Notebook

Material

Bacteria strains

Strain name	Risk group
E.coli strain DH5α	1
E.coli strain Mg1655	1
E.coli strain BL21	1

Primer

Name	Sequence	Length
LGT F	ctggaattcatcgatcgttctagagaggccgccgcaaaagaa	42
LGT R	ggactgcagattattatactagtattaagctctagtggaaacctgt	46
SH3 F	cgctggctggtttagttttagcgtttagcgcaagcgcagctgaggccgccgcaaaagaa	59
SH3 F2	ctggaattcgcggccgcttctagatgaaaaagatttggctggcgctggctggtttagt	58
SH3 R	ggactgcagcggccgctactagtatacttctccacgtaagggac	44

Plasmid

Enzyme

name	manufacturer
QuickCut™ EcoRI	Takara
QuickCut™ SpeI	Takara
QuickCut™ PstI	Takara
QuickCut™ XbaI	Takara
T4 DNA Ligase	Takara
rTag PCR enzyme	Takara
Q5® High-Fidelity 2X Master Mix	New England Biolab

Marker

name	manufacturer
200bp DNA ladder marker	Takara
BlueRAY Prestained Protein Ladder	Jet Biofil

Kit

name	manufacturer
TIANprep Mini Plasmid Kit DP103	Tiangen
TIANgel Midi Purification Kit DP209	Tiangen
Aflatoxin B1 Elisa kit	Reagen

Buffer

name	manufacturer
10X QuickCut Green buffer	Takara
10X QuickCut buffer	Takara
10X T4 DNA ligase buffer
dNTP Mixture	Takara
10X PCR buffer	Takara

Competent Cell

name	manufacturer
DH5α competent cell	Tiangen
BL21 competent cell	Tiangen

Protocol

Transformation

1. Remove 30-50 μl competent cell into a clean 1.5 ml micro-centrifuge tube
2. Add 100ng plasmids or ligation products to the competence
3. Let stand on ice for 30 minutes
4. Heat shock for 90 seconds at 42°C
5. Let stand on ice for 5 minutes
6. Add 500 μl LB into the micro-centrifuge tube and incubate at 37°C for 45minutes
7. Centrifuge for 3 minutes at 3000rpm and leave 100 μl supernatant
8. Blow the bacteria up and add the bacteria into the corresponding plate
9. Incubate at 37°C overnight

Plasmids Purification

1. Remove 2ml overnight cultures bacteria into a micro-centrifuge tube, centrifuge for 1 minutes at 12000rpm and discard the supernatant （repeat it for one time）
2. Cell lysis
   1. Add 250 μl Buffer P1
   2. Add 250 μl Buffer P2 and gently flip top to bottom for 6~7 times
   3. Add 350 μl Buffer P3 and gently flip top to bottom for 6~7 times Centrifuge for 10 minutes at 13000rpm
3. Wash silica membrane of the spin column with 500 μl Buffer BL , centrifuge for 1 minutes at 12000rpm and and discard the waste liquid
4. Remove the supernatant (from 3) to the spin column and let stand for 2 minutes
5. Centrifuge for 1 minutes at 12000rpm and discard the waste liquid
6. Add 600 μl Buffer PW , centrifuge for 1 minutes at 12000rpm and discard the waste liquid
7. Add 600 μl Buffer PW , centrifuge for 1 minutes at 12000rpm and discard the waste liquid
8. Centrifuge for 3 minutes at 13000rpm and discard the waste liquid
9. Put the column into a clean 1.5 ml micro-centrifuge tube and dry silica membrane for 10 minutes
10. Add 50 μl ddH2O (heated up to 55°C) and Add to the center of the column
11. Centrifuge for 1 minutes at 12000rpm to collect eluted DNA

Restriction Enzyme Digestions

1. Calculate the following requirement for enzymes reaction

   name	amount
   10x Quickcut Buffer	5μl
   DNA solution	1μg DNA
   Enzyme(EcoRI or XbaI or SpeI or PstI)	1μl per kind
   ddH2O	Add to 50μl

2. Incubate at 37°C for 40 minutes

3. Analyze by gel electrophoresis

Agarose Gel Electrophoresis

1. Confect a mixture in concentration of 1.5 ng agarose per 100 ml 1xTAE
2. Boil up the mixture until the agarose completely dissolved
3. Cool down to 50°C to 60°C
4. Pour it into a flat-bed tray and insert a comb
5. Put into the running buffer (1x TAE buffer)
6. Load the DNA mixture with loading buffer into the pockets
7. Electrophoreses for 35 minutes at 120V

Gel Extraction Of DNA Fragments

1. Get the gel parts containing the needed DNA fragement size from the agarose gel with a scalpel
2. Centrifuge for 30 seconds at 12000rpm
3. According to the volume of the gel and add Buffer PN of the same volume
4. Incubate at 55°C until the gel slices completely dissolved
5. Wash silica membrane of the spin column with 500 μl Buffer BL , centrifuge for 1 minutes at 12000rpm and and discard the waste liquid
6. Remove the liquid (from 4) to the spin column
7. Centrifuge for 1 minutes at 12000rpm and discard the waste liquid
8. Add 600 μl Buffer PW , centrifuge for 1 minutes at 12000rpm and discard the waste liquid
9. Add 600 μl Buffer PW , centrifuge for 1 minutes at 12000rpm and discard the waste liquid
10. Centrifuge for 3 minutes at 13000rpm and discard the waste liquid
11. Put the column into a clean 1.5 ml micro-centrifuge tube and dry silica membrane for 10 minutes
12. Add 25 μl ddH2O (heated up to 55°C) and Add to the center of the column
13. Centrifuge for 1 minutes at 12000rpm to collect eluted DNA

Ligation

1. Calculate the following requirement for enzymes reaction

   name	amount
   10x T4 Buffer	2μl
   large fragments	30ng DNA
   small fragments	60ng DNA
   T4 ligase	1μl
   ddH2O	Add to 20μl

   The reaction solution was adjusted according to annealing conditions.

2. Incubate at 16°C for 1 hour

Colony PCR

Colonies were picked with pipet tips and dipped into the PCR mixture.

ingredient	amount
Overnight Culture	Top of a pipet tip 30ng DNA
10x PCR buffer	2.0μl
Forward primer (10µM)	0.4μl
Reverse primer (10µM)	0.4μl
dNTPs mixture	2.0μl
Polymerase	0.2μl
ddH2O	Add to 20μl

Storage:

name	temperature [°C]
plasmids and engineered bacteria	-20
competent cell	-80
plates with bacteria	4
other chemicals	As the protocol recommends

Schedule

• Week1 making mistakes and improving the project

• Week2 making mistakes and improving the project

• Week3 making mistakes

• Week4 take a break

• Week5 gene synthesising

• Week6 constructing the device

• Week7 constructing the device

• Week8 constructing the device

• Week9 making mistakes

• Week10 making mistakes

• Week11 constucting the device

• Week12 doing western blot

• Week13 doing western blot

• Week14 Elisa

• Week15 writing wiki

• Week16 go to U.S and precentation