Project"> https://2013hs.igem.org/Team:CIDEB-UANL_Mexico/Project</a>. </p><br />
<p>● iGEM08_TUDelft. (2008). <i>Part:BBa_K115017</i>. Retrieved August 30, 2014, from <a href="http://parts.igem.org/Part:BBa_K115017"> http://parts.igem.org/Part:BBa_K115017</a>. </p><br />
<p>● MIT IGEM Team. (2006). <i>MIT 2006</i>. Retrieved on March 31th, 2014, from: <a href="https://2006.igem.org/wiki/index.php/MIT_2006"> https://2006.igem.org/wiki/index.php/MIT_2006</a>. </p><br />
<p>● TUDelft iGEM Team. (2008). <i>TUDelft 2008</i>. Retrieved on March 31th, 2014, from: <a href="https://2008.igem.org/Team:TUDelft"> https://2008.igem.org/Team:TUDelft</a>. </p><br />
<p>● VictoriaBC. (2009). <i>VictoriaBC 2009</i>. Retrieved on March 31th, 2014, from: <a href="https://2009.igem.org/Team:VictoriaBC"> https://2009.igem.org/Team:VictoriaBC</a>. </p><br />
<p>● Zubieta, Chole et al. (2003). <i>Structural Basis for Substrate Recognition in the Salicylic Acid Carboxyl Methyltransferase Family</i>. Manuscript submitted for publication. Retrieved from <a href="www.plantcell.org"> www.plantcell.org</a>. </p><br />
</font><br />
<br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture
Team:CIDEB-UANL Mexico/project capture
2014-06-15T03:16:00Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
span<br />
{<br />
font-size: 10pt;<br />
text-align: justify;<br />
width: 70%;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Capture Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<center><iframe width="640" height="390" src="//www.youtube.com/embed/axCvuDdbEM4" frameborder="0" allowfullscreen></iframe></center><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<br />
<p>In order to desalinize water our project intends to capture sodium ions from saline water using a protein produced from the NhaS gene expression. NhaS is a putative protein from <i>Bacillus firmus</i> that is characterized by its ability to bind and sequestering sodium ions. It “can enhance the Na+ -resistance of antiporter- deficient strains by increasing the availability of Na+ to the integral membrane antiporters on the cytoplasmic side of the membrane and by sequestering Na+ while rate-limiting efflux mechanisms catalyze extrusion of the cation.” (Krulwich & Ivey, 1992)</p><br />
</td><br />
<td style="padding-left:12px;"><img width=131 height=127 src="https://static.igem.org/mediawiki/2014hs/e/ec/CapturemoduleCIDEB.jpg"/><br />
</td><br />
</tr><br />
</table><br />
<br />
<p>Research by Krulwich and Ivey (1992) supports that in its origin bacteria, NhaS works as a regulation pH homeostasis protein because it makes the cytoplasmic pH more acidic than the external medium, usually basic. The calculated weight of the protein is 7100 Daltons and the final protein product is very basic with a calculated pH of 12.</p> <br />
<br />
<p>Basically, NhaS enhance the resistance of bacteria to high saline conditions, regulates pH and captures sodium ions.</p><center><br />
<br />
<p><img width=396 height=248 src="https://static.igem.org/mediawiki/2014hs/6/67/CaptureCIDEB.jpg"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<span><br />
<br />
<p font-size: 8pt><b>Figure 1.</b> Patent US 5346815 A shows extracts of the <i>E. coli</i> EP432 transformed with pGEM <b>(fig. 4A)</b> and pGRVH <b>(fig. 4B)</b>. The first one is a control plasmid and the second a plasmid with the NhaS gene. Those are crude extracts that were shown by the effect of putting the bacteria to an SFBI excitation, which is a sodium-sensitive molecule used to measure intracellular Na+. Resuming, it shows in basic draws that the protein is expressed in <i>E. coli</i> and in what quantity according to the excitation level where it is exposed.</p><br />
</span></center><br />
<br><br />
<p><b>Research on NhaS</b></p><br />
<br />
<p>It is important to be familiarized with what it is being worked with, and since this putative gene has never been used at iGEM before, we did a lot of research on it. </p><br />
<br />
<p>The composition and form of a protein show relevant data about its actions and functions, that is why we investigated NhaS’ predicted type. We found in the modelling tool <a href="http://bmm.cancerresearchuk.org/~3djigsaw/">3D-JIGSAW</a> from <i>Cancer Research UK's</i> site that its possible protein or peptide type would be helix, coil or strand.</p><center><br />
<br />
<p><img width=617 height=260 src="https://static.igem.org/mediawiki/2014hs/5/54/PPRESULTS.jpg"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 2.</b> Interactive 3D-Jigsaw's result that indicates the predicted protein type of NhaS.</p></center><br />
<br><br />
<p>The previous information was confirmed in <i>Predict Protein</i> site.</p><center><br />
<br />
<p><img width=561 height=239 src="https://static.igem.org/mediawiki/2014hs/9/98/GraphsCIDEB.jpg"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 3.</b> Results given by </i>Predict Protein</i> showing the </br>secondary structure composition and solvent accessibility of the putative NhaS gene.</p></center><center><br />
<br><br />
<p><img width=796 height=171 src="https://static.igem.org/mediawiki/2014hs/5/5b/PPCIDEB.jpg"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 4.</b> Results given by <i>Predict Protein</i> showing the predicted precise structure of the NhaS protein. </p></center><br />
<br><br />
<p>Based on the previous information we conclude that NhaS is most possible to be of the helix type. Being aware of the secondary structure of proteins is relevant, since hence, the protein folding mechanism can be taken into consideration.</p><br />
<br />
<p>According to Krulwich and Ivey (1992), the location of the protein is in the cytoplasmic side of the membrane, however, when we made our research, we found out that the protein is predicted to be highly non-cytoplasmic(Yeast Resource Center, 2014). We came out with a hypothesis in which NhaS would be located in the inner part of the membrane but on its cytoplasmic side. This would explain both predictions of both sources of information.</p><center><br />
<br />
<p><img width=391 height=411 src="https://static.igem.org/mediawiki/2014hs/3/32/ProteinCIDEB.jpg"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 5.</b> Predicted protein overview results from <i>Yeast Resource Center</i>.</p></center><br />
<br><br />
<p>As a “confirmation” for our hypothesis, <i>Predict Protein</i> site gave us the following result:</p><center><br />
<br />
<p><img width=180 height=110 src="https://static.igem.org/mediawiki/2014hs/2/28/PPCIDEB2.jpg"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 6.</b>“Predicted localization for the Bacteria domain: Inner Membrane (GO term ID: 0005886) Prediction confidence 76.”</p></center><br />
<br><br />
<p>Based on this predicted result and with the previous hypothesis we formulated, the team concluded that the protein would act in the cytoplasmic side of the inner membrane. This information was used for the understanding and explaining of the module, as well as for designing different animations.</p><br />
<br />
<p>Further information about NhaS can be found in its parts registry section.</p><br />
<br><br />
<br />
<p><b>How is NhaS gene activated?</b></p><br />
<table width=100%><br />
<tr><br />
<td><br />
<br />
<p><img width=52 height=66 src="https://static.igem.org/mediawiki/2014hs/e/e4/PUVCIDEB.jpg"/></p><br />
</td><br />
<td style="padding-left:12px;"><br />
<br />
<p>In our project we are going to activate NhaS’ production and functionability using a promoter from <a href="http://parts.igem.org/Part:BBa_I765001">iGEM Colombian Team 2007</a> that is regulated by UV irradiation and does not causes mutations in the bacteria(iGEM Colombian Team, 2007). We decided to use this type of promoter in order to have a control about the NhaS action in E. CARU, our project. With this, we can decide at which time NhaS is going to be activated. There were chosen UV rays as the initiator of the NhaS expression because they are present in normal conditions, since the mentioned UV promoter is activated under 360 wavelengths of light spectrum. The following table shows the result of the promoter under a bright field and a fluorescence microscope observing the GFP protein reporter glowing, according to Colombian Team 2007. </p><br />
</td><br />
</tr><br />
</table><center><br />
<br />
<p><img width=233 height=313 src="https://static.igem.org/mediawiki/2014hs/8/81/ResultsColombia.jpg"align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 7.</b>Results of the BBa_I765001 UV promoter part according to Colombian Team 2007.</p></center><br />
<br><br />
<br />
<p><b>Other teams that used pUV </b></p><br />
<br />
<p>Before choosing the BBa_I765001 UV promoter the team reviewed the experiences by other participants with it, with the intention of assuring the maximum possible success rate if used in this module. The following table shows information about its usage with other teams.</p><br />
<br />
<div align=center><br />
<table border=1 cellspacing=0 cellpadding=0 style='border-collapse:collapse;border:none;mso-border-alt:solid #C2D69B .5pt; mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh: .5pt solid #C2D69B;mso-border-insidev:.5pt solid #C2D69B'> <br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #9BBB59 1.0pt; border-right:none;mso-border-top-alt:solid #9BBB59 .5pt;mso-border-left-alt: solid #9BBB59 .5pt;mso-border-bottom-alt:solid #9BBB59 .5pt;background:#9BBB59; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><b><br />
<br />
<span style='font-size:12.0pt; color:white;mso-ansi-language:EN-US'>Team<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border:solid #9BBB59 1.0pt; border-left:none;mso-border-top-alt:solid #9BBB59 .5pt;mso-border-bottom-alt: solid #9BBB59 .5pt;mso-border-right-alt:solid #9BBB59 .5pt;background:#9BBB59; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><b><br />
<br />
<span style='font-size:12.0pt; color:white;mso-ansi-language:EN-US'>Use<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:1;height:33.0pt'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt;height:33.0pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><br />
<br />
<span lang=FR style='font-size:12.0pt;color:#4F81BD;mso-ansi-language: FR'><a href="https://2012.igem.org/Team:NYMU-Taipei">NYMU_Taiwan 2012</a><br />
</span></u></b><br />
<br />
<span lang=FR style='font-size:6.0pt;mso-bidi-font-size:12.0pt;mso-ansi-language:FR; mso-bidi-font-weight:bold'>:<br />
</span><b><br />
<br />
<span lang=FR style='font-size:12.0pt; mso-ansi-language:FR'><o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt; height:33.0pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>An UV induced promoter and a CDS of a testosterone-making gene.<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:2'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><br />
<br />
<span style='font-size:12.0pt;color:#4F81BD;mso-ansi-language: EN-US'><a href="https://2013.igem.org/Team:ITB_Indonesia">ITB_Indonesia 2013</a><br />
</span></u></b><br />
<br />
<span style='font-size:6.0pt;mso-bidi-font-size:12.0pt;mso-ansi-language:EN-US; mso-bidi-font-weight:bold'>:<b> <o:p></o:p></b><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></b></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>pUV and mCherry (BBa_J06702) to detect DNA damage.<o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes'> <br />
<td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;color:#4F81BD'><a href="https://2007.igem.org/wiki/index.php/Colombia-Israel_(ORT_Ebin_High_School)">Colombia_Israel 2007</a><br />
</span></u></b><br />
<br />
<span lang=ES-MX style='font-size:7.0pt;mso-bidi-font-size:12.0pt;mso-bidi-font-weight: bold'>:<b> <o:p></o:p></b><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><br />
<br />
<span lang=ES-MX style='font-size:12.0pt'><o:p>&nbsp;</o:p><br />
</span></b></p> <br />
</td> <br />
<td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><br />
<br />
<span style='font-size:12.0pt;mso-ansi-language:EN-US'>Expression of the UV promoter in presence of UV irradiation light lead to the expression of the EYFP reporter.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr><br />
</table><br />
</div><br />
<br><br />
<br />
<p><b>How to know there is any production?</b></p><br />
<br />
<p>In our ideal project we are going to propose an odor Wintergreen reporter for this module in order to know if there is any production of NhaS, that is our plan, but since Wintergreen has not been probed yet and NhaS is a putative protein we decided to test it physically with RFP, which is a simple and common reporter, in order to observe functional results in the tests for this specific segment of the project and obtaining conclusions about each one. Further information can be found in the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma module </a>of our project. </p><center><br />
<br />
<p><img width=495 height=262 src="https://static.igem.org/mediawiki/2014hs/7/7d/TestCIDEB.jpg"align=center hspace=12 alt="IMG_0317"></p></center><br />
<br><br />
<br />
<p><b>Other teams that used NhaS and potential future uses</b></p><br />
<br />
<p>There are no teams that used this gene in the past. IGEM CIDEB 2014 is the first team that is going to synthesize, test and register it.</p> <br />
<br />
<p>We consider this to be useful for the scientific community in general. NhaS, as mentioned before, is a putative protein. Knowing specific results about its functions could be of great use for future projects. </p><br />
<br />
<p>The potential for future usage of this gene is great. As mentioned in the patent from Krulwich and Ivey (1992), the gene encoding NhaS can be introduced into cells to produce desalination bioreactors, can be introduced into plants as a transgene to produce plants that are resistant to sodium, may be used for treatments involving Na+ /K+ ATPase disorders, e.g., in heart disease, and may be introduced parenterally, preferably orally, to bind to and sequester dietary sodium. The possibilities are wide and promising.</p><br />
<br><br />
<br />
<p><b>NhaS part’s description</b></p><br />
<br><center><br />
<br />
<div><br />
<table border=1 cellspacing=0 cellpadding=0 style='border-collapse:collapse;border:none;mso-border-alt:solid #95B3D7 .5pt; mso-yfti-tbllook:1184;mso-table-lspace:7.05pt;margin-left:4.8pt;mso-table-rspace: 7.05pt;margin-right:4.8pt;mso-table-anchor-vertical:margin;mso-table-anchor-horizontal: margin;mso-table-left:right;mso-table-top:25.35pt;mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-border-insideh:.5pt solid #95B3D7;mso-border-insidev:.5pt solid #95B3D7'> <br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes'> <br />
<td width=123 valign=top style='width:91.9pt;border:none;border-bottom:solid #95B3D7 1.0pt; mso-border-bottom-alt:solid #95B3D7 .5pt;background:white;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><b><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US; mso-bidi-font-style:italic'>IMAGE<i><o:p></o:p></i><br />
</span></b></p> <br />
</td> <br />
<td width=123 valign=top style='width:92.4pt;border:none;border-bottom:solid #95B3D7 1.0pt; mso-border-bottom-alt:solid #95B3D7 .5pt;background:white;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><b><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'>CODE<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
<td width=312 valign=top style='width:233.65pt;border:none;border-bottom: solid #95B3D7 1.0pt;mso-border-bottom-alt:solid #95B3D7 .5pt;background:white; padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><b><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'>DESCRIPTION<o:p></o:p><br />
</span></b></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:1'> <br />
<td width=123 valign=top style='width:91.9pt;border:none;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-top-alt:solid #95B3D7 .5pt; mso-border-right-alt:solid #95B3D7 .5pt;background:white;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><br />
<!--[if gte vml 1]><v:shapetype id="_x0000_t75" coordsize="21600,21600" o:spt="75" o:preferrelative="t" path="m@4@5l@4@11@9@11@9@5xe" filled="f" stroked="f"> <v:stroke joinstyle="miter"/> <v:formulas> <v:f eqn="if lineDrawn pixelLineWidth 0"/> <v:f eqn="sum @0 1 0"/> <v:f eqn="sum 0 0 @1"/> <v:f eqn="prod @2 1 2"/> <v:f eqn="prod @3 21600 pixelWidth"/> <v:f eqn="prod @3 21600 pixelHeight"/> <v:f eqn="sum @0 0 1"/> <v:f eqn="prod @6 1 2"/> <v:f eqn="prod @7 21600 pixelWidth"/> <v:f eqn="sum @8 21600 0"/> <v:f eqn="prod @7 21600 pixelHeight"/> <v:f eqn="sum @10 21600 0"/> </v:formulas> <v:path o:extrusionok="f" gradientshapeok="t" o:connecttype="rect"/> <o:lock v:ext="edit" aspectratio="t"/> </v:shapetype><v:shape id="Picture_x0020_32" o:spid="_x0000_s1075" type="#_x0000_t75" style='position:absolute;left:0;text-align:left;margin-left:17.2pt; margin-top:0;width:50.55pt;height:54pt;z-index:251659264;visibility:visible; mso-wrap-style:square;mso-width-percent:0;mso-height-percent:0; mso-wrap-distance-left:9pt;mso-wrap-distance-top:0; mso-wrap-distance-right:9pt;mso-wrap-distance-bottom:0; mso-position-horizontal:absolute;mso-position-horizontal-relative:margin; mso-position-vertical:absolute;mso-position-vertical-relative:text; mso-width-percent:0;mso-height-percent:0;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="https://static.igem.org/mediawiki/2014hs/1/1e/RegulatorypUV.jpg" o:title=""/> <w:wrap type="square" anchorx="margin"/> </v:shape><![endif]--><![if !vml]><img width=67 height=72 src="https://static.igem.org/mediawiki/2014hs/1/1e/RegulatorypUV.jpg" align=left hspace=12 v:shapes="Picture_x0020_32"><![endif]><br />
