Team:Nanjing NFLS/biobricks.html

From 2014hs.igem.org

(Difference between revisions)
(correct the links of project and notebook menupage)
 
(20 intermediate revisions not shown)
Line 1: Line 1:
<html xmlns="http://www.w3.org/1999/xhtml">
<html xmlns="http://www.w3.org/1999/xhtml">
<head>
<head>
-
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" />
+
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
-
<title>Untitled Document</title>
+
<script type="text/javascript" src="http://code.jquery.com/jquery-1.11.1.min.js"></script>
 +
<script type="text/javascript" src="http://code.jquery.com/ui/1.10.4/jquery-ui.js"></script>
 +
<title>Biobricks | iGEM Nanjing_NFLS</title>
<style type="text/css">
<style type="text/css">
 +
#menubar {
 +
font-size: 12px
 +
}
 +
p{
 +
line-height:100%
 +
}
 +
div#contentSub{
 +
    display: none;
 +
    position: absolute;
 +
    left: 0px;
 +
    top: 0px;
 +
}
 +
div#top-section{
 +
    background: url() no repeat;
 +
    background-color:#E3E3E3;
 +
    color: #D1E9E9;
 +
    height: 0px;
 +
    width:  100%;
 +
    border: 0px;
 +
 +
}
 +
#content
 +
{
 +
border:none;
 +
height: 100%;
 +
margin:0 0 0 0px;
 +
padding:0;
 +
position: absolute;
 +
background-color: #E3E3E3;
 +
line-height: normal;
 +
    width: 1350px;
 +
    border-left-width:0px;
 +
    border-right-width:0px;
 +
    padding:0px;
 +
}
 +
 +
#p-logo {
 +
    height:0px; overflow:hidden; display: none;
 +
}
 +
#top-section {
 +
    background-color: #444444;
 +
    height: 0px;
 +
    border-width:0px;
 +
    border-top-width:0px;
 +
}
 +
 +
#contentSub {
 +
display: none;
 +
}
 +
 +
.firstHeading {
 +
    display: none;
 +
}
 +
div#catlinks {
 +
    visibility: hidden;
 +
    height: 0px;
 +
}
 +
#searchInput
 +
{
 +
    position:relative;
 +
    height:0px;
 +
    margin-bottom:0em;
 +
    visibility:hidden;
 +
}
 +
input.searchButton
 +
{
 +
    height:0px;
 +
    margin-bottom:0em;
 +
    visibility:hidden;
 +
}
 +
#footer-box{display:none;}
 +
#catlinks{display:none;}
body {
body {
background-color: #E3E3E3;
background-color: #E3E3E3;
font: century ;
font: century ;
-
width: 100%;
+
width: 1350px;
padding: 0px;
padding: 0px;
margin: 0px;
margin: 0px;
Line 18: Line 92:
}
}
#page {
#page {
 +
margin-left:auto;
 +
margin-right:auto;
position: absolute;
position: absolute;
-
width: 100%;
+
width: 1350px;
-
height: 698px;
+
height: 5600px;
z-index: 0;
z-index: 0;
left: 0px;
left: 0px;
Line 37: Line 113:
#primary-nav {
#primary-nav {
position: absolute;
position: absolute;
-
width: 1800px;
+
width: 1095px;
-
height: 50px;
+
height: 60px;
z-index: 2;
z-index: 2;
-
left: 255px;
+
left:271px;
-
top: 102px;
+
top: 112px;
}
}
#primary-nav li{
#primary-nav li{
Line 76: Line 152:
position: absolute;
position: absolute;
width: 160px;
width: 160px;
-
height: 216px;
+
height: 256px;
left: -500px;
left: -500px;
top: 136px;
top: 136px;
Line 85: Line 161:
position: absolute;
position: absolute;
padding-left: 20px;
padding-left: 20px;
-
text-align:middle;
 
line-height: 40px;
line-height: 40px;
width: 140px;
width: 140px;
Line 113: Line 188:
position: absolute;
position: absolute;
padding-left: 20px;
padding-left: 20px;
-
text-align:middle;
 
