Team:CIDEB-UANL Mexico/labwork results
From 2014hs.igem.org
Results
Biobricks construction- Return to the top
Here are the results of how the team got the modules of the project
Minipreps- Return to the top
The first step to build up the four modules in bio-brick format with the vector pSB1C3 is to isolate the plasmid DNA from the bacteria through a mini prep.
The next electrophoresis geles (Image 1) shows that the extraction of the DNA was performed correctly. As in the beginning it was planned to put the four modules in vectors with different antibiotic resistance (such as pSB1C3, pSB1T3, pSB1A3 and pSB1K3) in a single E. col, but the team decided to first insert all of the genes in pSB1C3 so they could be sent to the parts registry.
Image 1. Electrophoresis geles showing the plasmid DNA gotten from mini preps of bacteria transformed with pUC57-NhaS, pUC57-BSMT1 opt., pUC57-AIDA, pUC57-L2, pSB1C3-RFP, pSB1K3-RFP and pSB1A3-RFP.
Digestions
-Return to the top
The next step of obtaining the DNA is get only the needed fragment for the project, this would be accomplished through a digestion with the enzymes of the biobrick format: EcoRI and PstI (In the case of pSB1C3, nhaS and BSMT1 opt.). But in the case of the union module, there is a fusion protein, it means that the digestion of AIDA and L2 (parts of the fusion protein) is with other enzymes, the first with PstI and BglII, and the second with EcoRI and BamHI.
In the digestion made in order to get the plasmid pSB1C3 and the gene NhaS (Image 2. right gel) both were differentiated from their respective insert (RFP) and plasmid (pUC57) by its length. The plasmid stays in the upper part of the gel while the insert stays below it.
The same happened with the digestion of BSMT1 opt., AIDA and L2 (Image 2. left gel) the genes were differentiated by its length.
Image 2.In the left gel: Gel of digestion of pSB1C3 (left black square) and NhaS (right black square). In the right gel: Gel of digestion of pSB1C3 (upper left square), AIDA, L2 and BMST1 opt. (In that order, the tree black squares of the right).
Purification- Return to the top
There is not need of make all the purification process of the fragments gotten in the digestion, easily the ligation can be done. But to make sure that only the pieces that were wanted to ligate, were together, it was done a purification. Then to confirm that there were only the fragments such as pSB1C3, BSTM1 opt. L2 and AIDA, it was made an electrophoresis gel:
Image 3. Electrophoresis geles of digestion after purification process after. The "M" before the first well of the gel, stands for Mark
Ligations- Return to the top
After the purification of the digestions was made, the fragments were ligated with their respective gene-plasmid. Then bacteria were transformed with those ligations and inoculated in a Petri dish obtaining the next result:
Ligation of NhaS and pSB1C3 [Capture Module] - Return to the top
In the first transformation of the ligation of NhaS and pSB1C3 grew red (expressing RFP) and white bacteria. The Petri dish was not cover by aluminum after its inoculation.
Image 4. NhaS first ligation with pSB1C3. Result of the transformation of the ligation between NhaS and pSB1C3.
There was a second transformation of the same ligation, also it was inoculated in a Petri dish getting Image 5. as result. There were also present red and white bacteria. The Petri dish was not cover by aluminum after its inoculation.
Image 5.NhaS first ligation with pSB1C3. Result of the transformation of the ligation between NhaS and pSB1C3.
Result of ligation BSMT1 (optimized) and pSB1C3 [Aroma Module] - Return to the top
The main gene of the aroma module, BSMT1 opt. was ligated with pSB1C3, and then transformed in bacteria in order to be inoculated. In the resulting inoculation there were only white colonies of bacteria.
Image 6.Colonies obtained from the transformation of the ligation BSMT1 opt and pSB1C3.
Characterization- Return to the top
Capture module characterization
Once NhaS was in pSB1C3, it was needed to prove it through a characterization, also there was the question of why in the ligation there were red and white bacteria, if all had the plasmid to chloramphenicol resistance (reason they lived). Which of the two types really had NhaS?. To know with which enzyme make the digestion, it was made a digital digestion of the plasmid and the insert getting the next result:
Image 7. Virtual digestion of NhaS (yellow) +RFP (red) +pSB1C3 (purple) by the enzyme Arsl (blue), showing that its restriction site is repeated two times, one in NhaS and other in pSB1C3.
