Team:Nanjing NFLS/notebook.html

1

Design of gRNA recognition sequence:

Principles of gRNA recognition sequence design: The specificity of the Cas9 nuclease is determined by the 23-nt guide sequence within the sgRNA. the target sequence must immediately precede a 3′GGN dinucleotide (protospacer adjacent motif PAM), and FUT8 gene is selected as gRNA recognize sequences based sequence motif II structure GGATAAAAAAAGAGTGTATCTGG(Figure 1-3).

2

Preparation of specific recognized gRNA carrier

Depending on the commercial Kit instructions ,the methods of translating DH5 Alpha cells are as follows: Monoclonal antibodies are picked and cultured in 4mL LB medium at 37℃ for 16-hours. Positive cell lines LA Taq (TAKARA CAT.RR002A) are identified by bacterial PCR described above. of PCR products are separated by 1% agarose gel electrophoresis. Select 180bp electrophoresis carrier suspension samples to expand cultivation. 5Ml turbid bacterial culture fluid are collected, endotoxin-free bacterial plasmid extraction kits are used for plasmid extraction operation (CWBIO CAT.CW2106), according with the commercial Kit instructions. DNA samples are prepared for UV (260 å/280 å) quantitative and saved in refrigerator below -20℃.

3

Preparation of CAS9 DNA Double-strand breaks enzyme

HCas9 plasmid (Addgene plasmid 41815) whose backbone are pcDNA3.3-TOPO（Invitrogen）are saved in plasmid puncture tube and cultured in 4mL LB medium with ampicillin (Ampicillin) resistance and 210rpm shocks at 37℃ for 16-hours, then, 5Ml turbid bacterial culture fluid are collected. Endotoxin-free bacterial plasmid extraction kits are used for plasmid extraction operation (CWBIO CAT.CW2106), according with the commercial Kit instructions. DNA samples are prepared for UV (260 å/280 å) quantitative and saved in refrigerator below -20℃.

4

Transfection

Chinese hamster ovary (CHO-K1) cell lines which are saved in our laboratory are cultured in Media DMEM/F12 (calf serum containing HEPES, 10%) at 37∘C in a humidified atmosphere (5% CO2, 95% air). Cell grows adherently, with 0.25% trypsin (EDTA) digesting every 48 hours, which 10% passage. For transfection experiments, the cells were seeded in 24-well tissue culture plate at 1×106 cells every well at 37∘C in a humidified atmosphere (5% CO2, 95% air). Replace the medium at an hour before transfection.

Dose of Plasmid for transfection:

DNA mixture liquor:

Lipofectamine2000/DNA Transfection reagents diluent preparation: gently mix, let stand for 20 minutes.

Preparation of Lipofectamine2000/DNA mixture: 50 μl of diluted Lipofectamine2000 drops add 50 μl DNA mixture, gently mix, let stand for 5 minutes.
Mixed droplets containing added Lipofectamine2000/DNA cell culture the hole, gently shake mix. Culture in 37∘C, 5% carbon dioxide for 6 h. Replace the medium DMEM/F12 (calf serum containing HEPES, 10%), incubating for 18h

5

the preliminary identification of monoclonal cells

About 5x106 are harvested and are centrifugalized at 1000rpm for 5 minutes, discard the supernatant, wash cells with PBS once. Use cell genome genome action kit to manipulate genome.

Gene obtain amplification primers:

LA Taq PCR Reaction system：

Touchdown PCR Reaction conditions：

PCR products are separated by electrophoresis using 1% agarose gel . Gel extraction Kit is used to recycle positive band.S1 nuclease digestion and recycled products separately t carrier connection sequence.

5.1

S1 nuclease digestion
S1 nuclease digestion: Recycled products are heated at 98∘C for 10 minutes, and then, cooled to room temperature, nuclease S1 (THERMO CAT.EN0321) enzymes at room temperature for 30 minutes, accordding with the commercial Kit instructions for specific methods.

Harvest of CRISPR/Cas/Donor knockout group, LA Taq PCR amplification of target gene sequence, and S1 nuclease digestion with restriction enzymes BamH I restriction enzyme digestion.S1 nuclease could identify mutations annealed to form single stranded DNA convex Central and catalytic the break of DNA strand. Enzymes BamH I can cut off the homologous recombinant vector into the enzyme loci. Knockout group is located in less than 500bp Strip, being consistent with theoretical Strip locations.