<!--[if gte vml 1]><v:shapetype id="_x0000_t202" coordsize="21600,21600" o:spt="202" path="m,l,21600r21600,l21600,xe"> <v:stroke joinstyle="miter"/> <v:path gradientshapeok="t" o:connecttype="rect"/> </v:shapetype><v:shape id="Text_x0020_Box_x0020_31" o:spid="_x0000_s1074" type="#_x0000_t202" style='position:absolute;left:0;text-align:left; margin-left:5.35pt;margin-top:51.1pt;width:1in;height:12pt;z-index:251661312; visibility:visible;mso-wrap-style:square;mso-width-percent:0; mso-height-percent:0;mso-wrap-distance-left:9pt;mso-wrap-distance-top:0; mso-wrap-distance-right:9pt;mso-wrap-distance-bottom:0; mso-position-horizontal:absolute;mso-position-horizontal-relative:margin; mso-position-vertical:absolute;mso-position-vertical-relative:text; mso-width-percent:0;mso-height-percent:0;mso-width-relative:page; mso-height-relative:margin;v-text-anchor:top' o:gfxdata="UEsDBBQABgAIAAAAIQC2gziS/gAAAOEBAAATAAAAW0NvbnRlbnRfVHlwZXNdLnhtbJSRQU7DMBBF90jcwfIWJU67QAgl6YK0S0CoHGBkTxKLZGx5TGhvj5O2G0SRWNoz/78nu9wcxkFMGNg6quQqL6RA0s5Y6ir5vt9lD1JwBDIwOMJKHpHlpr69KfdHjyxSmriSfYz+USnWPY7AufNIadK6MEJMx9ApD/oDOlTrorhX2lFEilmcO2RdNtjC5xDF9pCuTyYBB5bi6bQ4syoJ3g9WQ0ymaiLzg5KdCXlKLjvcW893SUOqXwnz5DrgnHtJTxOsQfEKIT7DmDSUCaxw7Rqn8787ZsmRM9e2VmPeBN4uqYvTtW7jvijg9N/yJsXecLq0q+WD6m8AAAD//wMAUEsDBBQABgAIAAAAIQA4/SH/1gAAAJQBAAALAAAAX3JlbHMvLnJlbHOkkMFqwzAMhu+DvYPRfXGawxijTi+j0GvpHsDYimMaW0Yy2fr2M4PBMnrbUb/Q94l/f/hMi1qRJVI2sOt6UJgd+ZiDgffL8ekFlFSbvV0oo4EbChzGx4f9GRdb25HMsYhqlCwG5lrLq9biZkxWOiqY22YiTra2kYMu1l1tQD30/bPm3wwYN0x18gb45AdQl1tp5j/sFB2T0FQ7R0nTNEV3j6o9feQzro1iOWA14Fm+Q8a1a8+Bvu/d/dMb2JY5uiPbhG/ktn4cqGU/er3pcvwCAAD//wMAUEsDBBQABgAIAAAAIQCHpQWMPwIAAI8EAAAOAAAAZHJzL2Uyb0RvYy54bWysVMFu2zAMvQ/YPwi6L06yrtiMOkWWIsOAoC2QDD0rshQLk0RNUmJnXz9KttOu22nYRaHJJ1J8fMzNbWc0OQkfFNiKziZTSoTlUCt7qOi33frdR0pCZLZmGqyo6FkEert4++amdaWYQwO6Fp5gEhvK1lW0idGVRRF4IwwLE3DCYlCCNyzipz8UtWctZje6mE+n10ULvnYeuAgBvXd9kC5yfikFjw9SBhGJrii+LebT53OfzmJxw8qDZ65RfHgG+4dXGKYsFr2kumORkaNXf6QyinsIIOOEgylASsVF7gG7mU1fdbNtmBO5FyQnuAtN4f+l5fenR09UXdH3M0osMzijnegi+QwdQRfy07pQImzrEBg79OOcc6/BbYB/DwgpXmD6CwHRiY9OepN+sVOCF3EE5wvtqQxH56fZ1dUUIxxDsw/zZKecz5edD/GLAEOSUVGPU80PYKdNiD10hKRaAbSq10rr9JECK+3JiaEC2kZFMST/DaVtwlpIt/qEvUdkCQ1VUpN9X8mK3b7LxF2PJO2hPiNHHnqVBcfXCqtvWIiPzKOssEdclfiAh9TQVhQGi5IG/M+/+RMep41RSlqUaUXDjyPzghL91aIOkqZHw4/GfjTs0awA+8bR4muyiRd81KMpPZgn3KBlqoIhZjnWqmgczVXslwU3kIvlMoNQuY7Fjd06Pkohsbzrnph3w4wiDvceRgGz8tWoemzP+fIYQao8x8Rrz+KgKVR9VsKwoWmtXn5n1PP/yOIXAAAA//8DAFBLAwQUAAYACAAAACEACa912d0AAAAKAQAADwAAAGRycy9kb3ducmV2LnhtbEyPwU7DMAyG70i8Q2QkbixtNLZRmk4ICU3iMtHtAbLGtBWNUzXp2r097glO9m//+v0538+uE1ccQutJQ7pKQCBV3rZUazifPp52IEI0ZE3nCTXcMMC+uL/LTWb9RF94LWMtOIRCZjQ0MfaZlKFq0Jmw8j0S77794ExkOdTSDmbicNdJlSQb6UxLfKExPb43WP2Uo9PQbin9HMv1LNPp5Xw6NofjbTxo/fgwv72CiDjHPzMs+IwOBTNd/Eg2iI51smXnUpUCsRie1zy5cKM2CmSRy/8vFL8AAAD//wMAUEsBAi0AFAAGAAgAAAAhALaDOJL+AAAA4QEAABMAAAAAAAAAAAAAAAAAAAAAAFtDb250ZW50X1R5cGVzXS54bWxQSwECLQAUAAYACAAAACEAOP0h/9YAAACUAQAACwAAAAAAAAAAAAAAAAAvAQAAX3JlbHMvLnJlbHNQSwECLQAUAAYACAAAACEAh6UFjD8CAACPBAAADgAAAAAAAAAAAAAAAAAuAgAAZHJzL2Uyb0RvYy54bWxQSwECLQAUAAYACAAAACEACa912d0AAAAKAQAADwAAAAAAAAAAAAAAAACZBAAAZHJzL2Rvd25yZXYueG1sUEsFBgAAAAAEAAQA8wAAAKMFAAAAAA==" stroked="f"> <v:path arrowok="t"/> <v:textbox inset="0,0,0,0"> <![if !mso]> <br />
<table cellpadding=0 cellspacing=0 width="100%"> <br />
<tr> <br />
<td><![endif]> <br />
<br />
<div> <br />
<br />
<p class=MsoCaption><br />
<br />
<span style='font-size:5.0pt;mso-bidi-font-size:9.0pt; color:red;font-style:normal;mso-bidi-font-style:italic'>https://static.igem.org/mediawiki/2014hs/1/1e/RegulatorypUV.jpg<br />
</span><br />
<br />
<span style='font-size:8.0pt;mso-bidi-font-size:12.0pt;mso-fareast-font-family: Calibri;mso-bidi-font-family:Arial;color:red;font-style:normal; mso-bidi-font-style:italic;mso-no-proof:yes'><o:p></o:p><br />
</span></p> <br />
</div> <![if !mso]><br />
</td> <br />
</tr> <br />
</table> <![endif]></v:textbox> <w:wrap type="square" anchorx="margin"/> </v:shape><![endif]--><![if !vml]><![endif]><b style='mso-bidi-font-weight: normal'><i><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;color:#365F91; mso-ansi-language:EN-US'><o:p></o:p><br />
</span></i></b></p> <br />
</td> <br />
<td width=123 valign=top style='width:92.4pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;background:#DBE5F1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-bidi-font-family:Arial; mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:BBa_I765001">BBa_I765001 </a><br />
</span></p><br />
</td> <br />
<td width=312 valign=top style='width:233.65pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;background:#DBE5F1;padding:0cm 5.4pt 0cm 5.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal;mso-element:frame;mso-element-frame-hspace:7.05pt;mso-element-wrap: around;mso-element-anchor-horizontal:margin;mso-element-left:right; mso-element-top:25.35pt;mso-height-rule:exactly'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>UV Promoter from iGEM Colombian Team 2007. Its length is 76bp. <br />
</span><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="https://2013.igem.org/Team:ITB_Indonesia">Tim ITB_Indonesia 2013</a> proved that this part worked for them.<b style='mso-bidi-font-weight:normal'><o:p></o:p></b><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:2;height:68.4pt'> <br />
<td width=123 valign=top style='width:91.9pt;border-top:solid #95B3D7 1.0pt; border-left:none;border-bottom:none;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-right-alt:solid #95B3D7 .5pt; background:white;padding:0cm 5.4pt 0cm 5.4pt;height:68.4pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><br />
<!--[if gte vml 1]><v:shape id="Text_x0020_Box_x0020_30" o:spid="_x0000_s1073" type="#_x0000_t202" style='position:absolute;left:0;text-align:left;margin-left:.35pt; margin-top:41.5pt;width:75.5pt;height:17.5pt;z-index:251662336;visibility:visible; mso-wrap-style:square;mso-width-percent:0;mso-height-percent:0; mso-wrap-distance-left:9pt;mso-wrap-distance-top:0; mso-wrap-distance-right:9pt;mso-wrap-distance-bottom:0; mso-position-horizontal:absolute;mso-position-horizontal-relative:text; mso-position-vertical:absolute;mso-position-vertical-relative:text; mso-width-percent:0;mso-height-percent:0;mso-width-relative:margin; mso-height-relative:margin;v-text-anchor:top' o:gfxdata="UEsDBBQABgAIAAAAIQC2gziS/gAAAOEBAAATAAAAW0NvbnRlbnRfVHlwZXNdLnhtbJSRQU7DMBBF90jcwfIWJU67QAgl6YK0S0CoHGBkTxKLZGx5TGhvj5O2G0SRWNoz/78nu9wcxkFMGNg6quQqL6RA0s5Y6ir5vt9lD1JwBDIwOMJKHpHlpr69KfdHjyxSmriSfYz+USnWPY7AufNIadK6MEJMx9ApD/oDOlTrorhX2lFEilmcO2RdNtjC5xDF9pCuTyYBB5bi6bQ4syoJ3g9WQ0ymaiLzg5KdCXlKLjvcW893SUOqXwnz5DrgnHtJTxOsQfEKIT7DmDSUCaxw7Rqn8787ZsmRM9e2VmPeBN4uqYvTtW7jvijg9N/yJsXecLq0q+WD6m8AAAD//wMAUEsDBBQABgAIAAAAIQA4/SH/1gAAAJQBAAALAAAAX3JlbHMvLnJlbHOkkMFqwzAMhu+DvYPRfXGawxijTi+j0GvpHsDYimMaW0Yy2fr2M4PBMnrbUb/Q94l/f/hMi1qRJVI2sOt6UJgd+ZiDgffL8ekFlFSbvV0oo4EbChzGx4f9GRdb25HMsYhqlCwG5lrLq9biZkxWOiqY22YiTra2kYMu1l1tQD30/bPm3wwYN0x18gb45AdQl1tp5j/sFB2T0FQ7R0nTNEV3j6o9feQzro1iOWA14Fm+Q8a1a8+Bvu/d/dMb2JY5uiPbhG/ktn4cqGU/er3pcvwCAAD//wMAUEsDBBQABgAIAAAAIQB6WpOSPwIAAI8EAAAOAAAAZHJzL2Uyb0RvYy54bWysVFFv0zAQfkfiP1h+p+mGBqNaOpVORUjVNmlDe3YdZ7FwfMZ2m5Rfz2cn2cbgCdEH9+z7fOf77rtcXPatYQflgyZb8pPZnDNlJVXaPpb82/3m3TlnIQpbCUNWlfyoAr9cvn1z0bmFOqWGTKU8QxAbFp0reROjWxRFkI1qRZiRUxbOmnwrIrb+sai86BC9NcXpfP6h6MhXzpNUIeD0anDyZY5f10rGm7oOKjJTcrwt5tXndZfWYnkhFo9euEbL8RniH17RCm2R9CnUlYiC7b3+I1SrpadAdZxJaguqay1VrgHVnMxfVXPXCKdyLSAnuCeawv8LK68Pt57pquTvQY8VLXp0r/rIPlPPcAR+OhcWgN05AGOPc/Q51xrcluT3AEjxAjNcCEAnPvrat+kflTJcRI7jE+0pjcThp7Pz8zN4JFyn+MFOMZ8vOx/iF0UtS0bJPbqaHyAO2xAH6ARJuQIZXW20MWmTHGvj2UFAAV2joxqD/4YyNmEtpVtDwOFEZQmNWVKRQ13Jiv2uz8R9nEjaUXUER54GlQUnNxrZtyLEW+EhK9SIUYk3WGpDXclptDhryP/823nCo9vwctZBpiUPP/bCK87MVwsdIGScDD8Zu8mw+3ZNqPsEQ+hkNnHBRzOZtaf2ARO0SlngElYiV8njZK7jMCyYQKlWqwyCcp2IW3vn5CSFxPJ9/yC8G3sU0dxrmgQsFq9aNWAHzlf7SLXOfUy8DiyOmoLqsxLGCU1j9XKfUc/fkeUvAAAA//8DAFBLAwQUAAYACAAAACEAFxfDStsAAAAHAQAADwAAAGRycy9kb3ducmV2LnhtbEyPzU7DMBCE70i8g7VI3Khj/hpCnAohoUpcKtI+gBsvcUS8jmKnSd+e7Qluuzuj2W/KzeJ7ccIxdoE0qFUGAqkJtqNWw2H/cZeDiMmQNX0g1HDGCJvq+qo0hQ0zfeGpTq3gEIqF0eBSGgopY+PQm7gKAxJr32H0JvE6ttKOZuZw38v7LHuW3nTEH5wZ8N1h81NPXkO3JvU51Y+LVPPLYb9z29152mp9e7O8vYJIuKQ/M1zwGR0qZjqGiWwUvYY1+zTkD1zooj4pPhx5UHkGsirlf/7qFwAA//8DAFBLAQItABQABgAIAAAAIQC2gziS/gAAAOEBAAATAAAAAAAAAAAAAAAAAAAAAABbQ29udGVudF9UeXBlc10ueG1sUEsBAi0AFAAGAAgAAAAhADj9If/WAAAAlAEAAAsAAAAAAAAAAAAAAAAALwEAAF9yZWxzLy5yZWxzUEsBAi0AFAAGAAgAAAAhAHpak5I/AgAAjwQAAA4AAAAAAAAAAAAAAAAALgIAAGRycy9lMm9Eb2MueG1sUEsBAi0AFAAGAAgAAAAhABcXw0rbAAAABwEAAA8AAAAAAAAAAAAAAAAAmQQAAGRycy9kb3ducmV2LnhtbFBLBQYAAAAABAAEAPMAAAChBQAAAAA=" stroked="f"> <v:path arrowok="t"/> <v:textbox inset="0,0,0,0"> <![if !mso]> <br />
<table cellpadding=0 cellspacing=0 width="100%"> <br />
<tr> <br />
<td><![endif]> <br />
<br />
<div> <br />
<br />
<p class=MsoCaption><br />
<br />
<span style='font-size:6.0pt;mso-bidi-font-size:9.0pt; color:red;font-style:normal;mso-bidi-font-style:italic'>https://static.igem.org/mediawiki/2014hs/1/17/RBSCIDEB.jpg<br />
</span><br />
<br />
<span style='mso-bidi-font-size:12.0pt;mso-fareast-font-family:Calibri; mso-bidi-font-family:Arial;color:red;font-style:normal;mso-bidi-font-style: italic;mso-no-proof:yes'><o:p></o:p><br />
</span></p> <br />
</div> <![if !mso]><br />
</td> <br />
</tr> <br />
</table> <![endif]></v:textbox> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><![endif]><br />
<!--[if gte vml 1]><v:shape id="Picture_x0020_29" o:spid="_x0000_s1072" type="#_x0000_t75" style='position:absolute; left:0;text-align:left;margin-left:15.1pt;margin-top:3.2pt;width:46.7pt; height:46.5pt;z-index:251660288;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:margin;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image005.png" o:title=""/> <w:wrap type="square" anchorx="margin"/> </v:shape><![endif]--><![if !vml]><img width=62 height=62 src="https://static.igem.org/mediawiki/2014hs/1/17/RBSCIDEB.jpg" align=left hspace=12 v:shapes="Picture_x0020_29"><![endif]><b style='mso-bidi-font-weight: normal'><i><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;color:#365F91; mso-ansi-language:EN-US'><o:p></o:p><br />
</span></i></b></p> <br />
</td> <br />
<td width=123 valign=top style='width:92.4pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:68.4pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-bidi-font-family:Arial; mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a><br />
</span></p><br />
</td> <br />
<td width=312 valign=top style='width:233.65pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:68.4pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;tab-stops:332.95pt;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-bidi-font-family:Arial; background:white;mso-ansi-language:EN-US'>Very common Ribosome Binding Site, based on Elowitz repressilator. Its length is 12bp<br />
</span><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-bidi-font-family:Arial; mso-ansi-language:EN-US'>.<br />
<br />
<span style='background:white'><o:p></o:p><br />
</span><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal;mso-element:frame;mso-element-frame-hspace:7.05pt;mso-element-wrap: around;mso-element-anchor-horizontal:margin;mso-element-left:right; mso-element-top:25.35pt;mso-height-rule:exactly'><b style='mso-bidi-font-weight: normal'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language: EN-US'><o:p>&nbsp;</o:p><br />
</span></b></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:3;height:57.35pt'> <br />
<td width=123 valign=top style='width:91.9pt;border-top:solid #95B3D7 1.0pt; border-left:none;border-bottom:none;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-right-alt:solid #95B3D7 .5pt; background:white;padding:0cm 5.4pt 0cm 5.4pt;height:57.35pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal;mso-element:frame;mso-element-frame-hspace:7.05pt;mso-element-wrap: around;mso-element-anchor-horizontal:margin;mso-element-left:right; mso-element-top:25.35pt;mso-height-rule:exactly'><br />
<!--[if gte vml 1]><v:shape id="Text_x0020_Box_x0020_28" o:spid="_x0000_s1071" type="#_x0000_t202" style='position:absolute;margin-left:3.4pt;margin-top:43pt;width:1in; height:8.15pt;z-index:251664384;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:margin; v-text-anchor:top' o:gfxdata="UEsDBBQABgAIAAAAIQC2gziS/gAAAOEBAAATAAAAW0NvbnRlbnRfVHlwZXNdLnhtbJSRQU7DMBBF90jcwfIWJU67QAgl6YK0S0CoHGBkTxKLZGx5TGhvj5O2G0SRWNoz/78nu9wcxkFMGNg6quQqL6RA0s5Y6ir5vt9lD1JwBDIwOMJKHpHlpr69KfdHjyxSmriSfYz+USnWPY7AufNIadK6MEJMx9ApD/oDOlTrorhX2lFEilmcO2RdNtjC5xDF9pCuTyYBB5bi6bQ4syoJ3g9WQ0ymaiLzg5KdCXlKLjvcW893SUOqXwnz5DrgnHtJTxOsQfEKIT7DmDSUCaxw7Rqn8787ZsmRM9e2VmPeBN4uqYvTtW7jvijg9N/yJsXecLq0q+WD6m8AAAD//wMAUEsDBBQABgAIAAAAIQA4/SH/1gAAAJQBAAALAAAAX3JlbHMvLnJlbHOkkMFqwzAMhu+DvYPRfXGawxijTi+j0GvpHsDYimMaW0Yy2fr2M4PBMnrbUb/Q94l/f/hMi1qRJVI2sOt6UJgd+ZiDgffL8ekFlFSbvV0oo4EbChzGx4f9GRdb25HMsYhqlCwG5lrLq9biZkxWOiqY22YiTra2kYMu1l1tQD30/bPm3wwYN0x18gb45AdQl1tp5j/sFB2T0FQ7R0nTNEV3j6o9feQzro1iOWA14Fm+Q8a1a8+Bvu/d/dMb2JY5uiPbhG/ktn4cqGU/er3pcvwCAAD//wMAUEsDBBQABgAIAAAAIQCTTmuvQAIAAI8EAAAOAAAAZHJzL2Uyb0RvYy54bWysVMFu2zAMvQ/YPwi6L3aydtiCOkWWIsOAoC2QDD0rshQLk0RNUmJnXz9KttOu22nYRaHJJ1J8fMzNbWc0OQkfFNiKTiclJcJyqJU9VPTbbv3uIyUhMlszDVZU9CwCvV28fXPTurmYQQO6Fp5gEhvmratoE6ObF0XgjTAsTMAJi0EJ3rCIn/5Q1J61mN3oYlaWH4oWfO08cBECeu/6IF3k/FIKHh+kDCISXVF8W8ynz+c+ncXihs0PnrlG8eEZ7B9eYZiyWPSS6o5FRo5e/ZHKKO4hgIwTDqYAKRUXuQfsZlq+6mbbMCdyL0hOcBeawv9Ly+9Pj56ouqIznJRlBme0E10kn6Ej6EJ+WhfmCNs6BMYO/Tjn3GtwG+DfA0KKF5j+QkB04qOT3qRf7JTgRRzB+UJ7KsPR+Wl6dVVihGNoWr6/Lq9T2eL5svMhfhFgSDIq6nGq+QHstAmxh46QVCuAVvVaaZ0+UmClPTkxVEDbqCiG5L+htE1YC+lWn7D3iCyhoUpqsu8rWbHbd5m4C0l7qM/IkYdeZcHxtcLqGxbiI/MoK+wRVyU+4CE1tBWFwaKkAf/zb/6Ex2ljlJIWZVrR8OPIvKBEf7Wog6Tp0fCjsR8NezQrwL6nuISOZxMv+KhHU3owT7hBy1QFQ8xyrFXROJqr2C8LbiAXy2UGoXIdixu7dXyUQmJ51z0x74YZRRzuPYwCZvNXo+qxPefLYwSp8hwTrz2Lg6ZQ9VkJw4amtXr5nVHP/yOLXwAAAP//AwBQSwMEFAAGAAgAAAAhAJrqGsvdAAAACAEAAA8AAABkcnMvZG93bnJldi54bWxMj8FOwzAQRO9I/IO1SNyok1JCCXEqhIQqcama9gPceIkj4nUUO036992e4La7M5p9U2xm14kzDqH1pCBdJCCQam9aahQcD19PaxAhajK684QKLhhgU97fFTo3fqI9nqvYCA6hkGsFNsY+lzLUFp0OC98jsfbjB6cjr0MjzaAnDnedXCZJJp1uiT9Y3eOnxfq3Gp2C9pXS77FazTKd3o6Hnd3uLuNWqceH+eMdRMQ5/pnhhs/oUDLTyY9kgugUZAweFawzbnSTXxI+nHhIls8gy0L+L1BeAQAA//8DAFBLAQItABQABgAIAAAAIQC2gziS/gAAAOEBAAATAAAAAAAAAAAAAAAAAAAAAABbQ29udGVudF9UeXBlc10ueG1sUEsBAi0AFAAGAAgAAAAhADj9If/WAAAAlAEAAAsAAAAAAAAAAAAAAAAALwEAAF9yZWxzLy5yZWxzUEsBAi0AFAAGAAgAAAAhAJNOa69AAgAAjwQAAA4AAAAAAAAAAAAAAAAALgIAAGRycy9lMm9Eb2MueG1sUEsBAi0AFAAGAAgAAAAhAJrqGsvdAAAACAEAAA8AAAAAAAAAAAAAAAAAmgQAAGRycy9kb3ducmV2LnhtbFBLBQYAAAAABAAEAPMAAACkBQAAAAA=" stroked="f"> <v:path arrowok="t"/> <v:textbox inset="0,0,0,0"> <![if !mso]> <br />
<table cellpadding=0 cellspacing=0 width="100%"> <br />
<tr> <br />
<td><![endif]> <br />
<br />
<div> <br />
<br />
<p class=MsoCaption><br />
<br />
<span lang=ES-MX style='font-size:3.0pt;mso-bidi-font-size: 9.0pt;color:red;mso-ansi-language:ES-MX'>https://static.igem.org/mediawiki/2014hs/3/3c/14CIDEB.jpg<br />
</span><br />
<br />
<span lang=ES-MX style='font-size:6.0pt;mso-bidi-font-size:12.0pt;mso-fareast-font-family: Calibri;mso-bidi-font-family:Arial;color:red;mso-ansi-language:ES-MX; mso-no-proof:yes'><o:p></o:p><br />
</span></p> <br />
</div> <![if !mso]><br />
</td> <br />
</tr> <br />
</table> <![endif]></v:textbox> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><![endif]><br />
<!--[if gte vml 1]><v:shape id="Picture_x0020_27" o:spid="_x0000_s1070" type="#_x0000_t75" style='position:absolute; margin-left:16.5pt;margin-top:3.1pt;width:47.45pt;height:40.5pt;z-index:251663360; visibility:visible;mso-wrap-style:square;mso-width-percent:0; mso-height-percent:0;mso-wrap-distance-left:9pt;mso-wrap-distance-top:0; mso-wrap-distance-right:9pt;mso-wrap-distance-bottom:0; mso-position-horizontal:absolute;mso-position-horizontal-relative:text; mso-position-vertical:absolute;mso-position-vertical-relative:text; mso-width-percent:0;mso-height-percent:0;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image007.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=63 height=54 src="https://static.igem.org/mediawiki/2014hs/3/3c/14CIDEB.jpg" align=center hspace=12 v:shapes="Picture_x0020_27"><![endif]><b style='mso-bidi-font-weight: normal'></b></p> <br />
</td> <br />
<td width=123 valign=top style='width:92.4pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;background:#DBE5F1;padding:0cm 5.4pt 0cm 5.4pt; height:57.35pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:BBa_1255000">BBa_1255000</a><o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'>&nbsp;</p><br />
</td> <br />
<td width=312 valign=top style='width:233.65pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;background:#DBE5F1;padding:0cm 5.4pt 0cm 5.4pt; height:57.35pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;tab-stops:332.95pt;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-bidi-font-family:Arial; mso-ansi-language:EN-US'>Putative protein that we, iGEM CIDEB 2014, are going to introduce to iGEM for the first time. Its length is 207bp.<o:p></o:p><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:4;height:49.65pt'> <br />
<td width=123 valign=top style='width:91.9pt;border-top:solid #95B3D7 1.0pt; border-left:none;border-bottom:none;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-right-alt:solid #95B3D7 .5pt; background:white;padding:0cm 5.4pt 0cm 5.4pt;height:49.65pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><br />
<!--[if gte vml 1]><v:shape id="_x0000_s1061" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:16.1pt;margin-top:.35pt;width:50.25pt;height:30.75pt; z-index:251667456;mso-position-horizontal-relative:text; mso-position-vertical-relative:text'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image009.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1061" DrawAspect="Content" ObjectID="_1464162124"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=67 height=41 src="https://static.igem.org/mediawiki/2014hs/d/da/Aroma_optCIDEB.jpg" align=left hspace=12 v:shapes="_x0000_s1061"><![endif]><i><br />
<br />
<span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;color:#365F91'> <o:p></o:p><br />
</span></i></p> <br />
</td> <br />
<td width=123 valign=top style='width:92.4pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:49.65pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:BBa_K1255000">BBa_K1255000</a><o:p></o:p><br />
</span></p> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal;mso-element:frame;mso-element-frame-hspace:7.05pt;mso-element-wrap: around;mso-element-anchor-horizontal:margin;mso-element-left:right; mso-element-top:25.35pt;mso-height-rule:exactly'><br />
<br />
<span style='font-size: 12.0pt;font-family:Oxygen;color:#365F91;mso-ansi-language:EN-US'><o:p></o:p><br />
</span></p> <br />
</td> <br />
<td width=312 valign=top style='width:233.65pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:49.65pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-element:frame;mso-element-frame-hspace:7.05pt; mso-element-wrap:around;mso-element-anchor-horizontal:margin;mso-element-left: right;mso-element-top:25.35pt;mso-height-rule:exactly'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'>Wintergreen-odor enzyme generator, used to allow the production of methyl salicylate, when it is induced by salicilyc acid. Its length is 1074bp.<b style='mso-bidi-font-weight: normal'><o:p></o:p></b><br />
</span></p> <br />
</td> <br />
</tr> <br />
<tr style='mso-yfti-irow:5;mso-yfti-lastrow:yes;height:49.65pt'> <br />
<td width=123 valign=top style='width:91.9pt;border-top:solid #95B3D7 1.0pt; border-left:none;border-bottom:none;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-right-alt:solid #95B3D7 .5pt; background:white;padding:0cm 5.4pt 0cm 5.4pt;height:49.65pt'> <br />
<br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><br />
<!--[if gte vml 1]><v:shape id="Picture_x0020_26" o:spid="_x0000_s1069" type="#_x0000_t75" style='position:absolute; left:0;text-align:left;margin-left:20.85pt;margin-top:1.65pt;width:32.65pt; height:34.35pt;z-index:251665408;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image010.png" o:title="" croptop="8327f" cropbottom="-1f"/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=44 height=46 src="https://static.igem.org/mediawiki/2014hs/1/12/StopCIDEB.jpg" align=left hspace=12 v:shapes="Picture_x0020_26"><![endif]><br />
