"
Team:Nanjing NFLS/biobricks.html
From 2014hs.igem.org
(Difference between revisions)
AlexGorilla (Talk | contribs) |
AlexGorilla (Talk | contribs) |
||
| Line 15: | Line 15: | ||
</div> | </div> | ||
</html> | </html> | ||
| - | |||
<html xmlns="http://www.w3.org/1999/xhtml"> | <html xmlns="http://www.w3.org/1999/xhtml"> | ||
<head> | <head> | ||
| Line 30: | Line 29: | ||
font-size: 150px; | font-size: 150px; | ||
font-color: white; | font-color: white; | ||
| - | left: | + | left: 228px; |
text-align: center; | text-align: center; | ||
font-family: "Century Gothic"; | font-family: "Century Gothic"; | ||
| Line 43: | Line 42: | ||
width: 600px; | width: 600px; | ||
z-index: 2; | z-index: 2; | ||
| - | left: | + | left: 404px; |
top: 273px; | top: 273px; | ||
font-size: 20px; | font-size: 20px; | ||
Revision as of 08:14, 20 June 2014
A
gRNA Specific Recognition Sequence Transcription Vectors
There are three sets of gRNA.
The Guide-RNA sequence comes from Addgene plasmid 41824(gRNA_Cloning Vector).
The Guide-RNA sequence is inserted in the DNA from into basic plasmid backbone pSB1C3（BBa_J04450）with BioBrick cloning site prefix（EcoR I，Xba I）and suffix（Spe I，Pst I）. When the plasmid is transfected into the mammalian cell nuclei, the plasmid will transcript into the form of Guide-RNA or gRNA.
There are three sets of gRNA.
The Guide-RNA sequence comes from Addgene plasmid 41824(gRNA_Cloning Vector).
The Guide-RNA sequence is inserted in the DNA from into basic plasmid backbone pSB1C3（BBa_J04450）with BioBrick cloning site prefix（EcoR I，Xba I）and suffix（Spe I，Pst I）. When the plasmid is transfected into the mammalian cell nuclei, the plasmid will transcript into the form of Guide-RNA or gRNA.
Three Sets Of gRNA
a
gRNA-A (BBa_K1252001)
TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTAGAATTGATCAGAGGAACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGACCCAGCTTTCTTGTACAAAGTTGGCATTA
b
gRNA-B (BBa_K1252002)
TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGAGGAACCGGATCTTATAATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGACCCAGCTTTCTTGTACAAAGTTGGCATTA
c
gRNA-C (BBa_K1252003)
TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTACGCACCACGTGTGATTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT
TCTAGACCCAGCTTTCTTGTACAAAGTTGGCATTA
*
*The unhighlighted parts of each gRNA is identical.
*The blue highlighted part is mutated from TCTAGA（EcoR I）to TCTAGT.
*The yellow highlighted part is commentary to the corresponding target gene with homologous arms.
*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）.
*The blue highlighted part is mutated from TCTAGA（EcoR I）to TCTAGT.
*The yellow highlighted part is commentary to the corresponding target gene with homologous arms.
*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）.
B
thDNA Target Recombinant Sequences of Vectors
Upstream and Downstream Homologous Arm with Target Gene There are three sets of thDNA corresponding to the three sets of gRNA, with an upstream homologous and a downstream homologous in each set.
thAF/thAR
thBF/thBR
thCF/thCR
The thDNA sequence is inserted in the DNA from into basic plasmid backbone pSB1C3（BBa_J04450）with BioBrick cloning site prefix（EcoR I，Xba I）and suffix（Spe I，Pst I）. When the plasmid is transfected into the mammalian cell nuclei, the plasmid will retain its form until there’s a CRISPR-Cas9 breakage available.
Upstream and Downstream Homologous Arm with Target Gene There are three sets of thDNA corresponding to the three sets of gRNA, with an upstream homologous and a downstream homologous in each set.
thAF/thAR
thBF/thBR
thCF/thCR
The thDNA sequence is inserted in the DNA from into basic plasmid backbone pSB1C3（BBa_J04450）with BioBrick cloning site prefix（EcoR I，Xba I）and suffix（Spe I，Pst I）. When the plasmid is transfected into the mammalian cell nuclei, the plasmid will retain its form until there’s a CRISPR-Cas9 breakage available.
a
thAF (BBa_K1252004)
TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAATCGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGAAATCAGTGTAGAATTGATCAGAGGAACCGG
*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）
*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）
b
thBF (BBa_K1252005)
TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAATCGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGAAATCAGTGAGGAACCGGATCTTATAATCGG
*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）
*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）
c
thCF (BBa_K1252006)
TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAATCGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGAAATCAGTGTACGCACCACGTGTGATTACGG
*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）
*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）
*
*The yellow highlighted part is commentary to the guide-RNA sequence with homologous arms.
d
thAR (BBa_K1252007)
GTAGAATTGATCAGAGGAACCGGTTCAAACACAACAAGCTCGAACTGTCGTTCAAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCCCTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCACAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT
e
thBR (BBa_K1252008)GAGGAACCGGATCTTATAATCGGTTCAAACACAACAAGCTCGAACTGTCGTTCAAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCCCTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCACAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT
f
thCR (BBa_K1252008)
GTACGCACCACGTGTGATTACGGTTCAAACACAACAAGCTCGAACTGTCGTTCAAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCCCTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCACAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT
*
*The yellow highlighted part is commentary to the guide-RNA sequence with homologous arms.
C
CRISPR-Cas9 Enzyme
Microbes rely on diverse defense mechanisms that allow them to withstand viral predation and exposure to invading nucleic acid. In many Bacteria and most Archaea, clustered regularly interspaced short palindromic repeats (CRISPR) form peculiar genetic loci, which provide acquired immunity against viruses and plasmids by targeting nucleic acid in a sequence-specific manner. These hypervariable loci take up genetic material from invasive elements and build up inheritable DNA-encoded immunity over time. Conversely, viruses have devised mutational escape strategies that allow them to circumvent the CRISPR/Cas system, albeit at a cost. CRISPR features may be exploited for typing purposes, epidemiological studies, host-virus ecological surveys, building specific immunity against undesirable genetic elements, and enhancing viral resistance in domesticated microbes. [1] [1] Horvath, P.; Barrangou, R. (2010). "CRISPR/Cas, the Immune System of Bacteria and Archaea". Science 327 (5962): 167–170.
Microbes rely on diverse defense mechanisms that allow them to withstand viral predation and exposure to invading nucleic acid. In many Bacteria and most Archaea, clustered regularly interspaced short palindromic repeats (CRISPR) form peculiar genetic loci, which provide acquired immunity against viruses and plasmids by targeting nucleic acid in a sequence-specific manner. These hypervariable loci take up genetic material from invasive elements and build up inheritable DNA-encoded immunity over time. Conversely, viruses have devised mutational escape strategies that allow them to circumvent the CRISPR/Cas system, albeit at a cost. CRISPR features may be exploited for typing purposes, epidemiological studies, host-virus ecological surveys, building specific immunity against undesirable genetic elements, and enhancing viral resistance in domesticated microbes. [1] [1] Horvath, P.; Barrangou, R. (2010). "CRISPR/Cas, the Immune System of Bacteria and Archaea". Science 327 (5962): 167–170.
