Team:CIDEB-UANL Mexico/labwork results

Biobricks construction- Return to the top

Here are the results of how the team got the modules of the project

Minipreps

Digestions

Purification

Ligations

Characterization

Minipreps- Return to the top

The first step for building the four modules in a bio-brick format, with the vector pSB1C3 is to isolate the plasmid DNA from the bacteria through a mini prep.

The next electrophoresis geles (Image 1) shows that the extraction of the DNA was performed correctly. At the beginning, it was planned to put the four modules in vectors with different antibiotic resistance (such as pSB1C3, pSB1T3, pSB1A3 and pSB1K3) in a single E. coli, but the team decided to first, insert all of the genes in pSB1C3 so they could be sent to the parts registry.

Digestions-Return to the top

The next step of obtaining the DNA is get only the needed fragment for the project, this would be accomplished through a digestion with the enzymes of the biobrick format: EcoRI and PstI (In the case of pSB1C3, nhaS and BSMT1 opt.). But in the case of the union module, there is a fusion protein, it means that the digestion of AIDA and L2 (parts of the fusion protein) is with other enzymes, the first with PstI and BglII, and the second with EcoRI and BamHI.

In the digestion made in order to get the plasmid pSB1C3 and the gene NhaS (Image 2. right gel) both were differentiated from their respective insert (RFP) and plasmid (pUC57) by its length. The plasmid stays in the upper part of the gel while the insert stays below it.

The same happened with the digestion of BSMT1 opt., AIDA and L2 (Image 2. left gel) the genes were differentiated by its length.

Purification- Return to the top

There is not need of make all the purification process of the fragments gotten in the digestion, easily the ligation can be done. But to make sure that only the pieces that were wanted to ligate, were together, it was done a purification. Then to confirm that there were only the fragments such as pSB1C3, BSTM1 opt. L2 and AIDA, it was made an electrophoresis gel:

Ligations- Return to the top

After the purification of the digestions was made, the fragments were ligated with their respective gene-plasmid. Then bacteria were transformed with those ligations and inoculated in a Petri dish obtaining the next result:

Ligation of NhaS and pSB1C3 [Capture Module] - Return to the top

In the first transformation of the ligation of NhaS and pSB1C3 grew red (expressing RFP) and white bacteria. The Petri dish was not cover by aluminum after its inoculation.

There was a second transformation of the same ligation, also it was inoculated in a Petri dish getting Image 5. as result. There were also present red and white bacteria. The Petri dish was not cover by aluminum after its inoculation.

Result of ligation BSMT1 (optimized) and pSB1C3 [Aroma Module] - Return to the top

The main gene of the aroma module, BSMT1 opt. was ligated with pSB1C3, and then transformed in bacteria in order to be inoculated. In the resulting inoculation there were only white colonies of bacteria.

Characterization- Return to the top

Capture module characterization

Once NhaS was in the pSB1C3 plasmid, it was needed to prove it, through a characterization; also there was the question of why were there in the ligation red and white bacteria, if all had the plasmid to chloramphenicol resistance (reason they lived). Which of the two types really had NhaS?. To know with which enzyme make the digestion, it was made a digital digestion of the plasmid and the insert getting the next result:

The problem was that the enzyme that cuts NhaS and pSB1C3 was not available to the team, and it would take a long time to get it. To solve this problem, it was sent the DNA to be sequenced and then prove that the ligation actually occurred, and NhaS was inside pSB1C3. It was used a primer that is from 5' to 3' in the complementary chain:

5´ATTACCGCCTTTGAGTGAGC 3'

3' AAAGTGTCCACCCCGTACGACCGAGCGGAGCGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTAATC
TTTTCGGCTTAAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAG
TATATAAACGCAGAAAGGCCCACCCGAAGGTGAGCCAGTGTGACTCTAGTAGAGAGCGTTCACCGACAAACAAC
AGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCTCTAGTAGCGATCTAC
ACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACGACCTTCAGCACGTTCGTACTGTTCAACGATGGTG
TAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTTTT
AGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCAC
CTTTCAGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACC
GGACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTC
CTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACA
GTTTCAGGTAGTCCGGGATGTCAGCCGGGTGTTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGAACA
GGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTTCAGTTTAGCGGTCTCGGGTACCTTCGAACGG
ACGACCTTCACCTTCACCCTTCAATTTTCAAACTCGTGACCGTAAACGGAACCTTTCCATACAACTTTGAAAAC
GCATGAAACTCATTTGAATAACGTCTTCCGGAAGAAAGCCCAATCTAAGTATTTTCTCCCTCTTTTCTCATATA
AATGTGATGAATATTTGATCTATCCGCCCTCCAACAACTTTCCCACAACAATCATGTATCGAAATTCCTGTTAT
ACGACACTATAAAGATGGTATAAAAAGCCCGTGGAGGGGGCGTGACCA 5'

And this is the sequence obtained from the miniPrep of the white (non-RFP) transformed bacteria with NhaS:

3' TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACC
TGCATAACGCGAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGA
CTGCAGCGGCCGCTACTAGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTA
CCTTCAGCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGT
TTTGTAAGCACCCGGCAGCTGAACCGGTTTTTTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCAC
CGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAA
GCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTT
GTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAA
CACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCCGGGTGTTTAACGTAA
GCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTT
CAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTTA
ACGGAACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTC
GCTTACAAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTT
TGCCATGCAGATTCCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGT
AA 5'

Aroma module characterization

To characterize the aroma module, the process of sequencing was made too

3' TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGAACC
TGCATAACGCGAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGA
CTGCAGCGGCCGCTACTAGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACTA
CCTTCAGCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGT
TTTGTAAGCACCCGGCAGCTGAACCGGTTTTTTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCAC
CGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAA
GCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTT
GTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAA
CACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCCGGGTGTTTAACGTAA
GCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTT
CAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTTA
ACGGAACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTTC
GCTTACAAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTATCGGTTT
TGCCATGCAGATTCCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGTCCGCAAAATGTGT
AA 5'

Experiments- Return to the top

It is needed to characterize and prove the modules, here are the results of the experiments made in order to accomplish it.

Capture

Aroma

UV Experimentation - Return to the top

During 2 hours the four Petri dishes were exposed to UV irradiation. None of them showed any change.

Repetition UV Experimentation - Return to the top

Two Petri dishes inoculated by streak: One with NhaS Red and the other with NhaS White. Both exposed during 30 minutes to UV irradiation at 302 nm and none of them showed any change.

With no time exposed to UV irradiation:

After 30 minutes:

Viability test of the NhaS gene containing bacteria in salt [Capture Module] - Return to the top

Experiment #1

Bacteria transformed with the capture plasmid were inoculated in Petri dishes with different concentrations of salt

All the bacteria containing the NhaS in pSB1C3 (Red and White) survived to a 10% concentration of salt.

None of the control group lived in any concentration of salt.

The first time the experiment #1 was performed, transformed bacteria with the capture plasmid were inoculated in Petri dishes with different concentrations of salt, but this time the mayor concentration is higher (15%)

All of the transformed bacteria with NhaS in pSB1C3 (Red and White) lived in the 15% saline medium.

All the control bacteria exposed to any concentration of salt died.

All the control bacteria inoculated only in LB medium (without salt) lived.

Experiment #2 - Return to the top

In the experiment #1, it was tested the hypothesis in which the NhaS transformed bacteria (red and white) survived to a saline environment with LB agar. Then it order to know if it would survive only in a saline medium, it was designed a second experiment where the bacteria was inoculated in erlenmeyer flasks with only salty water at different concentrations (1%, 2.5% 5%, 10% and 15%). None of all the inoculated erlenmeyer flasks was murky, it means that all of the bacteria was dead.

Experiment # 3

In the experiment #3 the bacteria's hability to withstand salty environments was again tested, but this time the effect that RFP could possibly have in the expression in the NhaS gene. In this experiment, three groups of bacteria (NhaS+RFP, NhaS and a control group) were exposed to different salinity concentrations to test their resistance to salt. This resistance was given by the NhaS gene. A similar process as the one in the experiment one was followed in which bacteria was cultivated in mediums containing salt at different concentrations, and incubated for 24 hours to appreciate how were the colonies formed.

In the previously made experiment, the team had the chance to test the effectiveness of the NhaS producing bacteria. The results of the experiments were measured in the amount of bacteria colonies on the petri dish. In some cases the amount of bacteria were uncountable, because they were spread throw all the petri dish. So it was measure an average size bacteria colony and it was compare with the size of the petri dish. So it was assume that a petri dish completely full has an approximately number of 2500 bacteria colonies. There were 3 different types of bacteria. The ones with NhaS that do not had RFP, the ones with Nhas and that has RFP and the bacteria that were used as control (no RFP or NhaS). Each one of this were introduced into a different salt percentage solution. The percentage on which the bacteria were tested are 15%, 10%, 5%, 2.5% 1% of salt on the solution. Also another variable for the experiment was the amount of bacteria concentration within the solution. These concentrations are shown in ratios which are 1:10, 1:100 and 1:1000 of a solution with bacteria on the solution. The experiment were executed twice so it means that there are two results for each type of bacteria on a given concentration on a given salt percentage solution.  
The bacteria’s resistance to salinity was expressed in the amount of colonies grown in a medium with a certain level of salinity due to the certain tolerance to salt given by the NhaS gene. After the experiment, the data obtained was plotted into tables for further processing and analysis.

You can download the raw data from this experiment in here.

Aroma Qualitative Experiments [Aroma Module] - Return to the top

Experiment 1 - Test tubes

AQUI S;

Experiment 2 - Petri dishes

Random people were chosen to smell our bacteria, four people per each concentration. The experiment was performed with three different concentrations of salicylic acid, which were of 10 mM, 20 mM, and 30 mM. All of the samples contained salicylic acid. There was a controlled group grown bellow and above the 32 ºC and a group with transformed bacteria with the Aroma module, also grown bellow and above the 32 ºC; per each concentration.

Those are the words that people used to repeat, or synonyms of what the said, because all the opinions were described in a different way.

Qualitative Aroma experimentation in petri dishes