<!--[if gte vml 1]><v:shape id="Text_x0020_Box_x0020_25" o:spid="_x0000_s1068" type="#_x0000_t202" style='position:absolute;left:0;text-align:left;margin-left:1.35pt; margin-top:36pt;width:1in;height:4.05pt;z-index:251666432;visibility:visible; mso-wrap-style:square;mso-width-percent:0;mso-height-percent:0; mso-wrap-distance-left:9pt;mso-wrap-distance-top:0; mso-wrap-distance-right:9pt;mso-wrap-distance-bottom:0; mso-position-horizontal:absolute;mso-position-horizontal-relative:margin; mso-position-vertical:absolute;mso-position-vertical-relative:text; mso-width-percent:0;mso-height-percent:0;mso-width-relative:page; mso-height-relative:margin;v-text-anchor:top' o:gfxdata="UEsDBBQABgAIAAAAIQC2gziS/gAAAOEBAAATAAAAW0NvbnRlbnRfVHlwZXNdLnhtbJSRQU7DMBBF90jcwfIWJU67QAgl6YK0S0CoHGBkTxKLZGx5TGhvj5O2G0SRWNoz/78nu9wcxkFMGNg6quQqL6RA0s5Y6ir5vt9lD1JwBDIwOMJKHpHlpr69KfdHjyxSmriSfYz+USnWPY7AufNIadK6MEJMx9ApD/oDOlTrorhX2lFEilmcO2RdNtjC5xDF9pCuTyYBB5bi6bQ4syoJ3g9WQ0ymaiLzg5KdCXlKLjvcW893SUOqXwnz5DrgnHtJTxOsQfEKIT7DmDSUCaxw7Rqn8787ZsmRM9e2VmPeBN4uqYvTtW7jvijg9N/yJsXecLq0q+WD6m8AAAD//wMAUEsDBBQABgAIAAAAIQA4/SH/1gAAAJQBAAALAAAAX3JlbHMvLnJlbHOkkMFqwzAMhu+DvYPRfXGawxijTi+j0GvpHsDYimMaW0Yy2fr2M4PBMnrbUb/Q94l/f/hMi1qRJVI2sOt6UJgd+ZiDgffL8ekFlFSbvV0oo4EbChzGx4f9GRdb25HMsYhqlCwG5lrLq9biZkxWOiqY22YiTra2kYMu1l1tQD30/bPm3wwYN0x18gb45AdQl1tp5j/sFB2T0FQ7R0nTNEV3j6o9feQzro1iOWA14Fm+Q8a1a8+Bvu/d/dMb2JY5uiPbhG/ktn4cqGU/er3pcvwCAAD//wMAUEsDBBQABgAIAAAAIQAv0j5WQgIAAI4EAAAOAAAAZHJzL2Uyb0RvYy54bWysVMFuGjEQvVfqP1i+lwVKqmaVJaJEVJVQEgminI3XZq3aHtc27NKv79jLkjTtqerFjGeeZ3bevOHmtjOaHIUPCmxFJ6MxJcJyqJXdV/Rpu/rwmZIQma2ZBisqehKB3s7fv7tpXSmm0ICuhSeYxIaydRVtYnRlUQTeCMPCCJywGJTgDYt49fui9qzF7EYX0/H4U9GCr50HLkJA710fpPOcX0rB44OUQUSiK4rfFvPp87lLZzG/YeXeM9cofv4M9g9fYZiyWPSS6o5FRg5e/ZHKKO4hgIwjDqYAKRUXuQfsZjJ+082mYU7kXpCc4C40hf+Xlt8fHz1RdUWnV5RYZnBGW9FF8gU6gi7kp3WhRNjGITB26Mc5516DWwP/HhBSvML0DwKiEx+d9Cb9YqcEH+IIThfaUxmOzuvJbDbGCMfQ1WT2MVctXt46H+JXAYYko6Ieh5rrs+M6xFSdlQMklQqgVb1SWqdLCiy1J0eGAmgbFUVqCV/8htI2YS2kV32494isoHOV1GPfVrJit+syb9cDRzuoT0iRh15kwfGVwuprFuIj86gqbBE3JT7gITW0FYWzRUkD/uff/AmPw8YoJS2qtKLhx4F5QYn+ZlEGSdKD4QdjNxj2YJaAfU9wBx3PJj7wUQ+m9GCecYEWqQqGmOVYq6JxMJex3xVcQC4WiwxC4ToW13bj+KCExPK2e2benWcUcbb3MOiXlW9G1WN7zheHCFLlOSZeexbPkkLR52GdFzRt1et7Rr38jcx/AQAA//8DAFBLAwQUAAYACAAAACEAq+OxZtwAAAAHAQAADwAAAGRycy9kb3ducmV2LnhtbEyPwWrDMBBE74X+g9hCb41sE+LE9TqUQgn0EurkAxRLtUytlbHk2Pn7bk7tcXaGmbflfnG9uJoxdJ4Q0lUCwlDjdUctwvn08bIFEaIirXpPBuFmAuyrx4dSFdrP9GWudWwFl1AoFIKNcSikDI01ToWVHwyx9+1HpyLLsZV6VDOXu15mSbKRTnXEC1YN5t2a5qeeHEKXU/o51etFpvPufDraw/E2HRCfn5a3VxDRLPEvDHd8RoeKmS5+Ih1Ej5DlHETIM/7obq83fLggbJMUZFXK//zVLwAAAP//AwBQSwECLQAUAAYACAAAACEAtoM4kv4AAADhAQAAEwAAAAAAAAAAAAAAAAAAAAAAW0NvbnRlbnRfVHlwZXNdLnhtbFBLAQItABQABgAIAAAAIQA4/SH/1gAAAJQBAAALAAAAAAAAAAAAAAAAAC8BAABfcmVscy8ucmVsc1BLAQItABQABgAIAAAAIQAv0j5WQgIAAI4EAAAOAAAAAAAAAAAAAAAAAC4CAABkcnMvZTJvRG9jLnhtbFBLAQItABQABgAIAAAAIQCr47Fm3AAAAAcBAAAPAAAAAAAAAAAAAAAAAJwEAABkcnMvZG93bnJldi54bWxQSwUGAAAAAAQABADzAAAApQUAAAAA" stroked="f"> <v:path arrowok="t"/> <v:textbox inset="0,0,0,0"> <![if !mso]> <br />
<table cellpadding=0 cellspacing=0 width="100%"> <br />
<tr> <br />
<td><![endif]> <br />
<br />
<div> <br />
<br />
<p class=MsoCaption><br />
<br />
<span lang=ES-MX style='font-size:3.0pt;mso-bidi-font-size: 9.0pt;color:red;mso-ansi-language:ES-MX'>https://static.igem.org/mediawiki/2014hs/1/12/StopCIDEB.jpg<br />
</span><b style='mso-bidi-font-weight:normal'><br />
<br />
<span lang=ES-MX style='font-size: 3.0pt;mso-bidi-font-size:9.0pt;mso-fareast-font-family:Calibri; color:red;mso-ansi-language:ES-MX;mso-no-proof:yes'><o:p></o:p><br />
</span></b></p> <br />
</div> <![if !mso]><br />
</td> <br />
</tr> <br />
</table> <![endif]></v:textbox> <w:wrap type="square" anchorx="margin"/> </v:shape><![endif]--><![if !vml]><![endif]><i><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;color:#365F91;mso-ansi-language:EN-US;mso-fareast-language: ES-MX;mso-no-proof:yes'><o:p></o:p><br />
</span></i></p> <br />
</td> <br />
<td width=123 valign=top style='width:92.4pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;background:#DBE5F1;padding:0cm 5.4pt 0cm 5.4pt; height:49.65pt'> <br />
<br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a><br />
</span><br />
<br />
<span style='font-size:12.0pt;font-family:Oxygen;mso-bidi-font-family:Arial; background:white;mso-ansi-language:EN-US'> <br />
</span></p><br />
</td> <br />
<td width=312 valign=top style='width:233.65pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;background:#DBE5F1;padding:0cm 5.4pt 0cm 5.4pt; height:49.65pt'> <br />
<br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal;mso-element:frame;mso-element-frame-hspace:7.05pt;mso-element-wrap: around;mso-element-anchor-horizontal:margin;mso-element-left:right; mso-element-top:25.35pt;mso-height-rule:exactly'><br />
<br />
<span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'>Part made of 6pb responsible for stopping transcription.<br />
<br />
<span style='color:#365F91'><o:p></o:p><br />
</span><br />
</span></p> <br />
</td> <br />
</tr><br />
</table><br />
</div></center><br />
<br />
<br><p><b>Bibliography</b></p><br />
<br />
<font size="2"><br />
<p>● Antiquity. (2013, January 31). <i>Part: BBa_B0034</i>. Retrieved May 1st, 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034">http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034</a></p><br />
<p>● BMM Cancer Research UK. <i>Interactive 3D Jigsaw</i>. Retrieved May 1st, 2014, from <a href="http://bmm.cancerresearchuk.org">bmm.cancerresearchuk.org</a></p><br />
<p>● Colombia Israel Team. (2007). <i>Part: BBa_I765001</i>. Retrieved April 1st, 2014, from <a href="http://parts.igem.org/Part:BBa_I765001">Part-BBa_I765001</a></p><br />
<p>● IGEM Colombian Team. (2007). <i>UV promoter</i>. Retrieved April 1st, 2014, from <a href="http://parts.igem.org/Part:BBa_I765001">http://parts.igem.org/Part:BBa_I765001</a></p><br />
<p>● IVEY Mark, KRULWICH Terry. (1994) <i>Sodium ion binding proteins</i>. Retrieved April 1st, 2014, from <a href="http://www.google.com.mx/patents/US5346815">http://www.google.com.mx/patents/US5346815</a></p><br />
<p>● Knight Lab. (2006). <i>Part: BBa_B1002</i>. Retrieved from <a href="http://parts.igem.org/Part:BBa_B1002">http://parts.igem.org/Part:BBa_B1002</a></p><br />
<p>● Predict Protein. <i>Request ID: 473277</i>. Retrieved May 3rd, 2014, from <a href="https://www.predictprotein.org">https://www.predictprotein.org</a></p><br />
<p>● Yeast Resource Center. <i>Protein Overview: gi|2209269.</i> Retrieved May 1st, 2014, from <a href="http://www.yeastrc.org/pdr/viewProtein.do?id=1296033">http://www.yeastrc.org/pdr/viewProtein.do?id=1296033</a></p></font><br />
<br />
<br><br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods
Team:CIDEB-UANL Mexico/labwork methods
2014-06-15T01:41:58Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_labwork}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Methods</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b>Capture Module</b></p><br />
<br />
<p><b>UV Experimentation</b></p><br />
<br />
<p>This experiment was designed in order to know if the UV promoter is working properly.</p><br />
<br />
<p><b>Procedure:</b></p><br />
<br />
<p><b>1.</b> Inoculate by streak 2 Petri dishes with NhaS DNA in pSB1C3 Red bacteria</p><br />
<p><b>2.</b> Repeat step 1 but with NhaS DNA in pSB1C3 White bacteria</p><br />
<p><b>3.</b> Let them grow during one day in the incubator at 37°C</p><br />
<p><b>4.</b> Expose the four Petri dishes to UV irradiation (302nm) during 2 hours</p><br />
<p><b>5.</b> Take photos each 10 minutes and wait for results. (You can also take video during the 2 hours instead of the photos)</p><br />
<br />
<p>Go to results</p><br />
<br />
<p><b>Viability in salt (experiment 1)</b></p><br />
<br />
<p>Bacteria transformed with the capture plasmid were inoculated in Petri dishes with different concentrations of salt</p><br />
<br />
<center><p><img width=380 height=260 src="https://2014hs.igem.org/File:Rojas_NhaS_experiment_1.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><center><b>Image 1. </b>All the 18 Petri dishes inoculated with NhaS Red in pSB1C3 of all the 9 used concentrations.</p></center><br />
<br><br />
<br />
<center><p><img width=380 height=260 src="https://2014hs.igem.org/File:Blancas_NhaS_experimen_1.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><center><b>Image 2. </b>All the 18 Petri dishes inoculated with NhaS White in pSB1C3 of all the 9 used concentrations.</p></center><br />
<br><br />
<br />
<center><p><img width=380 height=260 src="https://2014hs.igem.org/File:Control_Expriment_1_NhaS_.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><center><b>Image 3. </b>All the 18 Petri dishes inoculated with the Control bacteria of all the 9 used concentrations.</p></center><br />
<p>All the bacteria containing the NhaS in pSB1C3 (Red and White) survived to a 10% concentration of salt.</p> <br />
<p>None of the control group lived in any concentration of salt.</p><br />
<br><br />
<br />
<center><p><img width=262 height=403 src="https://2014hs.igem.org/File:Experiment_1_Maximum_concentration_of_salt..jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<p><center><b>Image 4. </b>Nine Petri dishes with the maximum concentration of salt (10%) used in this experiment. From up to bottom: NhaS Red in pSB1C3, NhaS White in pSB1C3 and the Control bacteria. </p></center><br />
<br><br />
<br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods
Team:CIDEB-UANL Mexico/labwork methods
2014-06-15T01:15:21Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_labwork}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Methods</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p><b>Capture Module</b></p><br />
<br />
<p><b>UV Experimentation</b></p><br />
<br />
<p>This experiment was designed in order to know if the UV promoter is working properly.</p><br />
<br />
<p><b>Procedure:</b></p><br />
<br />
<p><b>1.</b> Inoculate by streak 2 Petri dishes with NhaS DNA in pSB1C3 Red bacteria</p><br />
<p><b>2.</b> Repeat step 1 but with NhaS DNA in pSB1C3 White bacteria</p><br />
<p><b>3.</b> Let them grow during one day in the incubator at 37°C</p><br />
<p><b>4.</b> Expose the four Petri dishes to UV irradiation (302nm) during 2 hours</p><br />
<p><b>5.</b> Take photos each 10 minutes and wait for results. (You can also take video during the 2 hours instead of the photos)</p><br />
<br />
<p>Go to results</p><br />
<br />
<p><b>Viability in salt (experiment 1)</b></p><br />
<br />
<p>Bacteria transformed with the capture plasmid were inoculated in Petri dishes with different concentrations of salt</p><br />
<br />
<center><p><img width=379 height=258 src="https://2014hs.igem.org/File:Rojas_NhaS_experiment_1.jpg"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><center><b>Image 1. </b>All the 18 Petri dishes inoculated with NhaS Red in pSB1C3 of all the 9 used concentrations.</p></center><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_methods#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture
Team:CIDEB-UANL Mexico/project capture
2014-06-14T23:59:33Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Capture Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><tr><td><p>In order to desalinize water our project intends to capture sodium ions from saline water using a protein produced from the NhaS gene expression. NhaS is a putative protein from <i>Bacillus firmus</i> that is characterized by its ability to bind and sequestering sodium ions. It “can enhance the Na+ -resistance of antiporter- deficient strains by increasing the availability of Na+ to the integral membrane antiporters on the cytoplasmic side of the membrane and by sequestering Na+ while rate-limiting efflux mechanisms catalyze extrusion of the cation.” (Krulwich & Ivey, 1992)</p></td><td style="padding-left:12px;"><img width=131 height=127 src="https://static.igem.org/mediawiki/2014hs/e/ec/CapturemoduleCIDEB.jpg"/></td></tr></table><p>Research by Krulwich and Ivey (1992) supports that in its origin bacteria, NhaS works as a regulation pH homeostasis protein because it makes the cytoplasmic pH more acidic than the external medium, usually basic. The calculated weight of the protein is 7100 Daltons and the final protein product is very basic with a calculated pH of 12.</p> <p>Basically, NhaS enhance the resistance of bacteria to high saline conditions, regulates pH and captures sodium ions.</p><center><p><img width=396 height=248 src="https://static.igem.org/mediawiki/2014hs/6/67/CaptureCIDEB.jpg"align=center hspace=12 alt="IMG_0317"></p><p><b>Figure 1.</b> Patent US 5346815 A shows extracts of the <i>E. coli</i> EP432 transformed with pGEM <b>(fig. 4A)</b> and pGRVH <b>(fig. 4B)</b>. The first one is a control plasmid and the second a plasmid with the NhaS gene. Those are crude extracts that were shown by the effect of putting the bacteria to an SFBI excitation, which is a sodium-sensitive molecule used to measure intracellular Na+. Resuming, it shows in basic draws that the protein is expressed in <i>E. coli</i> and in what quantity according to the excitation level where it is exposed.</p></center><p><b>Research on NhaS</b></p><p>It is important to be familiarized with what it is being worked with, and since this putative gene has never been used at iGEM before, we did a lot of research on it. </p><p>The composition and form of a protein show relevant data about its actions and functions, that is why we investigated NhaS’ predicted type. We found in the modelling tool <a href="http://bmm.cancerresearchuk.org/~3djigsaw/">3D-JIGSAW</a> from <i>Cancer Research UK's</i> site that its possible protein or peptide type would be helix, coil or strand.</p><center><p><img width=617 height=260 src="https://static.igem.org/mediawiki/2014hs/5/54/PPRESULTS.jpg"align=center hspace=12 alt="IMG_0317"></p><p><b>Figure 2.</b> Interactive 3D-Jigsaw's result that indicates the predicted protein type of NhaS.</p></center><p>The previous information was confirmed in <i>Predict Protein</i> site.</p><center><p><img width=561 height=239 src="https://static.igem.org/mediawiki/2014hs/9/98/GraphsCIDEB.jpg"align=center hspace=12 alt="IMG_0317"></p><p><b>Figure 3.</b> Results given by </i>Predict Protein</i> showing the secondary structure composition and solvent accessibility of the putative NhaS gene.</p></center><center><p><img width=796 height=171 src="https://static.igem.org/mediawiki/2014hs/5/5b/PPCIDEB.jpg"align=center hspace=12 alt="IMG_0317"></p><p><b>Figure 4.</b> Results given by <i>Predict Protein</i> showing the predicted precise structure of the NhaS protein. </p></center><p>Based on the previous information we conclude that NhaS is most possible to be of the helix type. Being aware of the secondary structure of proteins is relevant, since hence, the protein folding mechanism can be taken into consideration.</p><p>According to Krulwich and Ivey (1992), the location of the protein is in the cytoplasmic side of the membrane, however, when we made our research, we found out that the protein is predicted to be highly non-cytoplasmic(Yeast Resource Center, 2014). We came out with a hypothesis in which NhaS would be located in the inner part of the membrane but on its cytoplasmic side. This would explain both predictions of both sources of information.</p><center><p><img width=391 height=411 src="https://static.igem.org/mediawiki/2014hs/3/32/ProteinCIDEB.jpg"align=center hspace=12 alt="IMG_0317"></p><p><b>Figure 5.</b> Predicted protein overview results from <i>Yeast Resource Center</i>.</p></center><p>As a “confirmation” for our hypothesis, <i>Predict Protein</i> site gave us the following result:</p><center><p><img width=180 height=110 src="https://static.igem.org/mediawiki/2014hs/2/28/PPCIDEB2.jpg"align=center hspace=12 alt="IMG_0317"></p><p><b>Figure 6.</b>“Predicted localization for the Bacteria domain: Inner Membrane (GO term ID: 0005886) Prediction confidence 76.”</p></center><p>Based on this predicted result and with the previous hypothesis we formulated, the team concluded that the protein would act in the cytoplasmic side of the inner membrane. This information was used for the understanding and explaining of the module, as well as for designing different animations.</p><p>Further information about NhaS can be found in its parts registry section.</p><br><p><b>How is NhaS gene activated?</b></p><table width=100%><tr><td><p><img width=52 height=66 src="https://static.igem.org/mediawiki/2014hs/e/e4/PUVCIDEB.jpg"/></p></td><td style="padding-left:12px;"><p>In our project we are going to activate NhaS’ production and functionability using a promoter from <a href="http://parts.igem.org/Part:BBa_I765001">iGEM Colombian Team 2007</a> that is regulated by UV irradiation and does not causes mutations in the bacteria(iGEM Colombian Team, 2007). We decided to use this type of promoter in order to have a control about the NhaS action in E. CARU, our project. With this, we can decide at which time NhaS is going to be activated. There were chosen UV rays as the initiator of the NhaS expression because they are present in normal conditions, since the mentioned UV promoter is activated under 360 wavelengths of light spectrum. The following table shows the result of the promoter under a bright field and a fluorescence microscope observing the GFP protein reporter glowing, according to Colombian Team 2007. </p></td></tr></table><center><p><img width=233 height=313 src="https://static.igem.org/mediawiki/2014hs/8/81/ResultsColombia.jpg"align=center hspace=12 alt="IMG_0317"></p><p><b>Figure 7.</b>Results of the BBa_I765001 UV promoter part according to Colombian Team 2007.</p></center><br><p><b>Other teams that used pUV </b></p><p>Before choosing the BBa_I765001 UV promoter the team reviewed the experiences by other participants with it, with the intention of assuring the maximum possible success rate if used in this module. The following table shows information about its usage with other teams.</p><div align=center><table border=1 cellspacing=0 cellpadding=0 style='border-collapse:collapse;border:none;mso-border-alt:solid #C2D69B .5pt; mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt;mso-border-insideh: .5pt solid #C2D69B;mso-border-insidev:.5pt solid #C2D69B'> <tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes'> <td width=170 valign=top style='width:127.35pt;border:solid #9BBB59 1.0pt; border-right:none;mso-border-top-alt:solid #9BBB59 .5pt;mso-border-left-alt: solid #9BBB59 .5pt;mso-border-bottom-alt:solid #9BBB59 .5pt;background:#9BBB59; padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><b><span style='font-size:12.0pt; color:white;mso-ansi-language:EN-US'>Team<o:p></o:p></span></b></p> </td> <td width=387 valign=top style='width:290.6pt;border:solid #9BBB59 1.0pt; border-left:none;mso-border-top-alt:solid #9BBB59 .5pt;mso-border-bottom-alt: solid #9BBB59 .5pt;mso-border-right-alt:solid #9BBB59 .5pt;background:#9BBB59; padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal'><b><span style='font-size:12.0pt; color:white;mso-ansi-language:EN-US'>Use<o:p></o:p></span></b></p> </td> </tr> <tr style='mso-yfti-irow:1;height:33.0pt'> <td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt;height:33.0pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><span lang=FR style='font-size:12.0pt;color:#4F81BD;mso-ansi-language: FR'><a href="https://2012.igem.org/Team:NYMU-Taipei">NYMU_Taiwan 2012</a></span></u></b><span lang=FR style='font-size:6.0pt;mso-bidi-font-size:12.0pt;mso-ansi-language:FR; mso-bidi-font-weight:bold'>:</span><b><span lang=FR style='font-size:12.0pt; mso-ansi-language:FR'><o:p></o:p></span></b></p> </td> <td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt; height:33.0pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><span style='font-size:12.0pt;mso-ansi-language:EN-US'>An UV induced promoter and a CDS of a testosterone-making gene.