Team:CIDEB-UANL Mexico/labwork results
From 2014hs.igem.org
Results
Biobricks construction- Return to the top
Here are the results of how the team got the modules of the project
Minipreps- Return to the top
GELES MINIPREPS
Digestions
-Return to the top
Digestion of NhaS and pSB1C3
Electrophoresis gel of quantitative digestion of NhaS and pSB1C3. The digestion was made in order to get the plasmid pSB1C3 and the gene NhaS. As a plasmid is differentiated from the insert by its length, it stays in the upper part of the gel while the insert RFP stays below it. Same with NhaS, as insert is stays below the vector pUC57
Image 1.Gel of digestion of pSB1C3 (left black square) and NhaS (right black square)
Ligations- Return to the top
Ligation of NhaS and pSB1C3 [Capture Module] - Return to the top
In the first transformation of the ligation of NhaS and pSB1C3 grew red (expressing RFP) and white bacteria.
Image 1. NhaS first ligation with pSB1C3. Result of the transformation of the ligation between NhaS and pSB1C3.
Image 2.NhaS first ligation with pSB1C3. Result of the transformation of the ligation between NhaS and pSB1C3.
Result of ligation BSMT1 (optimized) and pSB1C3 [Aroma Module] - Return to the top
Image 3.Colonies obtained from the transformation of the ligation BSMT1 opt and pSB1C3.
Characterization- Return to the top
Once NhaS was in pSB1C3, it was needed to prove it through a characterization. It was made a digital digestion of the plasmid and the insert getting the next result:
IMGAGEN PLASMIDO NhaS
The problem was that the enzyme that cuts NhaS and pSB1C3 was not available to the team, and it would take a long time to get it. To solve this problem, it was sent the DNA to be sequenced and then prove that the ligation actually occurred, and NhaS was inside pSB1C3.
The result of the sequencing of the DNA of the bacteria transformed with NhaS in pSB1C3 that showed the RFP production was the next:AAAGTGTCCACCCCGTACGACCGAGCGGAGCGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTAATCTTTTCGGCTT AAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTATATAAACGCAGAAAG GCCCACCCGAAGGTGAGCCAGTGTGACTCTAGTAGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTT TCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCTCTAGTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGT GGAGTGACGACCTTCAGCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTC GGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTTTTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTC TTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACC CATGGTTTTTTTCTGCATAACCGGACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTT GCAGGGAGGAGTCCTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAG GACAGTTTCAGGTAGTCCGGGATGTCAGCCGGGTGTTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGAACAGG ATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTTCAGTTTAGCGGTCTCGGGTACCTTCGAACGGACGACCTTCAC CTTCACCCTTCAATTTTCAAACTCGTGACCGTAAACGGAACCTTTCCATACAACTTTGAAAACGCATGAAACTCATTTGAATA ACGTCTTCCGGAAGAAAGCCCAATCTAAGTATTTTCTCCCTCTTTTCTCATATAAATGTGATGAATATTTGATCTATCCGCCCT CCAACAACTTTCCCACAACAATCATGTATCGAAATTCCTGTTATACGACACTATAAAGATGGTATAAAAAGCCCGTGGAGGG GGCGTGACCA
Experiments- Return to the top
It is needed to characterize and prove the modules, here are the results of the experiments made in order to accomplish it.
UV Experimentation - Return to the top
During 2 hours the four Petri dishes were exposed to UV irradiation. None of them showed any change.
Image 4.Petri Dish inoculated with NhaS in pSB1C3 exposed to UV irradiation at 302 nm. Before, no time being exposed (left) and after 2 hours of being exposed (right).
Repetition UV Experimentation - Return to the top
Two Petri dishes inoculated by streak: One with NhaS Red and the other with NhaS White. Both exposed during 30 minutes to UV irradiation at 302 nm and none of them showed any change.
With no time exposed to UV irradiation:
Image 5.Nhas in pSB1C3 before being exposed to UV irradiation.
After 30 minutes:
Image 6.Nhas in pSB1C3 before being exposed to UV irradiation.
Viability in Salt. Experiment 1 [Capture Module] - Return to the top
Bacteria transformed with the capture plasmid were inoculated in Petri dishes with different concentrations of salt
Image 7. All the 18 Petri dishes inoculated with NhaS Red in pSB1C3 of all the 9 used concentrations.
Image 8. All the 18 Petri dishes inoculated with NhaS White in pSB1C3 of all the 9 used concentrations.
Image 9. All the 18 Petri dishes inoculated with the Control bacteria of all the 9 used concentrations.
All the bacteria containing the NhaS in pSB1C3 (Red and White) survived to a 10% concentration of salt.
None of the control group lived in any concentration of salt.
Image 10. Nine Petri dishes with the maximum concentration of salt (10%) used in this experiment. From up to bottom: NhaS Red in pSB1C3, NhaS White in pSB1C3 and the Control bacteria.
Viability in Salt. Experiment 2 [Capture Module] - Return to the top
As in the Experiment 1, bacteria transformed with the capture plasmid were inoculated in Petri dishes with different concentrations of salt, but this time the mayor concentration is higher (15%)
All the bacteria transformed with NhaS in pSB1C3 (Red and White) lived in the 15% saline medium.
All the control bacteria exposed to any concentration of salt died.
All the control bacteria inoculated only in LB medium (without salt) lived.
Image 11. In the upper left part NhaS Red in pSB1C3 at 15% of salt. In the upper right part NhaS Whit in pSB1C3 at 15% of salt. In the lower left part the Control bacteria at 15% of salt. In the lower right part the Control bacteria with only LB medium (without salt)
Aroma Qualitative Experiment [Aroma Module] - Return to the top
Random people were chosen to smell our bacteria. The experiment was performed with three different concentrations of salicylic acid, which were of 10 mM, 20 mM, and 30 mM. All of the samples contained salicylic acid. There was a controlled group grown bellow and above the 32 ºC and a group with transformed bacteria with the Aroma module, also grown bellow and above the 32 ºC; per each concentration.
Those are the words that people used to repeat, or synonyms of what the said, because all the opinions were described in a different way.
Controlled Group Below 32 ºC | Group Below 32 ºC | Controlled Group Above 32 ºC | Group Above 32 ºC | |
10 mM | Corn | Rotten food but with a fresh scent | Kind of fresh | Ointment or a very Fresh Scent |
20 mM | Rotten food | A little bit fresh | Household product. (Fresh) | Rotten food |
30 mM | Rotten food | Rotten food | Rotten food | Rotten food |
Image 12. People smelling the different Petri dishes previously inoculated with the bacteria transformed with the aroma module in order to describe the odor they perceive.