Team:CIDEB-UANL Mexico/labwork discussions
From 2014hs.igem.org
DiegoValadez (Talk | contribs) |
DiegoValadez (Talk | contribs) |
||
Line 339: | Line 339: | ||
As the white and red colonies are supposed to come from the same ligation and to contain the same genetic information we need to prove that the insert was inside them. In order to prove this we sent samples of DNA to be sequenced to the DNA Synthesis and Sequentiation Biotechnology Institute Unit (USSDNA in Spanish), from the UNAM. </p><p> | As the white and red colonies are supposed to come from the same ligation and to contain the same genetic information we need to prove that the insert was inside them. In order to prove this we sent samples of DNA to be sequenced to the DNA Synthesis and Sequentiation Biotechnology Institute Unit (USSDNA in Spanish), from the UNAM. </p><p> | ||
The primer used was in the complementary reverse chain, so the sequences are in the 3’ to 5’ direction. We did an analysis of the sequences obtained by aligning them with the <a href=”http://blast.ncbi.nlm.nih.gov/Blast.cgi”>BLAST Software</a>.</p> | The primer used was in the complementary reverse chain, so the sequences are in the 3’ to 5’ direction. We did an analysis of the sequences obtained by aligning them with the <a href=”http://blast.ncbi.nlm.nih.gov/Blast.cgi”>BLAST Software</a>.</p> | ||
- | <p><b>The RFP sequence used in the alignment was the following:</b> </p> | + | <p><b>The RFP sequence used in the alignment was the following (in 5' to 3' direction):</b> </p> |
<pre> | <pre> | ||
Atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaa | Atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaa | ||
Line 354: | Line 354: | ||
<p> | <p> | ||
It was aligned with the sequences obtained from the samples Nhas white bacteria and Nhas red bacteria. </p> | It was aligned with the sequences obtained from the samples Nhas white bacteria and Nhas red bacteria. </p> | ||
- | <p><b>NhaS sequence from white colonies</b></p> | + | <p><b>NhaS sequence from white colonies (in 3' to 5' direction of the complementary reverse)</b></p> |
<pre> | <pre> | ||
TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGA | TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGA | ||
Line 372: | Line 372: | ||
TCGGTTTTGCCATGCAGATTCCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGT | TCGGTTTTGCCATGCAGATTCCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGT | ||
CCGCAAAATGTGTAA></pre><p> | CCGCAAAATGTGTAA></pre><p> | ||
- | <b>NhaS sequence from red colonies</b></p> | + | <b>NhaS sequence from red colonies (in 3' to 5' direction of the complementary reverse)</b></p> |
<pre> | <pre> | ||
AAAGTGTCCACCCCGTACGACCGAGCGGAGCGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTA | AAAGTGTCCACCCCGTACGACCGAGCGGAGCGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTA |
Revision as of 01:23, 15 June 2014
Discussion
The ligation transformed in E. coli of the NhaS module produced red and white colonies when we expected only red colonies (bacteria expressing the RFP). We did not know the reason of the unexpected result so we designed an experiment with the UV light promoter.
The NhaS module was proved in the experiment with the Petri Dishes in the UV camera. The red bacteria was already red (meaning that the RFP expression already started) before being exposed to the UV camera. The promoter pUV 1765001 is activated by the UV exposition. This is an unexpected result so this can mean that the promoter is so sensible to the UV light that the normal UV radiation is enough to activate it. In the part description is reported that the UV promoter must get active and the protein must be expressed after 10 minutes of exposure in the UV camera, but after 60 minutes (?) there was no change in the white colonies so the RFP was not expressed there.
After doing the experiment we obtained that the red colonies continued with the RFP expression and the white colonies did not changed in color. As we expected to activate the RFP expression in the white colonies, this means that the time of the exposure was not enough to activate the UV promoter or the promoter did not worked in the conditions we thought it would work. To see if the promoter was already activated we did another experiment.
The experiment with NaCl in different concentrations in Petri Dishes showed that the bacteria grew in a medium with high NaCl concentration. The control group with non-modified bacteria did not grow because it did not contain the Nhas insert so it was not able to survive in a saline medium. The white bacteria did actually grow but they did not expressed the RFP, but the fact that they did grow means that they have the NaCl resistance and the insert is inside them.