<o:p></o:p></span></p> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:2'> <td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><span style='font-size:12.0pt;color:#4F81BD;mso-ansi-language: EN-US'><a href="https://2013.igem.org/Team:ITB_Indonesia">ITB_Indonesia 2013</a></span></u></b><span style='font-size:6.0pt;mso-bidi-font-size:12.0pt;mso-ansi-language:EN-US; mso-bidi-font-weight:bold'>:<b> <o:p></o:p></b></span></p> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></b></p> </td> <td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><span style='font-size:12.0pt;mso-ansi-language:EN-US'>pUV and mCherry (BBa_J06702) to detect DNA damage.<o:p></o:p></span></p> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><span style='font-size:12.0pt;mso-ansi-language:EN-US'><o:p>&nbsp;</o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes'> <td width=170 valign=top style='width:127.35pt;border:solid #C2D69B 1.0pt; border-top:none;mso-border-top-alt:solid #C2D69B .5pt;mso-border-alt:solid #C2D69B .5pt; background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><u><span lang=ES-MX style='font-size:12.0pt;color:#4F81BD'><a href="https://2007.igem.org/wiki/index.php/Colombia-Israel_(ORT_Ebin_High_School)">Colombia_Israel 2007</a></span></u></b><span lang=ES-MX style='font-size:7.0pt;mso-bidi-font-size:12.0pt;mso-bidi-font-weight: bold'>:<b> <o:p></o:p></b></span></p> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><b><span lang=ES-MX style='font-size:12.0pt'><o:p>&nbsp;</o:p></span></b></p> </td> <td width=387 valign=top style='width:290.6pt;border-top:none;border-left: none;border-bottom:solid #C2D69B 1.0pt;border-right:solid #C2D69B 1.0pt; mso-border-top-alt:solid #C2D69B .5pt;mso-border-left-alt:solid #C2D69B .5pt; mso-border-alt:solid #C2D69B .5pt;background:#EAF1DD;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal'><span style='font-size:12.0pt;mso-ansi-language:EN-US'>Expression of the UV promoter in presence of UV irradiation light lead to the expression of the EYFP reporter.<o:p></o:p></span></p> </td> </tr></table></div><br><p><b>How to know there is any production?</b></p><p>In our ideal project we are going to propose an odor Wintergreen reporter for this module in order to know if there is any production of NhaS, that is our plan, but since Wintergreen has not been probed yet and NhaS is a putative protein we decided to test it physically with RFP, which is a simple and common reporter, in order to observe functional results in the tests for this specific segment of the project and obtaining conclusions about each one. Further information can be found in the <a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma">Aroma module </a>of our project. </p><center><p><img width=495 height=262 src="https://static.igem.org/mediawiki/2014hs/7/7d/TestCIDEB.jpg"align=center hspace=12 alt="IMG_0317"></p></center><br><p><b>Other teams that used NhaS and potential future uses</b></p><p>There are no teams that used this gene in the past. IGEM CIDEB 2014 is the first team that is going to synthesize, test and register it.</p> <p>We consider this to be useful for the scientific community in general. NhaS, as mentioned before, is a putative protein. Knowing specific results about its functions could be of great use for future projects. </p><p>The potential for future usage of this gene is great. As mentioned in the patent from Krulwich and Ivey (1992), the gene encoding NhaS can be introduced into cells to produce desalination bioreactors, can be introduced into plants as a transgene to produce plants that are resistant to sodium, may be used for treatments involving Na+ /K+ ATPase disorders, e.g., in heart disease, and may be introduced parenterally, preferably orally, to bind to and sequester dietary sodium. The possibilities are wide and promising.</p><br><p><b>NhaS part’s description</b></p><br><center><div><table border=1 cellspacing=0 cellpadding=0 style='border-collapse:collapse;border:none;mso-border-alt:solid #95B3D7 .5pt; mso-yfti-tbllook:1184;mso-table-lspace:7.05pt;margin-left:4.8pt;mso-table-rspace: 7.05pt;margin-right:4.8pt;mso-table-anchor-vertical:margin;mso-table-anchor-horizontal: margin;mso-table-left:right;mso-table-top:25.35pt;mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-border-insideh:.5pt solid #95B3D7;mso-border-insidev:.5pt solid #95B3D7'> <tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes'> <td width=123 valign=top style='width:91.9pt;border:none;border-bottom:solid #95B3D7 1.0pt; mso-border-bottom-alt:solid #95B3D7 .5pt;background:white;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><b><span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US; mso-bidi-font-style:italic'>IMAGE<i><o:p></o:p></i></span></b></p> </td> <td width=123 valign=top style='width:92.4pt;border:none;border-bottom:solid #95B3D7 1.0pt; mso-border-bottom-alt:solid #95B3D7 .5pt;background:white;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><b><span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'>CODE<o:p></o:p></span></b></p> </td> <td width=312 valign=top style='width:233.65pt;border:none;border-bottom: solid #95B3D7 1.0pt;mso-border-bottom-alt:solid #95B3D7 .5pt;background:white; padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><b><span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'>DESCRIPTION<o:p></o:p></span></b></p> </td> </tr> <tr style='mso-yfti-irow:1'> <td width=123 valign=top style='width:91.9pt;border:none;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-top-alt:solid #95B3D7 .5pt; mso-border-right-alt:solid #95B3D7 .5pt;background:white;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><!--[if gte vml 1]><v:shapetype id="_x0000_t75" coordsize="21600,21600" o:spt="75" o:preferrelative="t" path="m@4@5l@4@11@9@11@9@5xe" filled="f" stroked="f"> <v:stroke joinstyle="miter"/> <v:formulas> <v:f eqn="if lineDrawn pixelLineWidth 0"/> <v:f eqn="sum @0 1 0"/> <v:f eqn="sum 0 0 @1"/> <v:f eqn="prod @2 1 2"/> <v:f eqn="prod @3 21600 pixelWidth"/> <v:f eqn="prod @3 21600 pixelHeight"/> <v:f eqn="sum @0 0 1"/> <v:f eqn="prod @6 1 2"/> <v:f eqn="prod @7 21600 pixelWidth"/> <v:f eqn="sum @8 21600 0"/> <v:f eqn="prod @7 21600 pixelHeight"/> <v:f eqn="sum @10 21600 0"/> </v:formulas> <v:path o:extrusionok="f" gradientshapeok="t" o:connecttype="rect"/> <o:lock v:ext="edit" aspectratio="t"/> </v:shapetype><v:shape id="Picture_x0020_32" o:spid="_x0000_s1075" type="#_x0000_t75" style='position:absolute;left:0;text-align:left;margin-left:17.2pt; margin-top:0;width:50.55pt;height:54pt;z-index:251659264;visibility:visible; mso-wrap-style:square;mso-width-percent:0;mso-height-percent:0; mso-wrap-distance-left:9pt;mso-wrap-distance-top:0; mso-wrap-distance-right:9pt;mso-wrap-distance-bottom:0; mso-position-horizontal:absolute;mso-position-horizontal-relative:margin; mso-position-vertical:absolute;mso-position-vertical-relative:text; mso-width-percent:0;mso-height-percent:0;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="https://static.igem.org/mediawiki/2014hs/1/1e/RegulatorypUV.jpg" o:title=""/> <w:wrap type="square" anchorx="margin"/> </v:shape><![endif]--><![if !vml]><img width=67 height=72 src="https://static.igem.org/mediawiki/2014hs/1/1e/RegulatorypUV.jpg" align=left hspace=12 v:shapes="Picture_x0020_32"><![endif]><!--[if gte vml 1]><v:shapetype id="_x0000_t202" coordsize="21600,21600" o:spt="202" path="m,l,21600r21600,l21600,xe"> <v:stroke joinstyle="miter"/> <v:path gradientshapeok="t" o:connecttype="rect"/> </v:shapetype><v:shape id="Text_x0020_Box_x0020_31" o:spid="_x0000_s1074" type="#_x0000_t202" style='position:absolute;left:0;text-align:left; margin-left:5.35pt;margin-top:51.1pt;width:1in;height:12pt;z-index:251661312; visibility:visible;mso-wrap-style:square;mso-width-percent:0; mso-height-percent:0;mso-wrap-distance-left:9pt;mso-wrap-distance-top:0; mso-wrap-distance-right:9pt;mso-wrap-distance-bottom:0; mso-position-horizontal:absolute;mso-position-horizontal-relative:margin; mso-position-vertical:absolute;mso-position-vertical-relative:text; mso-width-percent:0;mso-height-percent:0;mso-width-relative:page; mso-height-relative:margin;v-text-anchor:top' o:gfxdata="UEsDBBQABgAIAAAAIQC2gziS/gAAAOEBAAATAAAAW0NvbnRlbnRfVHlwZXNdLnhtbJSRQU7DMBBF90jcwfIWJU67QAgl6YK0S0CoHGBkTxKLZGx5TGhvj5O2G0SRWNoz/78nu9wcxkFMGNg6quQqL6RA0s5Y6ir5vt9lD1JwBDIwOMJKHpHlpr69KfdHjyxSmriSfYz+USnWPY7AufNIadK6MEJMx9ApD/oDOlTrorhX2lFEilmcO2RdNtjC5xDF9pCuTyYBB5bi6bQ4syoJ3g9WQ0ymaiLzg5KdCXlKLjvcW893SUOqXwnz5DrgnHtJTxOsQfEKIT7DmDSUCaxw7Rqn8787ZsmRM9e2VmPeBN4uqYvTtW7jvijg9N/yJsXecLq0q+WD6m8AAAD//wMAUEsDBBQABgAIAAAAIQA4/SH/1gAAAJQBAAALAAAAX3JlbHMvLnJlbHOkkMFqwzAMhu+DvYPRfXGawxijTi+j0GvpHsDYimMaW0Yy2fr2M4PBMnrbUb/Q94l/f/hMi1qRJVI2sOt6UJgd+ZiDgffL8ekFlFSbvV0oo4EbChzGx4f9GRdb25HMsYhqlCwG5lrLq9biZkxWOiqY22YiTra2kYMu1l1tQD30/bPm3wwYN0x18gb45AdQl1tp5j/sFB2T0FQ7R0nTNEV3j6o9feQzro1iOWA14Fm+Q8a1a8+Bvu/d/dMb2JY5uiPbhG/ktn4cqGU/er3pcvwCAAD//wMAUEsDBBQABgAIAAAAIQCHpQWMPwIAAI8EAAAOAAAAZHJzL2Uyb0RvYy54bWysVMFu2zAMvQ/YPwi6L06yrtiMOkWWIsOAoC2QDD0rshQLk0RNUmJnXz9KttOu22nYRaHJJ1J8fMzNbWc0OQkfFNiKziZTSoTlUCt7qOi33frdR0pCZLZmGqyo6FkEert4++amdaWYQwO6Fp5gEhvK1lW0idGVRRF4IwwLE3DCYlCCNyzipz8UtWctZje6mE+n10ULvnYeuAgBvXd9kC5yfikFjw9SBhGJrii+LebT53OfzmJxw8qDZ65RfHgG+4dXGKYsFr2kumORkaNXf6QyinsIIOOEgylASsVF7gG7mU1fdbNtmBO5FyQnuAtN4f+l5fenR09UXdH3M0osMzijnegi+QwdQRfy07pQImzrEBg79OOcc6/BbYB/DwgpXmD6CwHRiY9OepN+sVOCF3EE5wvtqQxH56fZ1dUUIxxDsw/zZKecz5edD/GLAEOSUVGPU80PYKdNiD10hKRaAbSq10rr9JECK+3JiaEC2kZFMST/DaVtwlpIt/qEvUdkCQ1VUpN9X8mK3b7LxF2PJO2hPiNHHnqVBcfXCqtvWIiPzKOssEdclfiAh9TQVhQGi5IG/M+/+RMep41RSlqUaUXDjyPzghL91aIOkqZHw4/GfjTs0awA+8bR4muyiRd81KMpPZgn3KBlqoIhZjnWqmgczVXslwU3kIvlMoNQuY7Fjd06Pkohsbzrnph3w4wiDvceRgGz8tWoemzP+fIYQao8x8Rrz+KgKVR9VsKwoWmtXn5n1PP/yOIXAAAA//8DAFBLAwQUAAYACAAAACEACa912d0AAAAKAQAADwAAAGRycy9kb3ducmV2LnhtbEyPwU7DMAyG70i8Q2QkbixtNLZRmk4ICU3iMtHtAbLGtBWNUzXp2r097glO9m//+v0538+uE1ccQutJQ7pKQCBV3rZUazifPp52IEI0ZE3nCTXcMMC+uL/LTWb9RF94LWMtOIRCZjQ0MfaZlKFq0Jmw8j0S77794ExkOdTSDmbicNdJlSQb6UxLfKExPb43WP2Uo9PQbin9HMv1LNPp5Xw6NofjbTxo/fgwv72CiDjHPzMs+IwOBTNd/Eg2iI51smXnUpUCsRie1zy5cKM2CmSRy/8vFL8AAAD//wMAUEsBAi0AFAAGAAgAAAAhALaDOJL+AAAA4QEAABMAAAAAAAAAAAAAAAAAAAAAAFtDb250ZW50X1R5cGVzXS54bWxQSwECLQAUAAYACAAAACEAOP0h/9YAAACUAQAACwAAAAAAAAAAAAAAAAAvAQAAX3JlbHMvLnJlbHNQSwECLQAUAAYACAAAACEAh6UFjD8CAACPBAAADgAAAAAAAAAAAAAAAAAuAgAAZHJzL2Uyb0RvYy54bWxQSwECLQAUAAYACAAAACEACa912d0AAAAKAQAADwAAAAAAAAAAAAAAAACZBAAAZHJzL2Rvd25yZXYueG1sUEsFBgAAAAAEAAQA8wAAAKMFAAAAAA==" stroked="f"> <v:path arrowok="t"/> <v:textbox inset="0,0,0,0"> <![if !mso]> <table cellpadding=0 cellspacing=0 width="100%"> <tr> <td><![endif]> <div> <p class=MsoCaption><span style='font-size:5.0pt;mso-bidi-font-size:9.0pt; color:red;font-style:normal;mso-bidi-font-style:italic'>https://static.igem.org/mediawiki/2014hs/1/1e/RegulatorypUV.jpg</span><span style='font-size:8.0pt;mso-bidi-font-size:12.0pt;mso-fareast-font-family: Calibri;mso-bidi-font-family:Arial;color:red;font-style:normal; mso-bidi-font-style:italic;mso-no-proof:yes'><o:p></o:p></span></p> </div> <![if !mso]></td> </tr> </table> <![endif]></v:textbox> <w:wrap type="square" anchorx="margin"/> </v:shape><![endif]--><![if !vml]><![endif]><b style='mso-bidi-font-weight: normal'><i><span style='font-size:12.0pt;font-family:Oxygen;color:#365F91; mso-ansi-language:EN-US'><o:p></o:p></span></i></b></p> </td> <td width=123 valign=top style='width:92.4pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;background:#DBE5F1;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><span style='font-size:12.0pt;font-family:Oxygen;mso-bidi-font-family:Arial; mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:BBa_I765001">BBa_I765001 </a></span></p></td> <td width=312 valign=top style='width:233.65pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;background:#DBE5F1;padding:0cm 5.4pt 0cm 5.4pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal;mso-element:frame;mso-element-frame-hspace:7.05pt;mso-element-wrap: around;mso-element-anchor-horizontal:margin;mso-element-left:right; mso-element-top:25.35pt;mso-height-rule:exactly'><span style='font-size:12.0pt; font-family:Oxygen;mso-bidi-font-family:Arial;mso-ansi-language:EN-US'>UV Promoter from iGEM Colombian Team 2007. Its length is 76bp. </span><span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'>Tim ITB_Indonesia (2013) proved that this part worked for them.<b style='mso-bidi-font-weight:normal'><o:p></o:p></b></span></p> </td> </tr> <tr style='mso-yfti-irow:2;height:68.4pt'> <td width=123 valign=top style='width:91.9pt;border-top:solid #95B3D7 1.0pt; border-left:none;border-bottom:none;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-right-alt:solid #95B3D7 .5pt; background:white;padding:0cm 5.4pt 0cm 5.4pt;height:68.4pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><!--[if gte vml 1]><v:shape id="Text_x0020_Box_x0020_30" o:spid="_x0000_s1073" type="#_x0000_t202" style='position:absolute;left:0;text-align:left;margin-left:.35pt; margin-top:41.5pt;width:75.5pt;height:17.5pt;z-index:251662336;visibility:visible; mso-wrap-style:square;mso-width-percent:0;mso-height-percent:0; mso-wrap-distance-left:9pt;mso-wrap-distance-top:0; mso-wrap-distance-right:9pt;mso-wrap-distance-bottom:0; mso-position-horizontal:absolute;mso-position-horizontal-relative:text; mso-position-vertical:absolute;mso-position-vertical-relative:text; mso-width-percent:0;mso-height-percent:0;mso-width-relative:margin; mso-height-relative:margin;v-text-anchor:top' o:gfxdata="UEsDBBQABgAIAAAAIQC2gziS/gAAAOEBAAATAAAAW0NvbnRlbnRfVHlwZXNdLnhtbJSRQU7DMBBF90jcwfIWJU67QAgl6YK0S0CoHGBkTxKLZGx5TGhvj5O2G0SRWNoz/78nu9wcxkFMGNg6quQqL6RA0s5Y6ir5vt9lD1JwBDIwOMJKHpHlpr69KfdHjyxSmriSfYz+USnWPY7AufNIadK6MEJMx9ApD/oDOlTrorhX2lFEilmcO2RdNtjC5xDF9pCuTyYBB5bi6bQ4syoJ3g9WQ0ymaiLzg5KdCXlKLjvcW893SUOqXwnz5DrgnHtJTxOsQfEKIT7DmDSUCaxw7Rqn8787ZsmRM9e2VmPeBN4uqYvTtW7jvijg9N/yJsXecLq0q+WD6m8AAAD//wMAUEsDBBQABgAIAAAAIQA4/SH/1gAAAJQBAAALAAAAX3JlbHMvLnJlbHOkkMFqwzAMhu+DvYPRfXGawxijTi+j0GvpHsDYimMaW0Yy2fr2M4PBMnrbUb/Q94l/f/hMi1qRJVI2sOt6UJgd+ZiDgffL8ekFlFSbvV0oo4EbChzGx4f9GRdb25HMsYhqlCwG5lrLq9biZkxWOiqY22YiTra2kYMu1l1tQD30/bPm3wwYN0x18gb45AdQl1tp5j/sFB2T0FQ7R0nTNEV3j6o9feQzro1iOWA14Fm+Q8a1a8+Bvu/d/dMb2JY5uiPbhG/ktn4cqGU/er3pcvwCAAD//wMAUEsDBBQABgAIAAAAIQB6WpOSPwIAAI8EAAAOAAAAZHJzL2Uyb0RvYy54bWysVFFv0zAQfkfiP1h+p+mGBqNaOpVORUjVNmlDe3YdZ7FwfMZ2m5Rfz2cn2cbgCdEH9+z7fOf77rtcXPatYQflgyZb8pPZnDNlJVXaPpb82/3m3TlnIQpbCUNWlfyoAr9cvn1z0bmFOqWGTKU8QxAbFp0reROjWxRFkI1qRZiRUxbOmnwrIrb+sai86BC9NcXpfP6h6MhXzpNUIeD0anDyZY5f10rGm7oOKjJTcrwt5tXndZfWYnkhFo9euEbL8RniH17RCm2R9CnUlYiC7b3+I1SrpadAdZxJaguqay1VrgHVnMxfVXPXCKdyLSAnuCeawv8LK68Pt57pquTvQY8VLXp0r/rIPlPPcAR+OhcWgN05AGOPc/Q51xrcluT3AEjxAjNcCEAnPvrat+kflTJcRI7jE+0pjcThp7Pz8zN4JFyn+MFOMZ8vOx/iF0UtS0bJPbqaHyAO2xAH6ARJuQIZXW20MWmTHGvj2UFAAV2joxqD/4YyNmEtpVtDwOFEZQmNWVKRQ13Jiv2uz8R9nEjaUXUER54GlQUnNxrZtyLEW+EhK9SIUYk3WGpDXclptDhryP/823nCo9vwctZBpiUPP/bCK87MVwsdIGScDD8Zu8mw+3ZNqPsEQ+hkNnHBRzOZtaf2ARO0SlngElYiV8njZK7jMCyYQKlWqwyCcp2IW3vn5CSFxPJ9/yC8G3sU0dxrmgQsFq9aNWAHzlf7SLXOfUy8DiyOmoLqsxLGCU1j9XKfUc/fkeUvAAAA//8DAFBLAwQUAAYACAAAACEAFxfDStsAAAAHAQAADwAAAGRycy9kb3ducmV2LnhtbEyPzU7DMBCE70i8g7VI3Khj/hpCnAohoUpcKtI+gBsvcUS8jmKnSd+e7Qluuzuj2W/KzeJ7ccIxdoE0qFUGAqkJtqNWw2H/cZeDiMmQNX0g1HDGCJvq+qo0hQ0zfeGpTq3gEIqF0eBSGgopY+PQm7gKAxJr32H0JvE6ttKOZuZw38v7LHuW3nTEH5wZ8N1h81NPXkO3JvU51Y+LVPPLYb9z29152mp9e7O8vYJIuKQ/M1zwGR0qZjqGiWwUvYY1+zTkD1zooj4pPhx5UHkGsirlf/7qFwAA//8DAFBLAQItABQABgAIAAAAIQC2gziS/gAAAOEBAAATAAAAAAAAAAAAAAAAAAAAAABbQ29udGVudF9UeXBlc10ueG1sUEsBAi0AFAAGAAgAAAAhADj9If/WAAAAlAEAAAsAAAAAAAAAAAAAAAAALwEAAF9yZWxzLy5yZWxzUEsBAi0AFAAGAAgAAAAhAHpak5I/AgAAjwQAAA4AAAAAAAAAAAAAAAAALgIAAGRycy9lMm9Eb2MueG1sUEsBAi0AFAAGAAgAAAAhABcXw0rbAAAABwEAAA8AAAAAAAAAAAAAAAAAmQQAAGRycy9kb3ducmV2LnhtbFBLBQYAAAAABAAEAPMAAAChBQAAAAA=" stroked="f"> <v:path arrowok="t"/> <v:textbox inset="0,0,0,0"> <![if !mso]> <table cellpadding=0 cellspacing=0 width="100%"> <tr> <td><![endif]> <div> <p class=MsoCaption><span style='font-size:6.0pt;mso-bidi-font-size:9.0pt; color:red;font-style:normal;mso-bidi-font-style:italic'>https://static.igem.org/mediawiki/2014hs/1/17/RBSCIDEB.jpg</span><span style='mso-bidi-font-size:12.0pt;mso-fareast-font-family:Calibri; mso-bidi-font-family:Arial;color:red;font-style:normal;mso-bidi-font-style: italic;mso-no-proof:yes'><o:p></o:p></span></p> </div> <![if !mso]></td> </tr> </table> <![endif]></v:textbox> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><![endif]><!--[if gte vml 1]><v:shape id="Picture_x0020_29" o:spid="_x0000_s1072" type="#_x0000_t75" style='position:absolute; left:0;text-align:left;margin-left:15.1pt;margin-top:3.2pt;width:46.7pt; height:46.5pt;z-index:251660288;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:margin;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image005.png" o:title=""/> <w:wrap type="square" anchorx="margin"/> </v:shape><![endif]--><![if !vml]><img width=62 height=62 src="https://static.igem.org/mediawiki/2014hs/1/17/RBSCIDEB.jpg" align=left hspace=12 v:shapes="Picture_x0020_29"><![endif]><b style='mso-bidi-font-weight: normal'><i><span style='font-size:12.0pt;font-family:Oxygen;color:#365F91; mso-ansi-language:EN-US'><o:p></o:p></span></i></b></p> </td> <td width=123 valign=top style='width:92.4pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:68.4pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><span style='font-size:12.0pt;font-family:Oxygen;mso-bidi-font-family:Arial; mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a></span></p></td> <td width=312 valign=top style='width:233.65pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:68.4pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;tab-stops:332.95pt;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><span style='font-size:12.0pt;font-family:Oxygen;mso-bidi-font-family:Arial; background:white;mso-ansi-language:EN-US'>Very common Ribosome Binding Site, based on Elowitz repressilator. Its length is 12bp</span><span style='font-size:12.0pt;font-family:Oxygen;mso-bidi-font-family:Arial; mso-ansi-language:EN-US'>.