Figure 2:S1 nuclease digestion with restriction enzymes BamH I restriction enzyme digestion

S1 nuclease has the function of degradation of single-stranded nucleic acid, releases single nucleotide 5' phosphoryl or oligonucleotides, but also as the incision is cut double-stranded DNA, gaps and mismatches, or ring-like structure caused by single strand region. CRISPR/Cas Sentinel-mediated gene knockout cell specific gene loci will be rendered to produce a random deletion and insertion.Total cells genome extraction and amplification of target gene fragments, through denaturation and annealing, the wild-type gene fragments and fragments of mutated hybrid annealing, mutation due to the cut, nicked, single strand region due to mismatch or a ring-like structure, S1 nuclease will double-stranded DNA cut at this point (Figure 2-6).

Figure 3:S1 nuclease enzyme analysis principle

 

 

5.2

T carrier connection sequence:

Gel extraction of electrophoresis sample stripes 773bp, recycling products are amplified by Taq PCR for the second LA, according with the commercial Kit instructions. PCR reaction conditions: predegenerated 95 ℃ for 5 minutes, 94℃ for 30 seconds, 42 ℃ for 30 seconds, and 72℃ for 30 seconds, 30 cycles, extension 72 ℃for 5 minutes.

PCR reaction system:

PCR products are separated by 1% agarose gel electrophoresis. 773bp positive band products are recycled using gel extraction Kit (TIANGEN CAT.DP209-2).
PCR recovery products are connected with pMD19-T (TAKARA CAT.D102A) through a TA cloning vector, according with the commercial Kit instructions for specific methods.Translate DH5 Alpha cells according with the commercial Kit instructions for specific methods and incubate them at 37 ℃ for 16-hour . Monoclonal cells are picked and incubated in 4mL propagation LB medium, at 37 ℃, for 16-hours. DNA sequencing is perfomed to identify the actual sequence.

That shows a cut has happened by sequencing because missing sequence has been found.

April

April:

We start to design the g-RNA with high specificity. For working in the CHO, sequence of our tool kits hardly have similarity with the OMP of TMV. So we find the proper sequences and prove them.

TAGAATTGATCAGAGGAAC
AGGAACCGGATCTTATAAT
GAGGAACCGGATCTTATAATCGG
GTAGAATTGATCAGAGGAACCGG
Gtacgcaccacgtgtgattacgg
TACGCACCACGTGATTA

May

We build up the parts of our toolkits.
Restructure the PSB1C3 XbaI speI sites

tgatttctggaattcgcggccgcttctaga

actagtagcggccgctgcagtccggcaaa

tgatttctggaattcgcggccgcttctaga

TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGTCCCAGCTTTCTTGTACAAAGTTGGCATTA actagtagcggccgctgcagtccggcaaa

actagtagcggccgctgcagtccggcaaa

Use Gabc-F: tgatttctggaattcgcggccgcttctagaTGTACAAAAAAGCAGGCTTTAAAGG TM62
Gabc-R: CAAGAAATCGAAATACTTTCAAGTTACG

Expend the gRNA to the following sequence
TGATTTCTGGAATTCGCGGCCGCTTCTAGATGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTG

Synthesis the first piece and the last piece
GTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGTCCCAGCTTTCTTGTACAAAGTTGGCATTA actagtagcggccgctgcagtccggcaaa

Gain:

GA:
tgatttctggaattcgcggccgcttctaga
TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTAGAATTGATCAGAGGAACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGTCCCAGCTTTCTTGTACAAAGTTGGCATTA actagtagcggccgctgcagtccggcaaa

GB:
tgatttctggaattcgcggccgcttctaga
TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGAGGAACCGGATCTTATAATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGTCCCAGCTTTCTTGTACAAAGTTGGCATTA actagtagcggccgctgcagtccggcaaa

GC:
tgatttctggaattcgcggccgcttctaga
TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTACGCACCACGTGTGATTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGTCCCAGCTTTCTTGTACAAAGTTGGCATTA actagtagcggccgctgcagtccggcaaa