As the white and red colonies are supposed to come from the same ligation and to contain the same genetic information we need to prove that the insert was inside them. In order to prove this we sent samples of DNA to be sequenced to the DNA Synthesis and Sequentiation Biotechnology Institute Unit (USSDNA in Spanish), from the UNAM.
The primer used was in the complementary reverse chain, so the sequences are in the 3’ to 5’ direction. We did an analysis of the sequences obtained by aligning them with the BLAST Software.
The RFP sequence used in the alignment was the following (in 5' to 3' direction):
Atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaa cggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaac tgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggt tccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggttt caaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgc aagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatg cagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaagg tgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctaca tggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccac aacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaata acgctgatagtgctagtgtagatcgctaa
It was aligned with the sequences obtained from the samples Nhas white bacteria and Nhas red bacteria.
NhaS sequence from white colonies (in 3' to 5' direction of the complementary reverse)
TAAATAAAAAGTTTTTTCTAATGCGTTTCTTCTCCTACAACCGAAAACACCGGGTCAGTGAGCGAGGA ACCTGCATAACGCGAAGCACGCTTTTCCGCAAGAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTT TTTGCCGGACTGCAGCGGCCGCTACTAGTATTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCA CCGGTGGAGTGACTACCTTCAGCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGT GATGTCCAGTTTGATGTCGGTTTTGTAAGCACCCGGCAGCTGAACCGGTTTTTTAGCCATGTAGGTGG TTTTAACTTCAGCGTCGTAGTGACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGA GCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGG ACCGTCGGACGGGAAGTTGGTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGG AGTCCTGGGTAACGGTAACAACACCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCC GGGAAGGACAGTTTCAGGTAGTCCGGGATGTCAGCCGGGTGTTTAACGTAAGCTTTGGAACCGTACTG GAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTTCAGTTTAGCGG TCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTTCGAACTCGTGACCGTTAACGGA ACCTTTCCATACATGACCATGTTCTCTCGTCTGATTAGCATCGTGAGCCTGATTCTGTCCTTCTACTT CGCTTACAAATACCGTTATCGTGTGATTAACGCGGTGCTGGGCCGTCGCTGGCTGCGTAAAGTTATTA TCGGTTTTGCCATGCAGATTCCGATGATTCGTGACCGTATGCTGGGTAGCGTTCTGCAAAGTAACCGT CCGCAAAATGTGTAA>
NhaS sequence from red colonies (in 3' to 5' direction of the complementary reverse)
AAAGTGTCCACCCCGTACGACCGAGCGGAGCGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTA ATCTTTTCGGCTTAAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGC CGCTACTAGTATATAAACGCAGAAAGGCCCACCCGAAGGTGAGCCAGTGTGACTCTAGTAGAGAGCGT TCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGATGC CTGGCTCTAGTAGCGATCTACACTAGCACTATCAGCGTTATTAAGCACCGGTGGAGTGACGACCTTCA GCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGT TTTGTAAGCACCCGGCAGCTGAACCGGTTTTTTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGT GACCACCGTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGAGCACCGTCTTCCGGGTACATA CGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCGTCGGACGGGAAGTTGGT ACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAA CACCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGACAGTTTCAGGTAG TCCGGGATGTCAGCCGGGTGTTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGAACAGGATG TCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTTCAGTTTAGCGGTCTCGGGTACCTTCGAACG GACGACCTTCACCTTCACCCTTCAATTTTCAAACTCGTGACCGTAAACGGAACCTTTCCATACAACTT TGAAAACGCATGAAACTCATTTGAATAACGTCTTCCGGAAGAAAGCCCAATCTAAGTATTTTCTCCCT CTTTTCTCATATAAATGTGATGAATATTTGATCTATCCGCCCTCCAACAACTTTCCCACAACAATCAT GTATCGAAATTCCTGTTATACGACACTATAAAGATGGTATAAAAAGCCCGTGGAGGGGGCGTGACCAReport
The report obtained from the analysis with the NhaS in red colonies is the following:
The report obtained from the analysis with the NhaS in white colonies is the following:
We also made an analysis with the Ribosome Binding Site (RBS) sequence:
With these results we can infer that the BioBrick works find and expresses the NhaS (because both of them survive in a high NaCl concentrated medium) but it stops being translated in the RBS or in the RFP region causing the colonies to be white instead of red but being able to survive in a medium with high NaCl concentration.
The question is if the problem is caused by a mutation, When did it happen?
The mutation