<span style='background:white'><o:p></o:p></span></span></p> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal;mso-element:frame;mso-element-frame-hspace:7.05pt;mso-element-wrap: around;mso-element-anchor-horizontal:margin;mso-element-left:right; mso-element-top:25.35pt;mso-height-rule:exactly'><b style='mso-bidi-font-weight: normal'><span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language: EN-US'><o:p>&nbsp;</o:p></span></b></p> </td> </tr> <tr style='mso-yfti-irow:3;height:57.35pt'> <td width=123 valign=top style='width:91.9pt;border-top:solid #95B3D7 1.0pt; border-left:none;border-bottom:none;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-right-alt:solid #95B3D7 .5pt; background:white;padding:0cm 5.4pt 0cm 5.4pt;height:57.35pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal;mso-element:frame;mso-element-frame-hspace:7.05pt;mso-element-wrap: around;mso-element-anchor-horizontal:margin;mso-element-left:right; mso-element-top:25.35pt;mso-height-rule:exactly'><!--[if gte vml 1]><v:shape id="Text_x0020_Box_x0020_28" o:spid="_x0000_s1071" type="#_x0000_t202" style='position:absolute;margin-left:3.4pt;margin-top:43pt;width:1in; height:8.15pt;z-index:251664384;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:margin; v-text-anchor:top' o:gfxdata="UEsDBBQABgAIAAAAIQC2gziS/gAAAOEBAAATAAAAW0NvbnRlbnRfVHlwZXNdLnhtbJSRQU7DMBBF90jcwfIWJU67QAgl6YK0S0CoHGBkTxKLZGx5TGhvj5O2G0SRWNoz/78nu9wcxkFMGNg6quQqL6RA0s5Y6ir5vt9lD1JwBDIwOMJKHpHlpr69KfdHjyxSmriSfYz+USnWPY7AufNIadK6MEJMx9ApD/oDOlTrorhX2lFEilmcO2RdNtjC5xDF9pCuTyYBB5bi6bQ4syoJ3g9WQ0ymaiLzg5KdCXlKLjvcW893SUOqXwnz5DrgnHtJTxOsQfEKIT7DmDSUCaxw7Rqn8787ZsmRM9e2VmPeBN4uqYvTtW7jvijg9N/yJsXecLq0q+WD6m8AAAD//wMAUEsDBBQABgAIAAAAIQA4/SH/1gAAAJQBAAALAAAAX3JlbHMvLnJlbHOkkMFqwzAMhu+DvYPRfXGawxijTi+j0GvpHsDYimMaW0Yy2fr2M4PBMnrbUb/Q94l/f/hMi1qRJVI2sOt6UJgd+ZiDgffL8ekFlFSbvV0oo4EbChzGx4f9GRdb25HMsYhqlCwG5lrLq9biZkxWOiqY22YiTra2kYMu1l1tQD30/bPm3wwYN0x18gb45AdQl1tp5j/sFB2T0FQ7R0nTNEV3j6o9feQzro1iOWA14Fm+Q8a1a8+Bvu/d/dMb2JY5uiPbhG/ktn4cqGU/er3pcvwCAAD//wMAUEsDBBQABgAIAAAAIQCTTmuvQAIAAI8EAAAOAAAAZHJzL2Uyb0RvYy54bWysVMFu2zAMvQ/YPwi6L3aydtiCOkWWIsOAoC2QDD0rshQLk0RNUmJnXz9KttOu22nYRaHJJ1J8fMzNbWc0OQkfFNiKTiclJcJyqJU9VPTbbv3uIyUhMlszDVZU9CwCvV28fXPTurmYQQO6Fp5gEhvmratoE6ObF0XgjTAsTMAJi0EJ3rCIn/5Q1J61mN3oYlaWH4oWfO08cBECeu/6IF3k/FIKHh+kDCISXVF8W8ynz+c+ncXihs0PnrlG8eEZ7B9eYZiyWPSS6o5FRo5e/ZHKKO4hgIwTDqYAKRUXuQfsZlq+6mbbMCdyL0hOcBeawv9Ly+9Pj56ouqIznJRlBme0E10kn6Ej6EJ+WhfmCNs6BMYO/Tjn3GtwG+DfA0KKF5j+QkB04qOT3qRf7JTgRRzB+UJ7KsPR+Wl6dVVihGNoWr6/Lq9T2eL5svMhfhFgSDIq6nGq+QHstAmxh46QVCuAVvVaaZ0+UmClPTkxVEDbqCiG5L+htE1YC+lWn7D3iCyhoUpqsu8rWbHbd5m4C0l7qM/IkYdeZcHxtcLqGxbiI/MoK+wRVyU+4CE1tBWFwaKkAf/zb/6Ex2ljlJIWZVrR8OPIvKBEf7Wog6Tp0fCjsR8NezQrwL6nuISOZxMv+KhHU3owT7hBy1QFQ8xyrFXROJqr2C8LbiAXy2UGoXIdixu7dXyUQmJ51z0x74YZRRzuPYwCZvNXo+qxPefLYwSp8hwTrz2Lg6ZQ9VkJw4amtXr5nVHP/yOLXwAAAP//AwBQSwMEFAAGAAgAAAAhAJrqGsvdAAAACAEAAA8AAABkcnMvZG93bnJldi54bWxMj8FOwzAQRO9I/IO1SNyok1JCCXEqhIQqcama9gPceIkj4nUUO036992e4La7M5p9U2xm14kzDqH1pCBdJCCQam9aahQcD19PaxAhajK684QKLhhgU97fFTo3fqI9nqvYCA6hkGsFNsY+lzLUFp0OC98jsfbjB6cjr0MjzaAnDnedXCZJJp1uiT9Y3eOnxfq3Gp2C9pXS77FazTKd3o6Hnd3uLuNWqceH+eMdRMQ5/pnhhs/oUDLTyY9kgugUZAweFawzbnSTXxI+nHhIls8gy0L+L1BeAQAA//8DAFBLAQItABQABgAIAAAAIQC2gziS/gAAAOEBAAATAAAAAAAAAAAAAAAAAAAAAABbQ29udGVudF9UeXBlc10ueG1sUEsBAi0AFAAGAAgAAAAhADj9If/WAAAAlAEAAAsAAAAAAAAAAAAAAAAALwEAAF9yZWxzLy5yZWxzUEsBAi0AFAAGAAgAAAAhAJNOa69AAgAAjwQAAA4AAAAAAAAAAAAAAAAALgIAAGRycy9lMm9Eb2MueG1sUEsBAi0AFAAGAAgAAAAhAJrqGsvdAAAACAEAAA8AAAAAAAAAAAAAAAAAmgQAAGRycy9kb3ducmV2LnhtbFBLBQYAAAAABAAEAPMAAACkBQAAAAA=" stroked="f"> <v:path arrowok="t"/> <v:textbox inset="0,0,0,0"> <![if !mso]> <table cellpadding=0 cellspacing=0 width="100%"> <tr> <td><![endif]> <div> <p class=MsoCaption><span lang=ES-MX style='font-size:3.0pt;mso-bidi-font-size: 9.0pt;color:red;mso-ansi-language:ES-MX'>https://static.igem.org/mediawiki/2014hs/3/3c/14CIDEB.jpg</span><span lang=ES-MX style='font-size:6.0pt;mso-bidi-font-size:12.0pt;mso-fareast-font-family: Calibri;mso-bidi-font-family:Arial;color:red;mso-ansi-language:ES-MX; mso-no-proof:yes'><o:p></o:p></span></p> </div> <![if !mso]></td> </tr> </table> <![endif]></v:textbox> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><![endif]><!--[if gte vml 1]><v:shape id="Picture_x0020_27" o:spid="_x0000_s1070" type="#_x0000_t75" style='position:absolute; margin-left:16.5pt;margin-top:3.1pt;width:47.45pt;height:40.5pt;z-index:251663360; visibility:visible;mso-wrap-style:square;mso-width-percent:0; mso-height-percent:0;mso-wrap-distance-left:9pt;mso-wrap-distance-top:0; mso-wrap-distance-right:9pt;mso-wrap-distance-bottom:0; mso-position-horizontal:absolute;mso-position-horizontal-relative:text; mso-position-vertical:absolute;mso-position-vertical-relative:text; mso-width-percent:0;mso-height-percent:0;mso-width-relative:page; mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image007.png" o:title=""/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=63 height=54 src="https://static.igem.org/mediawiki/2014hs/3/3c/14CIDEB.jpg" align=center hspace=12 v:shapes="Picture_x0020_27"><![endif]><b style='mso-bidi-font-weight: normal'></b></p> </td> <td width=123 valign=top style='width:92.4pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;background:#DBE5F1;padding:0cm 5.4pt 0cm 5.4pt; height:57.35pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:BBa_1255000">BBa_1255000</a><o:p></o:p></span></p> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'>&nbsp;</p></td> <td width=312 valign=top style='width:233.65pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;background:#DBE5F1;padding:0cm 5.4pt 0cm 5.4pt; height:57.35pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;tab-stops:332.95pt;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><span style='font-size:12.0pt;font-family:Oxygen;mso-bidi-font-family:Arial; mso-ansi-language:EN-US'>Putative protein that we, iGEM CIDEB 2014, are going to introduce to iGEM for the first time. Its length is 207bp.<o:p></o:p></span></p> </td> </tr> <tr style='mso-yfti-irow:4;height:49.65pt'> <td width=123 valign=top style='width:91.9pt;border-top:solid #95B3D7 1.0pt; border-left:none;border-bottom:none;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-right-alt:solid #95B3D7 .5pt; background:white;padding:0cm 5.4pt 0cm 5.4pt;height:49.65pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><!--[if gte vml 1]><v:shape id="_x0000_s1061" type="#_x0000_t75" style='position:absolute;left:0; text-align:left;margin-left:16.1pt;margin-top:.35pt;width:50.25pt;height:30.75pt; z-index:251667456;mso-position-horizontal-relative:text; mso-position-vertical-relative:text'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image009.png" o:title=""/> <w:wrap type="square"/> </v:shape><![if gte mso 9]><o:OLEObject Type="Embed" ProgID="PBrush" ShapeID="_x0000_s1061" DrawAspect="Content" ObjectID="_1464162124"> </o:OLEObject> <![endif]><![endif]--><![if !vml]><img width=67 height=41 src="https://static.igem.org/mediawiki/2014hs/d/da/Aroma_optCIDEB.jpg" align=left hspace=12 v:shapes="_x0000_s1061"><![endif]><i><span lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;color:#365F91'> <o:p></o:p></span></i></p> </td> <td width=123 valign=top style='width:92.4pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:49.65pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:BBa_K1255001">BBa_K1255001</a><o:p></o:p></span></p> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal;mso-element:frame;mso-element-frame-hspace:7.05pt;mso-element-wrap: around;mso-element-anchor-horizontal:margin;mso-element-left:right; mso-element-top:25.35pt;mso-height-rule:exactly'><span style='font-size: 12.0pt;font-family:Oxygen;color:#365F91;mso-ansi-language:EN-US'><o:p></o:p></span></p> </td> <td width=312 valign=top style='width:233.65pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;padding:0cm 5.4pt 0cm 5.4pt;height:49.65pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align: justify;line-height:normal;mso-element:frame;mso-element-frame-hspace:7.05pt; mso-element-wrap:around;mso-element-anchor-horizontal:margin;mso-element-left: right;mso-element-top:25.35pt;mso-height-rule:exactly'><span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'>Wintergreen-odor enzyme generator, used to allow the production of methyl salicylate, when it is induced by salicilyc acid. Its length is 1074bp.<b style='mso-bidi-font-weight: normal'><o:p></o:p></b></span></p> </td> </tr> <tr style='mso-yfti-irow:5;mso-yfti-lastrow:yes;height:49.65pt'> <td width=123 valign=top style='width:91.9pt;border-top:solid #95B3D7 1.0pt; border-left:none;border-bottom:none;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-right-alt:solid #95B3D7 .5pt; background:white;padding:0cm 5.4pt 0cm 5.4pt;height:49.65pt'> <p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:right;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><!--[if gte vml 1]><v:shape id="Picture_x0020_26" o:spid="_x0000_s1069" type="#_x0000_t75" style='position:absolute; left:0;text-align:left;margin-left:20.85pt;margin-top:1.65pt;width:32.65pt; height:34.35pt;z-index:251665408;visibility:visible;mso-wrap-style:square; mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt; mso-wrap-distance-top:0;mso-wrap-distance-right:9pt; mso-wrap-distance-bottom:0;mso-position-horizontal:absolute; mso-position-horizontal-relative:text;mso-position-vertical:absolute; mso-position-vertical-relative:text;mso-width-percent:0; mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'> <v:imagedata src="Tablas%20Capture%20y%20Binding_archivos/image010.png" o:title="" croptop="8327f" cropbottom="-1f"/> <w:wrap type="square"/> </v:shape><![endif]--><![if !vml]><img width=44 height=46 src="https://static.igem.org/mediawiki/2014hs/1/12/StopCIDEB.jpg" align=left hspace=12 v:shapes="Picture_x0020_26"><![endif]><!--[if gte vml 1]><v:shape id="Text_x0020_Box_x0020_25" o:spid="_x0000_s1068" type="#_x0000_t202" style='position:absolute;left:0;text-align:left;margin-left:1.35pt; margin-top:36pt;width:1in;height:4.05pt;z-index:251666432;visibility:visible; mso-wrap-style:square;mso-width-percent:0;mso-height-percent:0; mso-wrap-distance-left:9pt;mso-wrap-distance-top:0; mso-wrap-distance-right:9pt;mso-wrap-distance-bottom:0; mso-position-horizontal:absolute;mso-position-horizontal-relative:margin; mso-position-vertical:absolute;mso-position-vertical-relative:text; mso-width-percent:0;mso-height-percent:0;mso-width-relative:page; mso-height-relative:margin;v-text-anchor:top' o:gfxdata="UEsDBBQABgAIAAAAIQC2gziS/gAAAOEBAAATAAAAW0NvbnRlbnRfVHlwZXNdLnhtbJSRQU7DMBBF90jcwfIWJU67QAgl6YK0S0CoHGBkTxKLZGx5TGhvj5O2G0SRWNoz/78nu9wcxkFMGNg6quQqL6RA0s5Y6ir5vt9lD1JwBDIwOMJKHpHlpr69KfdHjyxSmriSfYz+USnWPY7AufNIadK6MEJMx9ApD/oDOlTrorhX2lFEilmcO2RdNtjC5xDF9pCuTyYBB5bi6bQ4syoJ3g9WQ0ymaiLzg5KdCXlKLjvcW893SUOqXwnz5DrgnHtJTxOsQfEKIT7DmDSUCaxw7Rqn8787ZsmRM9e2VmPeBN4uqYvTtW7jvijg9N/yJsXecLq0q+WD6m8AAAD//wMAUEsDBBQABgAIAAAAIQA4/SH/1gAAAJQBAAALAAAAX3JlbHMvLnJlbHOkkMFqwzAMhu+DvYPRfXGawxijTi+j0GvpHsDYimMaW0Yy2fr2M4PBMnrbUb/Q94l/f/hMi1qRJVI2sOt6UJgd+ZiDgffL8ekFlFSbvV0oo4EbChzGx4f9GRdb25HMsYhqlCwG5lrLq9biZkxWOiqY22YiTra2kYMu1l1tQD30/bPm3wwYN0x18gb45AdQl1tp5j/sFB2T0FQ7R0nTNEV3j6o9feQzro1iOWA14Fm+Q8a1a8+Bvu/d/dMb2JY5uiPbhG/ktn4cqGU/er3pcvwCAAD//wMAUEsDBBQABgAIAAAAIQAv0j5WQgIAAI4EAAAOAAAAZHJzL2Uyb0RvYy54bWysVMFuGjEQvVfqP1i+lwVKqmaVJaJEVJVQEgminI3XZq3aHtc27NKv79jLkjTtqerFjGeeZ3bevOHmtjOaHIUPCmxFJ6MxJcJyqJXdV/Rpu/rwmZIQma2ZBisqehKB3s7fv7tpXSmm0ICuhSeYxIaydRVtYnRlUQTeCMPCCJywGJTgDYt49fui9qzF7EYX0/H4U9GCr50HLkJA710fpPOcX0rB44OUQUSiK4rfFvPp87lLZzG/YeXeM9cofv4M9g9fYZiyWPSS6o5FRg5e/ZHKKO4hgIwjDqYAKRUXuQfsZjJ+082mYU7kXpCc4C40hf+Xlt8fHz1RdUWnV5RYZnBGW9FF8gU6gi7kp3WhRNjGITB26Mc5516DWwP/HhBSvML0DwKiEx+d9Cb9YqcEH+IIThfaUxmOzuvJbDbGCMfQ1WT2MVctXt46H+JXAYYko6Ieh5rrs+M6xFSdlQMklQqgVb1SWqdLCiy1J0eGAmgbFUVqCV/8htI2YS2kV32494isoHOV1GPfVrJit+syb9cDRzuoT0iRh15kwfGVwuprFuIj86gqbBE3JT7gITW0FYWzRUkD/uff/AmPw8YoJS2qtKLhx4F5QYn+ZlEGSdKD4QdjNxj2YJaAfU9wBx3PJj7wUQ+m9GCecYEWqQqGmOVYq6JxMJex3xVcQC4WiwxC4ToW13bj+KCExPK2e2benWcUcbb3MOiXlW9G1WN7zheHCFLlOSZeexbPkkLR52GdFzRt1et7Rr38jcx/AQAA//8DAFBLAwQUAAYACAAAACEAq+OxZtwAAAAHAQAADwAAAGRycy9kb3ducmV2LnhtbEyPwWrDMBBE74X+g9hCb41sE+LE9TqUQgn0EurkAxRLtUytlbHk2Pn7bk7tcXaGmbflfnG9uJoxdJ4Q0lUCwlDjdUctwvn08bIFEaIirXpPBuFmAuyrx4dSFdrP9GWudWwFl1AoFIKNcSikDI01ToWVHwyx9+1HpyLLsZV6VDOXu15mSbKRTnXEC1YN5t2a5qeeHEKXU/o51etFpvPufDraw/E2HRCfn5a3VxDRLPEvDHd8RoeKmS5+Ih1Ej5DlHETIM/7obq83fLggbJMUZFXK//zVLwAAAP//AwBQSwECLQAUAAYACAAAACEAtoM4kv4AAADhAQAAEwAAAAAAAAAAAAAAAAAAAAAAW0NvbnRlbnRfVHlwZXNdLnhtbFBLAQItABQABgAIAAAAIQA4/SH/1gAAAJQBAAALAAAAAAAAAAAAAAAAAC8BAABfcmVscy8ucmVsc1BLAQItABQABgAIAAAAIQAv0j5WQgIAAI4EAAAOAAAAAAAAAAAAAAAAAC4CAABkcnMvZTJvRG9jLnhtbFBLAQItABQABgAIAAAAIQCr47Fm3AAAAAcBAAAPAAAAAAAAAAAAAAAAAJwEAABkcnMvZG93bnJldi54bWxQSwUGAAAAAAQABADzAAAApQUAAAAA" stroked="f"> <v:path arrowok="t"/> <v:textbox inset="0,0,0,0"> <![if !mso]> <table cellpadding=0 cellspacing=0 width="100%"> <tr> <td><![endif]> <div> <p class=MsoCaption><span lang=ES-MX style='font-size:3.0pt;mso-bidi-font-size: 9.0pt;color:red;mso-ansi-language:ES-MX'>https://static.igem.org/mediawiki/2014hs/1/12/StopCIDEB.jpg</span><b style='mso-bidi-font-weight:normal'><span lang=ES-MX style='font-size: 3.0pt;mso-bidi-font-size:9.0pt;mso-fareast-font-family:Calibri; color:red;mso-ansi-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></b></p> </div> <![if !mso]></td> </tr> </table> <![endif]></v:textbox> <w:wrap type="square" anchorx="margin"/> </v:shape><![endif]--><![if !vml]><![endif]><i><span style='font-size:12.0pt; font-family:Oxygen;color:#365F91;mso-ansi-language:EN-US;mso-fareast-language: ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p> </td> <td width=123 valign=top style='width:92.4pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;background:#DBE5F1;padding:0cm 5.4pt 0cm 5.4pt; height:49.65pt'> <p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt; text-align:center;line-height:normal;mso-element:frame;mso-element-frame-hspace: 7.05pt;mso-element-wrap:around;mso-element-anchor-horizontal:margin; mso-element-left:right;mso-element-top:25.35pt;mso-height-rule:exactly'><span style='font-size:12.0pt;font-family:Oxygen;mso-ansi-language:EN-US'><a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a></span><span style='font-size:12.0pt;font-family:Oxygen;mso-bidi-font-family:Arial; background:white;mso-ansi-language:EN-US'> </span></p></td> <td width=312 valign=top style='width:233.65pt;border-top:none;border-left: none;border-bottom:solid #95B3D7 1.0pt;border-right:solid #95B3D7 1.0pt; mso-border-top-alt:solid #95B3D7 .5pt;mso-border-left-alt:solid #95B3D7 .5pt; mso-border-alt:solid #95B3D7 .5pt;background:#DBE5F1;padding:0cm 5.4pt 0cm 5.4pt; height:49.65pt'> <p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height: normal;mso-element:frame;mso-element-frame-hspace:7.05pt;mso-element-wrap: around;mso-element-anchor-horizontal:margin;mso-element-left:right; mso-element-top:25.35pt;mso-height-rule:exactly'><span style='font-size:12.0pt; font-family:Oxygen;mso-ansi-language:EN-US'>Part made of 6pb responsible for stopping transcription.<span style='color:#365F91'><o:p></o:p></span></span></p> </td> </tr></table></div></center><br />
<br />
<br><p><b>References</b></p><br />
<br />
<font size="2"><br />
<p>● Antiquity (2013, January 31). <i>Part: BBa_B0034</i>. Retrieved May 1st 2014, from <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034">http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034</a></p><br />
<p>● BMM Cancer Research UK. <i>Interactive 3D Jigsaw</i>. Retrieved May 1st 2014 from <a href="http://bmm.cancerresearchuk.org">bmm.cancerresearchuk.org</a></p><br />
<p>● Colombia Israel Team (2007) <i>Part: BBa_I765001</i>. Retrieved April 1st 2014 from <a href="http://parts.igem.org/Part:BBa_I765001">Part-BBa_I765001</a></p><br />
<p>● IGEM Colombian Team (2007) <i>UV promoter</i>. Retrieved April 1st 2014 from <a href="http://parts.igem.org/Part:BBa_I765001">http://parts.igem.org/Part:BBa_I765001</a></p><br />
<p>● IVEY Mark, KRULWICH Terry. (1994) <i>Sodium ion binding proteins</i>. Retrieved April 1st 2014 from <a href="http://www.google.com.mx/patents/US5346815">http://www.google.com.mx/patents/US5346815</a></p><br />
<p>● Knight Lab (2006) <i>Part: BBa_B1002</i>. Retrieved from <a href="http://parts.igem.org/Part:BBa_B1002">http://parts.igem.org/Part:BBa_B1002</a></p><br />
<p>● Predict Protein. <i>Request ID: 473277</i>. Retrieved May 3rd 2014 from <a href="https://www.predictprotein.org">https://www.predictprotein.org</a></p><br />
<p>● Yeast Resource Center. <i>Protein Overview: gi|2209269.</i> Retrieved May 1st 2014 from <a href="http://www.yeastrc.org/pdr/viewProtein.do?id=1296033">http://www.yeastrc.org/pdr/viewProtein.do?id=1296033</a></p></font><br />
<br />
<br><br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_abstract
Team:CIDEB-UANL Mexico/project abstract
2014-06-14T23:33:51Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Abstract</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p>Since always, water has been known as a source for life. We cannot survive without water. Although useful water is a necessity which must be satisfied for everyone, nowadays in certain countries there are no enough water supplies for people. The global lack of abundance of usable water is an issue that presents a dangerous problem to our future. Ironically, only a small portion of our planet's water is actually usable. Ninety-seven percent of the world's water is too salty for consumption or agricultural use. Furthermore, much of the rest is held in ice caps or other unattainable sources. This leaves approximately one percent of the global water as liquid and fresh; ninety-eight percent of which is groundwater(Bouwer, 2002).</p><br />
</td><br />
<td style="padding-left:12px;"><img width=265 height=243 src="https://static.igem.org/mediawiki/2014hs/archive/c/c9/20140609211415%21Logo.png"/></td><br />
</tr></table><br />
<br />
<p>In fact, for solving this problem have been developed different methods. One of them is desalination, converting sea water (rich in salts) into usable water; but this method is very expensive by the great use of electrical energy, and the extraction process produces wastes dangerous for the environment (Cotruvo, 2010).</p><br />
<br />
<p>For that reason our project is focused on developing a biological machine capable of performing desalination, reducing costs and avoiding dangerous wastes during the process. For making this possible, <i>E. coli</i> must survive in saline environments, able to capture salts, and be removed from the water after the process. In order to achieve the objective we designed a biological circuit in which <i>E. coli</i> could be able to resist adverse conditions though a protein called IrrE, capture Na+ ions (this because sodium chloride is the main salt of sea water) by NhaS production releasing an aroma (WinterGreen) as reporter, and be able for binding silica (L2+AIDA) in order to remove it through a biofilter. The whole circuit is shown below:</p><br />