The problem was that the enzyme that cuts NhaS and pSB1C3 was not available to the team, and it would take a long time to get it. To solve this problem, it was sent the DNA to be sequenced and then prove that the ligation actually occurred, and NhaS was inside pSB1C3. It was used a primer that is from 5' to 3' in the complementary chain:
5´ATTACCGCCTTTGAGTGAGC 3'The result of the sequencing of the mini prep of the bacteria transformed with NhaS in pSB1C3 that showed the RFP production was the next (in 3' to 5' direction):
3' AAAGTGTCCACCCCGTACGACCGAGCGGAGCGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTAATCTTTTCGGCTTA AAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTATATAAACGCAGAAAGGC CCACCCGAAGGTGAGCCAGTGTGACTCTAGTAGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCG ACTGAGCCTTTCGTTTTATTTGATGCCTGGCTCTAGTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAG TGACGACCTTCAGCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTT TGTAAGCACCCGGCAGCTGAACCGGTTTTTTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAG TTTCAGACGCATTTTGATTTCACCTTTCAGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTT TTTTTCTGCATAACCGGACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGG AGGAGTCCTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAG TTTCAGGTAGTCCGGGATGTCAGCCGGGTGTTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGAACAGGATGTCCC AAGCGAACGGCAGCGGACCACCTTTGGTAACTTTCAGTTTAGCGGTCTCGGGTACCTTCGAACGGACGACCTTCACCTTCAC CCTTCAATTTTCAAACTCGTGACCGTAAACGGAACCTTTCCATACAACTTTGAAAACGCATGAAACTCATTTGAATAACGTC TTCCGGAAGAAAGCCCAATCTAAGTATTTTCTCCCTCTTTTCTCATATAAATGTGATGAATATTTGATCTATCCGCCCTCCA ACAACTTTCCCACAACAATCATGTATCGAAATTCCTGTTATACGACACTATAAAGATGGTATAAAAAGCCCGTGGAGGGGGC GTGACCA 5'
And this is the sequence obtained from the miniPrep of the white bacteria transformed with NhaS:
3' TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACCTGCATAACGC GAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACT AGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTACCTTCAGCACGTTCGTACTGTTCA ACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTT TTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTC AGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGAC GGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACA CCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCC GGGTGTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTG GTAACTTTCAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTT AACGGAACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTCGCTTAC AAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTTTGCCATGCAGATT CCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGTAA 5'
Aroma module characterization
To characterize the aroma module, the process of sequencing was made too
3' TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACCTGCATAACGC GAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACT AGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTACCTTCAGCACGTTCGTACTGTTCA ACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTT TTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTC AGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGAC GGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACA CCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCC GGGTGTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTG GTAACTTTCAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTT AACGGAACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTCGCTTAC AAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTTTGCCATGCAGATT CCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGTAA 5'
Experiments- Return to the top
It is needed to characterize and prove the modules, here are the results of the experiments made in order to accomplish it.
UV Experimentation - Return to the top
During 2 hours the four Petri dishes were exposed to UV irradiation. None of them showed any change.
Image 8.Petri Dish inoculated with NhaS in pSB1C3 exposed to UV irradiation at 302 nm. Before, no time being exposed (left) and after 2 hours of being exposed (right).
Repetition UV Experimentation - Return to the top
Two Petri dishes inoculated by streak: One with NhaS Red and the other with NhaS White. Both exposed during 30 minutes to UV irradiation at 302 nm and none of them showed any change.
With no time exposed to UV irradiation:
Image 9.Nhas in pSB1C3 before being exposed to UV irradiation.
After 30 minutes:
Image 10.Nhas in pSB1C3 before being exposed to UV irradiation.
Viability test of the NhaS gene containing bacteria in salt [Capture Module] - Return to the top
Experiment #1
Bacteria transformed with the capture plasmid were inoculated in Petri dishes with different concentrations of salt
Image 11. All the 18 Petri dishes inoculated with NhaS Red in pSB1C3 of all the 9 used concentrations.
Image 12. All the 18 Petri dishes inoculated with NhaS White in pSB1C3 of all the 9 used concentrations.
Image 13. All the 18 Petri dishes inoculated with the Control bacteria of all the 9 used concentrations.
All the bacteria containing the NhaS in pSB1C3 (Red and White) survived to a 10% concentration of salt.
None of the control group lived in any concentration of salt.
Image 14. Nine Petri dishes with the maximum concentration of salt (10%) used in this experiment. From up to bottom: NhaS Red in pSB1C3, NhaS White in pSB1C3 and the Control bacteria.
The first time the experiment one was performed, bacteria transformed with the capture plasmid were inoculated in Petri dishes with different concentrations of salt, but this time the mayor concentration is higher (15%)
All the bacteria transformed with NhaS in pSB1C3 (Red and White) lived in the 15% saline medium.
All the control bacteria exposed to any concentration of salt died.
All the control bacteria inoculated only in LB medium (without salt) lived.
Image 15. In the upper left part NhaS Red in pSB1C3 at 15% of salt. In the upper right part NhaS Whit in pSB1C3 at 15% of salt. In the lower left part the Control bacteria at 15% of salt. In the lower right part the Control bacteria with only LB medium (without salt)
Experiment #2 - Return to the top
In the experiment #1, it was proved that the NhaS transformed bacteria (red and white) survived to a saline environment with LB agar. Then it order to know if it would survive only in a saline medium, it was designed a second experiment where the bacteria was inoculated in erlenmeyer flasks with only salty water at different concentrations (1%, 2.5% 5%, 10% and 15%). None of all the inoculated erlenmeyer flasks was murky, it means that all of the bacteria was dead.
Image 16. Erlenmeyer flasks inoculated with NhaS transformed red bacteria of all concentrations. From left to right: 15%, 10%, 5%, 2.3% and 1%.
Experiment # 3
AQUI D:
Aroma Qualitative Experiments [Aroma Module] - Return to the top
Experiment 1 - Test tubes
AQUI S;
Experiment 2 - Petri dishes
Random people were chosen to smell our bacteria, four people per each concentration. The experiment was performed with three different concentrations of salicylic acid, which were of 10 mM, 20 mM, and 30 mM. All of the samples contained salicylic acid. There was a controlled group grown bellow and above the 32 ºC and a group with transformed bacteria with the Aroma module, also grown bellow and above the 32 ºC; per each concentration.
Those are the words that people used to repeat, or synonyms of what the said, because all the opinions were described in a different way.
Controlled Group Below 32 ºC | Group Below 32 ºC | Controlled Group Above 32 ºC | Group Above 32 ºC | |
10 mM | Corn | Rotten food but with a fresh scent | Rotten food | Ointment or a very Fresh Scent |
20 mM | Rotten food | A little bit fresh | Rotten food | Household product. (Fresh) |
30 mM | Rotten food | Rotten food | Rotten food | Rotten food |
Image 12. People smelling the different Petri dishes previously inoculated with the bacteria transformed with the aroma module in order to describe the odor they perceive.
Qualitative Aroma experimentation in petri dishes