<br />
<center><p><img width=552 height=343 src="https://static.igem.org/mediawiki/2014hs/9/9b/Whole_circuit.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 1.</b> Diagram representing our proposed circuit</p></center><br />
<br />
<p>But we realized <i>E. coli</i> could have a genetic overload because the circuit was too big (approximately 5000 bp). Also the time we had to finish it was not enough, as well as most of the proteins we wanted to produce were putative or untested. So for a better understanding and for determine if each piece works we divided the project into four modules: capture, binding, aroma and resistance, but the project is the result of their correlation. In fact our bacteria was named E. CARU (each letter by each module). </p><br />
<br />
<center><table width=60%><br />
<tr><br />
<td><br />
<p><b>E</b>scherichia coli</p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture"><b>C</b>apture</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma"><b>A</b>roma</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance"><b>R</b>esistance </a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union"><b>U</b>nion</a></p><br />
</p><br />
</td><br />
<td style="padding-left:12px;"><img width=286 height=285 src="https://static.igem.org/mediawiki/2014hs/3/30/Image006cideb2014.png"/></td><br />
</tr></table></center><br />
<br />
<p><b>Future results</b></p><br />
<br />
<p>Once we have proved each piece works alone, and we obtained experimental data to support their effectiveness we planned to join every module into the whole circuit we propose at first. It would mean to place IrrE and L2+AIDA gene in <i>E. coli</i>. In the case of NhaS and Wintergreen we would replace the RFP gene from NhaS with the Wintergreen reporter.</p><br />
<br />
<br><p><b>References</b></p><br />
<br />
<font size="2"><br />
<p>● Bouwer, H. (2002). Integrated Water Management for the 21st Century: Problems and Solutions. Journal of irrigation and drainage engineering, 193-200.</p><br />
<p>● Joseph Cotruvo, N. V. (2010). Desalination Technology: Health and Environmental Impacts. U.S: Taylor and Francis Group.</p><br />
<br />
<br />
<br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_abstract#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance
Team:CIDEB-UANL Mexico/project resistance
2014-06-14T18:17:09Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Resistance Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p>Because our project is a biofilter which allows to remove salt from water, the bacteria needs to survive to extreme environmental conditions which normally it can’t do. We need <i>E. Coli</i> to survive a high salinity environment to allow it to capture Na ions and remove the salt concentration of the water.</p><br />
<br />
<p>In order to accomplish our project goal, we have to change <i>E. Coli</i> metabolism and make it stronger, more resistant and more efficient than in normal E.coli bacteria.</p><br />
<br />
<p>Last discoveries show IrrE as a protein capable of change the <i>E. Coli</i> metabolism, and giving it the ability to survive to bigger temperatures, bigger UV rays radiation and bigger salt concentration <b>(UCL, 2012)</b>.</p><br />
<br />
<br><p><b>¿What does IrrE do?</b></p><br />
<br />
<p>The protein IrrE originates from <i>Deinococcusradiodurans</i>, and initially, this gene provides resistance to radiation. But when transformed in <i>E. Coli</i>, it protects it against salt, oxidative and thermal shock. <b>(UCL, 2012)</b> Also, different experiments from different iGEM teams, support the idea of the bigger salt resistance in <i>E. Coli</i> with this biobrick. </p><br />
<br />
<center><p><img width=564 height=350 src="https://static.igem.org/mediawiki/2014hs/3/3e/Grafica_1_cideb2014.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 1.</b> This graph done by <b>UCL iGEM team 2012</b>, shows how IrrE biobrick increased the salt concentration resistance in <i>E. Coli</i> compared with the results from <b>Tu Delf iGEM team 2010</b>.</p></center><br />
<br />
<br><p><b>How it works?</b></p><br />
<br />
<p>IrrE has been demonstrated to up regulate transcription of recA and pprA - genes which encode Recombines A and Radiation Inducible Protein. With respect to salt tolerance, IrrE up regulates the production of several stress responsive proteins, protein kinases, metabolic proteins, and detoxification proteins. It also down regulates glycerol degradation. With this global regulatory effect, <i>E. Coli</i> becomes more salt tolerant <b>(UCL, 2012)</b>.</p><br />
<br />
<center><p><img width=429 height=322 src="https://static.igem.org/mediawiki/2014hs/9/9b/Imagen1cideb2014.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 2.</b> This diagram shows the effect of IrrE protein on <i>E. Coli</i> metabolism. </p></center><br />
<br />
<br><p><b>Other teams that use it:</b></p><br />
<br />
<p><b>London 2012:</b> They propose to confer salt tolerance on <i>E. Coli</i> by linking the salt tolerance gene encoding the protein IrrE (BBa_K729001) to a constitutive promoter (BBa_J23119). </p><br />
<br />
<center><p><img width=661 height=139 src="https://static.igem.org/mediawiki/2014hs/3/33/Gen1cideb2014.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 3.</b> Part designed by <b>UCL iGEM team 2012</b> for the irrE protein.</p></center><br />
<br />
<br><p><b>IrrE's parts description :</b></p><br><br />
<br />
<center><div><br />
<table class=MsoTable15Grid7ColorfulAccent6 border=1 cellspacing=0<br />
cellpadding=0 width=631 style='width:473.0pt;border-collapse:collapse;<br />
border:none;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt'><br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes;<br />
height:15.75pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border:none;border-bottom:<br />
solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint:<br />
153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:517'><b><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX;mso-bidi-font-style:<br />
italic'>IMAGE</span></b><b style='mso-bidi-font-weight:normal'><span<br />
lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
"Times New Roman";mso-bidi-font-family:"Times New Roman";mso-fareast-language:<br />
ES-MX;mso-bidi-font-style:italic'><o:p></o:p></span></b></p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border:none;border-bottom:<br />
solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint:<br />
153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>CODE</span></b><b<br />
style='mso-bidi-font-weight:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></b></p><br />
</td><br />
<td width=400 nowrap valign=top style='width:300.0pt;border:none;border-bottom:<br />
solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint:<br />
153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>DESCRIPTION</span></b><b<br />
style='mso-bidi-font-weight:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></b></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:0;height:60.75pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border:none;border-right:<br />
solid #FABF8F 1.0pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:60.75pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shapetype<br />
id="_x0000_t75" coordsize="21600,21600" o:spt="75" o:preferrelative="t"<br />
path="m@4@5l@4@11@9@11@9@5xe" filled="f" stroked="f"><br />
<v:stroke joinstyle="miter"/><br />
<v:formulas><br />
<v:f eqn="if lineDrawn pixelLineWidth 0"/><br />
<v:f eqn="sum @0 1 0"/><br />
<v:f eqn="sum 0 0 @1"/><br />
<v:f eqn="prod @2 1 2"/><br />
<v:f eqn="prod @3 21600 pixelWidth"/><br />
<v:f eqn="prod @3 21600 pixelHeight"/><br />
<v:f eqn="sum @0 0 1"/><br />
<v:f eqn="prod @6 1 2"/><br />
<v:f eqn="prod @7 21600 pixelWidth"/><br />
<v:f eqn="sum @8 21600 0"/><br />
<v:f eqn="prod @7 21600 pixelHeight"/><br />
<v:f eqn="sum @10 21600 0"/><br />
</v:formulas><br />
<v:path o:extrusionok="f" gradientshapeok="t" o:connecttype="rect"/><br />
<o:lock v:ext="edit" aspectratio="t"/><br />
</v:shapetype><v:shape id="_x0031__x0020_Imagen" o:spid="_x0000_s1033"<br />
type="#_x0000_t75" style='position:absolute;left:0;text-align:left;<br />
margin-left:15.9pt;margin-top:9.9pt;width:61.45pt;height:48.6pt;z-index:251649536;<br />
visibility:visible;mso-wrap-style:square;mso-width-percent:0;<br />
mso-height-percent:0;mso-wrap-distance-left:9pt;mso-wrap-distance-top:0;<br />
mso-wrap-distance-right:9pt;mso-wrap-distance-bottom:0;<br />
mso-position-horizontal:absolute;mso-position-horizontal-relative:text;<br />
mso-position-vertical:absolute;mso-position-vertical-relative:text;<br />
mso-width-percent:0;mso-height-percent:0;mso-width-relative:page;<br />
mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image001.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=82 height=65<br />
src="https://static.igem.org/mediawiki/2014hs/6/62/Promotor.png" align=left hspace=12<br />
v:shapes="_x0031__x0020_Imagen"><![endif]><i><span lang=ES-MX<br />
style='font-family:Oxygen;color:#E36C0A;mso-themecolor:accent6;mso-themeshade:<br />
191;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'>&nbsp;</p></td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;<br />
mso-border-right-themecolor:accent6;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt;<br />
mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt:<br />
solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153;<br />
background:#FDE9D9;mso-background-themecolor:accent6;mso-background-themetint:<br />
51;padding:0cm 5.4pt 0cm 5.4pt;height:60.75pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p><br />
</td><br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left:<br />
none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;<br />
mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint:<br />
153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;background:#FDE9D9;mso-background-themecolor:accent6;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:60.75pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
Arial;color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>In<br />
the specific case of our bacteria, it helps to continuously transcribing the <span<br />
class=SpellE>IrrE</span> gene in order to make bacteria resist high<br />
concentration of salt. </span><span class=SpellE><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:#282828;mso-fareast-language:ES-MX'>This</span></span><span<br />
lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
"Times New Roman";mso-bidi-font-family:Arial;color:#282828;mso-fareast-language:<br />
ES-MX'> <span class=SpellE>promoter</span> has a <span class=SpellE>length</span><br />
of 35 <span class=SpellE>pb</span> <b>(Anderson, 2006)</b>.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:1;height:75.0pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:75.0pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape<br />
id="_x0032__x0020_Imagen" o:spid="_x0000_s1032" type="#_x0000_t75" style='position:absolute;<br />
left:0;text-align:left;margin-left:23.1pt;margin-top:6.95pt;width:54.25pt;<br />
height:49.45pt;z-index:251651584;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image003.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=72 height=66<br />
src="https://static.igem.org/mediawiki/2014hs/5/5d/Cds.png" align=left hspace=12<br />
v:shapes="_x0032__x0020_Imagen"><![endif]><i><span style='font-family:Oxygen;<br />
color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191;mso-ansi-language:<br />
EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'>&nbsp;</p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;<br />
mso-border-right-themecolor:accent6;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt;<br />
mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt:<br />
solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153;<br />
padding:0cm 5.4pt 0cm 5.4pt;height:75.0pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-ansi-language:EN-US;mso-fareast-language:<br />
ES-MX'><a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'>&nbsp;</p><br />
</td><br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left:<br />
none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;<br />
mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint:<br />
153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:75.0pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal'><span style='font-size:12.0pt;font-family:Oxygen;<br />
mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial;<br />
color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>This<br />
specific is <span class=SpellE>RBS</span> based on <span class=SpellE>Elowitz</span><br />
<span class=SpellE>repressilator</span>. It is very common to see in many <span<br />
class=SpellE>iGEM</span> projects.<span style='mso-spacerun:yes'> </span>It<br />
has a length of 12 <span class=SpellE>pb</span>. <b>(Mahajan, <span<br />
class=SpellE>Marinescu</span>, Chow, <span class=SpellE>Wissner</span>-Gross,<br />
&amp; Carr, 2003)</b>.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:2;height:90.35pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:90.35pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape<br />
id="_x0033__x0020_Imagen" o:spid="_x0000_s1031" type="#_x0000_t75" style='position:absolute;<br />
left:0;text-align:left;margin-left:23.4pt;margin-top:10pt;width:57pt;<br />
height:48pt;z-index:251654656;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image005.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=76 height=64<br />
src="https://static.igem.org/mediawiki/2014hs/9/97/IrrEResistance.png" align=left hspace=12<br />
v:shapes="_x0033__x0020_Imagen"><![endif]></p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;<br />
mso-border-right-themecolor:accent6;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt;<br />
mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt:<br />
solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153;<br />
background:#FDE9D9;mso-background-themecolor:accent6;mso-background-themetint:<br />
51;padding:0cm 5.4pt 0cm 5.4pt;height:90.35pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-ansi-language:EN-US;<br />
mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K729001">BBa_K729001</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span<br />
style='font-size:3.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-ansi-language:EN-US;<br />
mso-fareast-language:ES-MX'><o:p></o:p></span></p><br />
</td><br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left:<br />
none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;<br />
mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint:<br />
153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;background:#FDE9D9;mso-background-themecolor:accent6;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:90.35pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
Arial;color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>Gene<br />
that produces <span class=SpellE>IrrE</span>, a substance that changes the<br />
bacteria’s metabolism and allows bacteria to survive to extreme conditions,<br />
some examples could be high UV rays exposition, or high salt concentration<br />
levels in an aquatic environment, oxidative or thermal shock.<span<br />
style='mso-spacerun:yes'> </span>It has a length of 933pb <b>(<span<br />
class=SpellE>Sohrabi</span>, 2012)</b>.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes;height:62.25pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:62.25pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape<br />
id="_x0034__x0020_Imagen" o:spid="_x0000_s1030" type="#_x0000_t75" style='position:absolute;<br />
left:0;text-align:left;margin-left:22.6pt;margin-top:5.5pt;width:54.75pt;<br />
height:52.5pt;z-index:251657728;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image006.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=73 height=70<br />
src="https://static.igem.org/mediawiki/2014hs/5/55/TerminatorResistance.png" align=left hspace=12<br />
v:shapes="_x0034__x0020_Imagen"><![endif]><i><span style='font-family:Oxygen;<br />
color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191;mso-ansi-language:<br />
EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i><i><span<br />
lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
"Times New Roman";mso-bidi-font-family:"Times New Roman";color:black;<br />
mso-fareast-language:ES-MX'> <br />
<o:p></o:p><br />
</span></i></p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;<br />
mso-border-right-themecolor:accent6;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt;<br />
mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt:<br />
solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153;<br />
padding:0cm 5.4pt 0cm 5.4pt;height:62.25pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'>&nbsp;</p></td><br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left:<br />
none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;<br />
mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint:<br />
153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:62.25pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal'><span style='font-size:12.0pt;font-family:Oxygen;<br />
mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:"Times New Roman";<br />
color:black;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>Part made of<br />
6pb responsible for transcription stop <b>(Huang, 206)</b>.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
</div></center><br />
<br />
<br><p><b>References</b></p><br />
<br />
<font size="2"><br />
<p>● Antiquity 2013. (2013, January 31). <i>Part:BBa_B0034</i> Retrieved from http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034</p><br />
<p>● Huang, H. (2006, August 30). <i>Part:BBa_B1002</i>. Retrieved August 30, 2014, from http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002</p><br />
<p>● iGEM2006_Berkeley. (2006, August 24). <i>Part:BBa_J23119</i>. Retrieved April 30, 2014, from http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119</p><br />
<p>● Sohrabi, B. (2012, June 27). <i>Part:BBa_K729001</i>. Retrieved from http://parts.igem.org/wiki/index.php?title=Part:BBa_K729001</p><br />
<p>● UCLiGEM Team. (2012). <i>IRRE module</i>. Retrieved March 31, 2014 from https://2012.igem.org/Team:University_College_London/Module_5</p><br />
</font><br />
<br />
<br><br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance
Team:CIDEB-UANL Mexico/project resistance
2014-06-14T18:15:48Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Resistance Module</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<p>Because our project is a biofilter which allows to remove salt from water, the bacteria needs to survive to extreme environmental conditions which normally it can’t do. We need <i>E. Coli</i> to survive a high salinity environment to allow it to capture Na ions and remove the salt concentration of the water.</p><br />
<br />
<p>In order to accomplish our project goal, we have to change <i>E. Coli</i> metabolism and make it stronger, more resistant and more efficient than in normal E.coli bacteria.</p><br />
<br />
<p>Last discoveries show IrrE as a protein capable of change the <i>E. Coli</i> metabolism, and giving it the ability to survive to bigger temperatures, bigger UV rays radiation and bigger salt concentration <b>(UCL, 2012)</b>.</p><br />
<br />
<br><p><b>¿What does IrrE do?</b></p><br />
<br />
<p>The protein IrrE originates from <i>Deinococcusradiodurans</i>, and initially, this gene provides resistance to radiation. But when transformed in <i>E. Coli</i>, it protects it against salt, oxidative and thermal shock. <b>(UCL, 2012)</b> Also, different experiments from different iGEM teams, support the idea of the bigger salt resistance in <i>E. Coli</i> with this biobrick. </p><br />
<br />
<center><p><img width=564 height=350 src="https://static.igem.org/mediawiki/2014hs/3/3e/Grafica_1_cideb2014.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 1.</b> This graph done by UCL iGEM team 2012, shows how IrrE biobrick increased the salt concentration resistance in <i>E. Coli</i> compared with the results from Tu Delf iGEM team 2010.</p></center><br />
<br />
<br><p><b>How it works?</b></p><br />
<br />
<p>IrrE has been demonstrated to up regulate transcription of recA and pprA - genes which encode Recombines A and Radiation Inducible Protein. With respect to salt tolerance, IrrE up regulates the production of several stress responsive proteins, protein kinases, metabolic proteins, and detoxification proteins. It also down regulates glycerol degradation. With this global regulatory effect, <i>E. Coli</i> becomes more salt tolerant <b>(UCL, 2012)</b>.</p><br />
<br />
<center><p><img width=429 height=322 src="https://static.igem.org/mediawiki/2014hs/9/9b/Imagen1cideb2014.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 2.</b> This diagram shows the effect of IrrE protein on <i>E. Coli</i> metabolism. </p></center><br />
<br />
<br><p><b>Other teams that use it:</b></p><br />
<br />
<p><b>London 2012:</b> They propose to confer salt tolerance on <i>E. Coli</i> by linking the salt tolerance gene encoding the protein IrrE (BBa_K729001) to a constitutive promoter (BBa_J23119). </p><br />
<br />
<center><p><img width=661 height=139 src="https://static.igem.org/mediawiki/2014hs/3/33/Gen1cideb2014.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Image 3.</b> Part designed by <b>UCL iGEM team 2012</b> for the irrE protein.</p></center><br />
<br />
<br><p><b>IrrE's parts description :</b></p><br><br />
<br />
<center><div><br />
<table class=MsoTable15Grid7ColorfulAccent6 border=1 cellspacing=0<br />
cellpadding=0 width=631 style='width:473.0pt;border-collapse:collapse;<br />
border:none;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt'><br />
<tr style='mso-yfti-irow:-1;mso-yfti-firstrow:yes;mso-yfti-lastfirstrow:yes;<br />
height:15.75pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border:none;border-bottom:<br />
solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint:<br />
153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:517'><b><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX;mso-bidi-font-style:<br />
italic'>IMAGE</span></b><b style='mso-bidi-font-weight:normal'><span<br />
lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
"Times New Roman";mso-bidi-font-family:"Times New Roman";mso-fareast-language:<br />
ES-MX;mso-bidi-font-style:italic'><o:p></o:p></span></b></p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border:none;border-bottom:<br />
solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint:<br />
153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>CODE</span></b><b<br />
style='mso-bidi-font-weight:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></b></p><br />
</td><br />
<td width=400 nowrap valign=top style='width:300.0pt;border:none;border-bottom:<br />
solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;mso-border-bottom-themetint:<br />
153;mso-border-bottom-alt:solid #FABF8F .5pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;background:white;mso-background-themecolor:<br />
background1;padding:0cm 5.4pt 0cm 5.4pt;height:15.75pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:1'><b><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";mso-fareast-language:ES-MX'>DESCRIPTION</span></b><b<br />
style='mso-bidi-font-weight:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";mso-fareast-language:ES-MX'><o:p></o:p></span></b></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:0;height:60.75pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border:none;border-right:<br />
solid #FABF8F 1.0pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:60.75pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shapetype<br />
id="_x0000_t75" coordsize="21600,21600" o:spt="75" o:preferrelative="t"<br />
path="m@4@5l@4@11@9@11@9@5xe" filled="f" stroked="f"><br />
<v:stroke joinstyle="miter"/><br />
<v:formulas><br />
<v:f eqn="if lineDrawn pixelLineWidth 0"/><br />
<v:f eqn="sum @0 1 0"/><br />
<v:f eqn="sum 0 0 @1"/><br />
<v:f eqn="prod @2 1 2"/><br />
<v:f eqn="prod @3 21600 pixelWidth"/><br />
<v:f eqn="prod @3 21600 pixelHeight"/><br />
<v:f eqn="sum @0 0 1"/><br />
<v:f eqn="prod @6 1 2"/><br />
<v:f eqn="prod @7 21600 pixelWidth"/><br />
<v:f eqn="sum @8 21600 0"/><br />
<v:f eqn="prod @7 21600 pixelHeight"/><br />
<v:f eqn="sum @10 21600 0"/><br />
</v:formulas><br />
<v:path o:extrusionok="f" gradientshapeok="t" o:connecttype="rect"/><br />
<o:lock v:ext="edit" aspectratio="t"/><br />
</v:shapetype><v:shape id="_x0031__x0020_Imagen" o:spid="_x0000_s1033"<br />
type="#_x0000_t75" style='position:absolute;left:0;text-align:left;<br />
margin-left:15.9pt;margin-top:9.9pt;width:61.45pt;height:48.6pt;z-index:251649536;<br />
visibility:visible;mso-wrap-style:square;mso-width-percent:0;<br />
mso-height-percent:0;mso-wrap-distance-left:9pt;mso-wrap-distance-top:0;<br />
mso-wrap-distance-right:9pt;mso-wrap-distance-bottom:0;<br />
mso-position-horizontal:absolute;mso-position-horizontal-relative:text;<br />
mso-position-vertical:absolute;mso-position-vertical-relative:text;<br />
mso-width-percent:0;mso-height-percent:0;mso-width-relative:page;<br />
mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image001.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=82 height=65<br />
src="https://static.igem.org/mediawiki/2014hs/6/62/Promotor.png" align=left hspace=12<br />
v:shapes="_x0031__x0020_Imagen"><![endif]><i><span lang=ES-MX<br />
style='font-family:Oxygen;color:#E36C0A;mso-themecolor:accent6;mso-themeshade:<br />
191;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'>&nbsp;</p></td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;<br />
mso-border-right-themecolor:accent6;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt;<br />
mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt:<br />
solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153;<br />
background:#FDE9D9;mso-background-themecolor:accent6;mso-background-themetint:<br />
51;padding:0cm 5.4pt 0cm 5.4pt;height:60.75pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_J23119">BBa_J23119</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'>&nbsp;</p><br />
</td><br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left:<br />
none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;<br />
mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint:<br />
153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;background:#FDE9D9;mso-background-themecolor:accent6;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:60.75pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
Arial;color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>In<br />
the specific case of our bacteria, it helps to continuously transcribing the <span<br />
class=SpellE>IrrE</span> gene in order to make bacteria resist high<br />
concentration of salt. </span><span class=SpellE><span lang=ES-MX<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:Arial;color:#282828;mso-fareast-language:ES-MX'>This</span></span><span<br />
lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
"Times New Roman";mso-bidi-font-family:Arial;color:#282828;mso-fareast-language:<br />
ES-MX'> <span class=SpellE>promoter</span> has a <span class=SpellE>length</span><br />
of 35 <span class=SpellE>pb</span> <b>(Anderson, 2006)</b>.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:1;height:75.0pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:75.0pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape<br />
id="_x0032__x0020_Imagen" o:spid="_x0000_s1032" type="#_x0000_t75" style='position:absolute;<br />
left:0;text-align:left;margin-left:23.1pt;margin-top:6.95pt;width:54.25pt;<br />
height:49.45pt;z-index:251651584;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image003.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=72 height=66<br />
src="https://static.igem.org/mediawiki/2014hs/5/5d/Cds.png" align=left hspace=12<br />
v:shapes="_x0032__x0020_Imagen"><![endif]><i><span style='font-family:Oxygen;<br />
color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191;mso-ansi-language:<br />
EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i></p><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'>&nbsp;</p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;<br />
mso-border-right-themecolor:accent6;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt;<br />
mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt:<br />
solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153;<br />
padding:0cm 5.4pt 0cm 5.4pt;height:75.0pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-ansi-language:EN-US;mso-fareast-language:<br />
ES-MX'><a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'>&nbsp;</p><br />
</td><br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left:<br />
none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;<br />
mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint:<br />
153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:75.0pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal'><span style='font-size:12.0pt;font-family:Oxygen;<br />
mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:Arial;<br />
color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>This<br />
specific is <span class=SpellE>RBS</span> based on <span class=SpellE>Elowitz</span><br />
<span class=SpellE>repressilator</span>. It is very common to see in many <span<br />
class=SpellE>iGEM</span> projects.<span style='mso-spacerun:yes'> </span>It<br />
has a length of 12 <span class=SpellE>pb</span>. <b>(Mahajan, <span<br />
class=SpellE>Marinescu</span>, Chow, <span class=SpellE>Wissner</span>-Gross,<br />
&amp; Carr, 2003)</b>.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:2;height:90.35pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:90.35pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:68'><!--[if gte vml 1]><v:shape<br />
id="_x0033__x0020_Imagen" o:spid="_x0000_s1031" type="#_x0000_t75" style='position:absolute;<br />
left:0;text-align:left;margin-left:23.4pt;margin-top:10pt;width:57pt;<br />
height:48pt;z-index:251654656;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image005.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=76 height=64<br />
src="https://static.igem.org/mediawiki/2014hs/9/97/IrrEResistance.png" align=left hspace=12<br />
v:shapes="_x0033__x0020_Imagen"><![endif]></p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;<br />
mso-border-right-themecolor:accent6;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt;<br />
mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt:<br />
solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153;<br />
background:#FDE9D9;mso-background-themecolor:accent6;mso-background-themetint:<br />
51;padding:0cm 5.4pt 0cm 5.4pt;height:90.35pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span<br />
style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-ansi-language:EN-US;<br />
mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_K729001">BBa_K729001</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal;mso-yfti-cnfc:64'><span<br />
style='font-size:3.0pt;font-family:Oxygen;mso-fareast-font-family:"Times New Roman";<br />
mso-bidi-font-family:"Times New Roman";color:black;mso-ansi-language:EN-US;<br />
mso-fareast-language:ES-MX'><o:p></o:p></span></p><br />
</td><br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left:<br />
none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;<br />
mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint:<br />
153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;background:#FDE9D9;mso-background-themecolor:accent6;<br />
mso-background-themetint:51;padding:0cm 5.4pt 0cm 5.4pt;height:90.35pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal;mso-yfti-cnfc:64'><span style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
Arial;color:#282828;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>Gene<br />
that produces <span class=SpellE>IrrE</span>, a substance that changes the<br />
bacteria’s metabolism and allows bacteria to survive to extreme conditions,<br />
some examples could be high UV rays exposition, or high salt concentration<br />
levels in an aquatic environment, oxidative or thermal shock.<span<br />
style='mso-spacerun:yes'> </span>It has a length of 933pb <b>(<span<br />
class=SpellE>Sohrabi</span>, 2012)</b>.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:3;mso-yfti-lastrow:yes;height:62.25pt'><br />
<td width=112 nowrap valign=top style='width:84.0pt;border-top:solid #FABF8F 1.0pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;border-left:<br />
none;border-bottom:none;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-right-alt:<br />
solid #FABF8F .5pt;mso-border-right-themecolor:accent6;mso-border-right-themetint:<br />
153;background:white;mso-background-themecolor:background1;padding:0cm 5.4pt 0cm 5.4pt;<br />
height:62.25pt'><br />
<p class=MsoNormal align=right style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:right;line-height:normal;mso-yfti-cnfc:4'><!--[if gte vml 1]><v:shape<br />
id="_x0034__x0020_Imagen" o:spid="_x0000_s1030" type="#_x0000_t75" style='position:absolute;<br />
left:0;text-align:left;margin-left:22.6pt;margin-top:5.5pt;width:54.75pt;<br />
height:52.5pt;z-index:251657728;visibility:visible;mso-wrap-style:square;<br />
mso-width-percent:0;mso-height-percent:0;mso-wrap-distance-left:9pt;<br />
mso-wrap-distance-top:0;mso-wrap-distance-right:9pt;<br />
mso-wrap-distance-bottom:0;mso-position-horizontal:absolute;<br />
mso-position-horizontal-relative:text;mso-position-vertical:absolute;<br />
mso-position-vertical-relative:text;mso-width-percent:0;<br />
mso-height-percent:0;mso-width-relative:page;mso-height-relative:page'><br />
<v:imagedata src="TablasAromaYResistencia_archivos/image006.png" o:title=""/><br />
<w:wrap type="square"/><br />
</v:shape><![endif]--><![if !vml]><img width=73 height=70<br />
src="https://static.igem.org/mediawiki/2014hs/5/55/TerminatorResistance.png" align=left hspace=12<br />
v:shapes="_x0034__x0020_Imagen"><![endif]><i><span style='font-family:Oxygen;<br />
color:#E36C0A;mso-themecolor:accent6;mso-themeshade:191;mso-ansi-language:<br />
EN-US;mso-fareast-language:ES-MX;mso-no-proof:yes'><o:p></o:p></span></i><i><span<br />
lang=ES-MX style='font-size:12.0pt;font-family:Oxygen;mso-fareast-font-family:<br />
"Times New Roman";mso-bidi-font-family:"Times New Roman";color:black;<br />
mso-fareast-language:ES-MX'> <br />
<o:p></o:p><br />
</span></i></p><br />
</td><br />
<td width=119 nowrap valign=top style='width:89.0pt;border-top:none;<br />
border-left:none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:<br />
accent6;mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;<br />
mso-border-right-themecolor:accent6;mso-border-right-themetint:153;<br />
mso-border-top-alt:solid #FABF8F .5pt;mso-border-top-themecolor:accent6;<br />
mso-border-top-themetint:153;mso-border-left-alt:solid #FABF8F .5pt;<br />
mso-border-left-themecolor:accent6;mso-border-left-themetint:153;mso-border-alt:<br />
solid #FABF8F .5pt;mso-border-themecolor:accent6;mso-border-themetint:153;<br />
padding:0cm 5.4pt 0cm 5.4pt;height:62.25pt'><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'><span lang=ES-MX style='font-size:12.0pt;<br />
font-family:Oxygen;mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:<br />
"Times New Roman";color:black;mso-fareast-language:ES-MX'><a href="http://parts.igem.org/Part:BBa_B1002">BBa_B1002</a><o:p></o:p></span></p><br />
<p class=MsoNormal align=center style='margin-bottom:0cm;margin-bottom:.0001pt;<br />
text-align:center;line-height:normal'>&nbsp;</p></td><br />
<td width=400 valign=top style='width:300.0pt;border-top:none;border-left:<br />
none;border-bottom:solid #FABF8F 1.0pt;mso-border-bottom-themecolor:accent6;<br />
mso-border-bottom-themetint:153;border-right:solid #FABF8F 1.0pt;mso-border-right-themecolor:<br />
accent6;mso-border-right-themetint:153;mso-border-top-alt:solid #FABF8F .5pt;<br />
mso-border-top-themecolor:accent6;mso-border-top-themetint:153;mso-border-left-alt:<br />
solid #FABF8F .5pt;mso-border-left-themecolor:accent6;mso-border-left-themetint:<br />
153;mso-border-alt:solid #FABF8F .5pt;mso-border-themecolor:accent6;<br />
mso-border-themetint:153;padding:0cm 5.4pt 0cm 5.4pt;height:62.25pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;text-align:<br />
justify;line-height:normal'><span style='font-size:12.0pt;font-family:Oxygen;<br />
mso-fareast-font-family:"Times New Roman";mso-bidi-font-family:"Times New Roman";<br />
color:black;mso-ansi-language:EN-US;mso-fareast-language:ES-MX'>Part made of<br />
6pb responsible for transcription stop <b>(Huang, 206)</b>.<o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
</div></center><br />
<br />
<br><p><b>References</b></p><br />
<br />
<font size="2"><br />
<p>● Antiquity 2013. (2013, January 31). <i>Part:BBa_B0034</i> Retrieved from http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034</p><br />
<p>● Huang, H. (2006, August 30). <i>Part:BBa_B1002</i>. Retrieved August 30, 2014, from http://parts.igem.org/wiki/index.php?title=Part:BBa_B1002</p><br />
<p>● iGEM2006_Berkeley. (2006, August 24). <i>Part:BBa_J23119</i>. Retrieved April 30, 2014, from http://parts.igem.org/wiki/index.php?title=Part:BBa_J23119</p><br />
<p>● Sohrabi, B. (2012, June 27). <i>Part:BBa_K729001</i>. Retrieved from http://parts.igem.org/wiki/index.php?title=Part:BBa_K729001</p><br />
<p>● UCLiGEM Team. (2012). <i>IRRE module</i>. Retrieved March 31, 2014 from https://2012.igem.org/Team:University_College_London/Module_5</p><br />
</font><br />
<br />
<br><br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_discussions
Team:CIDEB-UANL Mexico/labwork discussions
2014-06-14T18:07:25Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_labwork}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Discussion</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<br />
<p>The ligation transformed in E. coli of the NhaS module produced red and white colonies when we expected only red colonies (bacteria expressing the RFP). We did not know the reason of the unexpected result so we designed an experiment with the UV light promoter. </p><p><br />
The NhaS module was proved in the experiment with the Petri Dishes in the UV camera. The red bacteria was already red (meaning that the RFP expression already started) before being exposed to the UV camera. The promoter <a href = http://parts.igem.org/Part:BBa_I765001> pUV 1765001</a> is activated by the UV exposition. This is an unexpected result so this can mean that the promoter is so sensible to the UV light that the normal UV radiation is enough to activate it. In the part description is reported that the UV promoter must activated and the protein must be expressed after 10 minutes of exposure in the UV camera, but after 60 minutes (?) there was no change in the white colonies so the RFP was not expressed there. </p><p><br />
After doing the experiment we obtained that the red colonies continued with the RFP expression and the white colonies did not changed in color. As we expected to activate the RFP expression in the white colonies, this means that the time of the exposure was not enough to activate the UV promoter or the promoter did not worked in the conditions we thought it would work. To see if the promoter was already activated we did another experiment. </p><p><br />
The experiment with NaCl in different concentrations in Petri Dishes showed that the bacteria grew in a medium with high NaCl concentration. The control group with non-modified bacteria did not grow because it did not contain the Nhas insert so it was not able to survive in a saline medium. The white bacteria did actually grow but they did not expressed the RFP, but the fact that they did grow means that they have the NaCl resistance and the insert is inside them. </p><p><br />
As the white and red colonies are supposed to come from the same ligation and to contain the same genetic information we need to prove that the insert was inside them. In order to prove this we sent samples of DNA to be sequenced to the DNA Synthesis and Sequentiation Biotechnology Institute Unit (USSDNA in Spanish), from the UNAM. </p><p><br />
The primer used was in the complementary reverse chain, so the sequences are in the 3’ to 5’ direction. We did an analysis of the sequences obtained by aligning them with the <a href=”http://blast.ncbi.nlm.nih.gov/Blast.cgi”>BLAST Software</a>.</p><br />
<p><b>The RFP sequence used in the alignment was the following:</b> </p><br />
<pre><br />
Atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaa<br />
cggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaac<br />
tgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggt<br />
tccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggttt<br />
caaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgc<br />
aagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatg<br />
cagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaagg<br />
tgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctaca<br />
tggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccac<br />
aacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaata<br />
acgctgatagtgctagtgtagatcgctaa</pre><br />
<p><br />
It was aligned with the sequences obtained from the samples Nhas white bacteria and Nhas red bacteria. </p><br />
<p><b>NhaS sequence from white colonies</b></p><br />
<pre><br />
TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGA<br />
ACCTGCATAACGCGAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTT<br />
TTTGCCGGACTGCAGCGGCCGCTACTAGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCA<br />
CCGGTGGAGTGACTACCTTCAGCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGT<br />
GATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTTTTAGCCATGTAGGTGG<br />
TTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGA<br />
GCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGG <br />
ACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGG<br />
AGTCCTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCC<br />
GGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCCGGGTGTTTAACGTAAGCTTTGGAACCGTACTG<br />
GAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTTCAGTTTAGCGG<br />
TCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTTAACGGA<br />
ACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTT<br />
CGCTTACAAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTA<br />
TCGGTTTTGCCATGCAGATTCCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGT<br />
CCGCAAAATGTGTAA></pre><p><br />
<b>NhaS sequence from red colonies</b></p><br />
<pre><br />
AAAGTGTCCACCCCGTACGACCGAGCGGAGCGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTA<br />
ATCTTTTCGGCTTAAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGC<br />
CGCTACTAGTATATAAACGCAGAAAGGCCCACCCGAAGGTGAGCCAGTGTGACTCTAGTAGAGAGCGT<br />
TCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGATGC<br />
CTGGCTCTAGTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACGACCTTCA<br />
GCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGT<br />
TTTGTAAGCACCCGGCAGCTGAACCGGTTTTTTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGT<br />
GACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGAGCACCGTCTTCCGGGTACATA<br />
CGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGACGGGAAGTTGGT<br />
ACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAA<br />
CACCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAG<br />
TCCGGGATGTCAGCCGGGTGTTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGAACAGGATG<br />
TCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTTCAGTTTAGCGGTCTCGGGTACCTTCGAACG<br />
GACGACCTTCACCTTCACCCTTCAATTTTCAAACTCGTGACCGTAAACGGAACCTTTCCATACAACTT<br />
TGAAAACGCATGAAACTCATTTGAATAACGTCTTCCGGAAGAAAGCCCAATCTAAGTATTTTCTCCCT<br />
CTTTTCTCATATAAATGTGATGAATATTTGATCTATCCGCCCTCCAACAACTTTCCCACAACAATCAT<br />
GTATCGAAATTCCTGTTATACGACACTATAAAGATGGTATAAAAAGCCCGTGGAGGGGGCGTGACCA</pre><br />
<b>Report</b></p><p><br />
The report obtained from the analysis with the NhaS in red colonies is the following: </p><p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/6/6d/DISCUSSIONIGEMCIDEB2014.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
The RFP original sequence has a length of 709 bp. The match started at position 3 and ended at position 708, this means that almost all the RFP is present in the sample sequenced as we expected because the colonies were red. </p><p><br />
<b>The report obtained from the analysis with the NhaS in white colonies is the following: </b></p><p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/7/7e/DISCUSSIONIGEMCIDEB20142.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center><br />
<br />
The match ends at the 709 position from the original RFP sequence, but it did not star from the position 1 or 3, it starts at position 50. This means that there are 49 nucleotides that did not match with the original RFP sequence. This can be a possible cause in the problem with the RFP expression in white colonies, a mutation in the region of the RFP. </p><p><br />
<b>We also made an analysis with the Ribosome Binding Site (RBS) sequence:</b> </p><p><br />
<br />
<center><p><img width=500 src="https://static.igem.org/mediawiki/2014hs/5/52/DISCUSSIONIGEMCIDEB20143.png"<br />
align=center hspace=12 alt="IMG_0317"></p></center> <br />
In the red colonies there where two matches, which is the complete sequence but in two parts: from 1 to 7 and from 6 to 12 positions. In the white colonies there was only one match, this means that the RBS sequence was not found there. If the RBS previous to the RFP has a problem, the mRNA cannot bind in the ribosome, and is not able to be translated. </p><p><br />
With these results we can infer that the BioBrick works find and expresses the NhaS (because both of them survive in a saline medium) but it stops being translated in the RBS or in the RFP region causing the colonies to be white instead of red. </p><p><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/labwork_discussions#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico
http://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_abstract
Team:CIDEB-UANL Mexico/project abstract
2014-06-14T18:02:38Z
<p>UnicornioMagico: </p>
<hr />
<div>{{:Team:CIDEB-UANL_Mexico/style2.css}}<br />
{{:Team:CIDEB-UANL_Mexico/menu_project}}<br />
<html xmlns="http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,700' rel='stylesheet' type='text/css'><br />
<title>iGEM CIDEB 2014 - Project</title><br />
<style><br />
<br />
body<br />
{<br />
margin: 0px;<br />
width: 100%;<br />
padding: 0px;<br />
background: #2056ac;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
background-image:url(https://static.igem.org/mediawiki/2014hs/3/32/Cideb_Fondo1.gif);<br />
}<br />
<br />
<br />
h1, h2, h3<br />
{<br />
margin: 0;<br />
padding-bottom: 5px;<br />
color: #404040;<br />
}<br />
<br />
p, ol, ul<br />
{<br />
margin-top: 0;<br />
}<br />
<br />
ol, ul<br />
{<br />
padding: 0;<br />
list-style: none;<br />
}<br />
p<br />
{<br />
line-height: 1.60em;<br />
padding- right: 3em;<br />
}<br />
strong<br />
{<br />
}<br />
<br />
a<br />
{<br />
color: #2056ac;<br />
}<br />
<br />
a:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
.container<br />
{<br />
margin: 0px auto;<br />
width: 1200px;<br />
}<br />
.container-text<br />
{<br />
margin: 0px auto;<br />
width: 75%;<br />
padding: 0px;<br />
font-family: 'Oxygen', sans-serif;<br />
font-size: 12pt;<br />
text-align: justify;<br />
}<br />
.wrapper<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 1em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper1<br />
{<br />
background: #FFF;<br />
}<br />
<br />
#wrapper2<br />
{<br />
overflow: hidden;<br />
background: #F3F3F3;<br />
padding: 5em 0em;<br />
text-align: center;<br />
}<br />
<br />
#wrapper3<br />
{<br />
overflow: hidden;<br />
padding: 0em 0em 0em 0em;<br />
background: #FFF;<br />
}<br />
<br />
#wrapper4<br />
{<br />
}<br />
#banner<br />
{<br />
padding-top: 2em;<br />
}<br />
#welcome<br />
{<br />
overflow: hidden;<br />
width: 1000px;<br />
padding: 0em 100px 0em 100px;<br />
text-align: center;<br />
}<br />
<br />
#welcome .content<br />
{<br />
padding: 0em 8em;<br />
}<br />
<br />
#welcome .title h2<br />
{<br />
}<br />
<br />
#welcome a,<br />
#welcome strong<br />
{<br />
}<br />
.title<br />
{<br />
margin-bottom: 1em;<br />
}<br />
<br />
.title h2<br />
{<br />
font-size: 2em;<br />
}<br />
<br />
.title .byline<br />
{<br />
font-size: 1.1em;<br />
color: #6F6F6F#;<br />
}<br />
#three-column<br />
{<br />
overflow: hidden;<br />
margin-top: 5em;<br />
padding-top: 1em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
text-align: center;<br />
}<br />
#three-column h2<br />
{<br />
margin: 1em 0em;<br />
font-size: 1.5em;<br />
font-weight: 700;<br />
}<br />
<br />
#three-column .icon<br />
{<br />
position: relative;<br />
display: block;<br />
margin: 0px auto 0.80em auto;<br />
background: none;<br />
line-height: 150px;<br />
font-size: 4em;<br />
width: 150px;<br />
height: 100px;<br />
border-radius: 100px;<br />
border: 6px solid #67128F;<br />
text-align: center;<br />
color: #FFF;<br />
<br />
}<br />
<br />
#three-column #tbox1,<br />
#three-column #tbox2,<br />
#three-column #tbox3<br />
{<br />
float: left;<br />
width: 320px;<br />
padding: 30px 40px 50px 40px;<br />
}<br />
<br />
#three-column .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#three-column .title h2<br />
{<br />
font-size: 1.60em;<br />
}<br />
<br />
#three-column .title .byline<br />
{<br />
padding-top: 0.50em;<br />
font-size: 0.90em;<br />
color: #858585;<br />
}<br />
<br />
#three-column .arrow-down<br />
{<br />
border-top-color: #292929;<br />
}<br />
<br />
<br />
ul.tools<br />
{<br />
margin: 0;<br />
padding: 0em 0em 0em 0em;<br />
list-style: none;<br />
}<br />
<br />
ul.tools li<br />
{<br />
display: inline-block;<br />
padding: 0em .2em;<br />
font-size: 4em;<br />
}<br />
<br />
ul.tools li span<br />
{<br />
display: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
ul.tools li a<br />
{<br />
color: #FFF;<br />
}<br />
<br />
ul.tools li a:before<br />
{<br />
display: inline-block;<br />
background: #1ABC9C;<br />
width: 120px;<br />
height: 120px;<br />
border-radius: 50%;<br />
line-height: 120px;<br />
text-align: center;<br />
color: #FFFFFF;<br />
}<br />
.button<br />
{<br />
display: inline-block;<br />
margin-top: 2em;<br />
padding: 0.8em 2em;<br />
background: #64ABD1;<br />
line-height: 1.8em;<br />
letter-spacing: 1px;<br />
text-decoration: none;<br />
font-size: 1em;<br />
color: #FFF;<br />
}<br />
<br />
.button:before<br />
{<br />
display: inline-block;<br />
background: #8DCB89;<br />
margin-right: 1em;<br />
width: 40px;<br />
height: 40px;<br />
line-height: 40px;<br />
border-radius: 20px;<br />
text-align: center;<br />
color: #272925;<br />
}<br />
<br />
.button-small<br />
{<br />
}<br />
#portfolio<br />
{<br />
overflow: hidden;<br />
padding-top: 5em;<br />
border-top: 1px solid rgba(0,0,0,0.2);<br />
}<br />
<br />
#portfolio .box<br />
{<br />
text-align: center;<br />
color: rgba(0,0,0,0.5);<br />
}<br />
<br />
#portfolio h3<br />
{<br />
display: block;<br />
padding-bottom: 1em;<br />
font-size: 1em;<br />
color: rgba(0,0,0,0.6);<br />
}<br />
<br />
#portfolio .title<br />
{<br />
text-align: center;<br />
}<br />
<br />
#portfolio .title h2<br />
{<br />
color: rgba(0,0,0,0.8);<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3,<br />
.column4<br />
{<br />
width: 282px;<br />
}<br />
<br />
.column1,<br />
.column2,<br />
.column3<br />
{<br />
float: left;<br />
margin-right: 24px;<br />
}<br />
<br />
.column4<br />
{<br />
float: right;<br />
}<br />
</style><br />
<body><br />
<div class="wrapper"><br />
<div id="welcome" class="container"><br />
<div class="title"><br />
<h2>Abstract</h2><br />
</div><br />
</div><br />
<div class="container-text"><br />
<br />
<table width=100%><br />
<tr><br />
<td><br />
<p>Since always, water has been known as a source for life. We cannot survive without water. Although useful water is a necessity which must be satisfied for everyone, nowadays in certain countries there are no enough water supplies for people. The global lack of abundance of usable water is an issue that presents a dangerous problem to our future. Ironically, only a small portion of our planet's water is actually usable. Ninety-seven percent of the world's water is too salty for consumption or agricultural use. Furthermore, much of the rest is held in ice caps or other unattainable sources. This leaves approximately one percent of the global water as liquid and fresh; ninety-eight percent of which is groundwater <b>(Bouwer, 2002)</b>.</p><br />
</td><br />
<td style="padding-left:12px;"><img width=265 height=243 src="https://static.igem.org/mediawiki/2014hs/archive/c/c9/20140609211415%21Logo.png"/></td><br />
</tr></table><br />
<br />
<p>In fact, for solving this problem have been developed different methods. One of them is desalination, converting sea water (rich in salts) into usable water; but this method is very expensive by the great use of electrical energy, and the extraction process produces wastes dangerous for the environment <b>(Cotruvo, 2010)</b>.</p><br />
<br />
<p>For that reason our project is focused on developing a biological machine capable of performing desalination, reducing costs and avoiding dangerous wastes during the process. For making this possible, <i>E. coli</i> must survive in saline environments, able to capture salts, and be removed from the water after the process. In order to achieve the objective we designed a biological circuit in which <i>E. coli</i> could be able to resist adverse conditions though a protein called IrrE, capture Na+ ions (this because sodium chloride is the main salt of sea water) by NhaS production releasing an aroma (WinterGreen) as reporter, and be able for binding silica (L2+AIDA) in order to remove it through a biofilter. The whole circuit is shown below:</p><br />
<br />
<center><p><img width=552 height=343 src="https://static.igem.org/mediawiki/2014hs/9/9b/Whole_circuit.png"<br />
align=center hspace=12 alt="IMG_0317"></p><br />
<br />
<p><b>Figure 1.</b> Diagram representing our proposed circuit</p></center><br />
<br />
<p>But we realized <i>E. coli</i> could have a genetic overload because the circuit was too big (approximately 5000 bp). Also the time we had to finish it was not enough, as well as most of the proteins we wanted to produce were putative or untested. So for a better understanding and for determine if each piece works we divided the project into four modules: capture, binding, aroma and resistance, but the project is the result of their correlation. In fact our bacteria was named E. CARU (each letter by each module). </p><br />
<br />
<center><table width=60%><br />
<tr><br />
<td><br />
<p><b>E</b>scherichia coli</p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_capture"><b>C</b>apture</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_aroma"><b>A</b>roma</a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_resistance"><b>R</b>esistance </a></p><br />
<p><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_union"><b>U</b>nion</a></p><br />
</p><br />
</td><br />
<td style="padding-left:12px;"><img width=286 height=285 src="https://static.igem.org/mediawiki/2014hs/3/30/Image006cideb2014.png"/></td><br />
</tr></table></center><br />
<br />
<p><b>Future results</b></p><br />
<br />
<p>Once we have proved each piece works alone, and we obtained experimental data to support their effectiveness we planned to join every module into the whole circuit we propose at first. It would mean to place IrrE and L2+AIDA gene in <i>E. coli</i>. In the case of NhaS and Wintergreen we would replace the RFP gene from NhaS with the Wintergreen reporter.</p><br />
<br />
<br><p><b>References</b></p><br />
<br />
<font size="2"><br />
<p>● Bouwer, H. (2002). Integrated Water Management for the 21st Century: Problems and Solutions. Journal of irrigation and drainage engineering, 193-200.</p><br />
<p>● Joseph Cotruvo, N. V. (2010). Desalination Technology: Health and Environmental Impacts. U.S: Taylor and Francis Group.</p><br />
<br />
<br />
<br><br />
<br />
<div style="text-align: right;"><a href="https://2014hs.igem.org/Team:CIDEB-UANL_Mexico/project_abstract#"><font color="blue">Return to the Top</font></a></p></div><br />
<br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:CIDEB-UANL_Mexico/footer}}</div>
UnicornioMagico