line-height: 40px;
line-height: 40px;
width: 140px;
width: 140px;
Line 129: Line 203:
z-index: 19;
z-index: 19;
}
}
-
</style>
+
#bottom {
-
<style type="text/css">
+
position: absolute;
 +
width: 100%;
 +
height: 50px;
 +
left: 0px;
 +
top: 5550px;
 +
opacity: 0.6;
 +
}
 +
#banner {
 +
position: absolute;
 +
width: 1350px;
 +
height: 100px;
 +
z-index: 19;
 +
left: 282px;
 +
top: 0px;
 +
opacity: 0.6;
 +
}
#apDiv1 {
#apDiv1 {
position: absolute;
position: absolute;
Line 136: Line 225:
height: 136px;
height: 136px;
z-index: 1;
z-index: 1;
-
top: 273px;
+
top: 190px;
background-color: #0066CC;
background-color: #0066CC;
font-size: 150px;
font-size: 150px;
Line 154: Line 243:
z-index: 2;
z-index: 2;
left: 404px;
left: 404px;
-
top: 273px;
+
top: 190px;
font-size: 20px;
font-size: 20px;
color: #FFF;
color: #FFF;
Line 162: Line 251:
white-space: normal;
white-space: normal;
     word-break: break-all;;
     word-break: break-all;;
-
overflow:hidden
+
overflow:hidden;
}
}
p{white-space: normal; line-height:0px}
p{white-space: normal; line-height:0px}
Line 183: Line 272:
         y:ev.clientY + document.body.scrollTop - document.body.clientTop
         y:ev.clientY + document.body.scrollTop - document.body.clientTop
     };
     };
-
};
+
}  
$(document).ready(function(ev){
$(document).ready(function(ev){
 +
  var blocks = $("div.trans");
   var menu1 = $("div.menuPlist");
   var menu1 = $("div.menuPlist");
   var menu2 = $("div.menuNlist");
   var menu2 = $("div.menuNlist");
 +
  var absttitle = new Array("What's this about?", "What are the biobricks?", "What's about experiments?", "How we ensure safety?", "How did we popularize it?", "Who are we?");
 +
  var abstcontent = new Array("Utilizing the unique features of CRISPR-Cas9 system, our team developed a gene editing tool kit that can be effectively used in eukaryotic cells. CRISPR-Cas9 based system offers several advantages including greater flexibility in silencing and repairing gene expression, and the ability to introduce larger gene fragments. The system was designed to have great compatibility with a wide range of organisms and easy to work with, and has been preliminarily validated by plasmid transfection in CHO cell line. With iGEM database in mind, the kit follows a modular design and aims to facilitate future iGEM projects with greater flexibility and compatibility in gene editing.", "Our gene editing kit has three components: Guide RNA (g-RNA), outer membrane protein of TMV homologous DNA sequences and CRISPR-Cas9 enzyme. Both the g-RNA and the homologous DNA sequences have high specificity in CHO. And the CRISPR-Cas9 enzyme was proven to be efficient in eukaryotic cells.", "It is the record of our experiments, which concludes every step of design, build-up, and examine; it is the trace of our life, which leaves us the most valuable memory of fighting, sharing, and devoting; it is the path in springtime, which not only gives us a chance to learn synthetic biology, but also provides a platform to boarder our views.", "1.Would any of your project ideas raise safety issues in terms of: researcher safety, public safety, or environmental safety? 2.Do any of the new BioBrick parts (or devices) that you made this year raise safety issues? 3.Is there a local biosafety group, committee, or review board at your institution?4. Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering?", "To attract more attention on the competition and our project about the CRISPR-Cas system, we ran a club named iGEMER at NFLS. A home page about our study has been created since we started our project. On the website, we have several segments: team introduction, project progress, notebook, results and conclusions, safety, attributions, human practices and amusement. ", "We are a group of passionate syudents from Nanjing Foreign Languages School, specializing in different disciplines: BIO, computer science, mathematics.., we gather together, questing for the same interest. We are the symbol of plurality, vitality and unity.");
 +
  var picts = new Array("https://static.igem.org/mediawiki/2014hs/6/6a/NFLS_image6.png", "https://static.igem.org/mediawiki/2014hs/7/70/NFLS_image2.png", "https://static.igem.org/mediawiki/2014hs/c/c0/NFLS_image3.png", "https://static.igem.org/mediawiki/2014hs/7/7f/NFLS_image5.png", "https://static.igem.org/mediawiki/2014hs/e/ed/NFLS_image4.png", "https://static.igem.org/mediawiki/2014hs/b/be/NFLS_image1.png");
 +
  $("#menuProject").css("height", "0px");
 +
  $("#menuNotebook").css("height", "0px");
   $("#nav-notebook").mouseover(function(){
   $("#nav-notebook").mouseover(function(){
 +
  if ($("#menuNotebook").hasClass("cur")) {
 +
  return;
 +
  };
 +
  $("#menuNotebook").addClass("cur");
  $("#menuNotebook").css("left", "532px");
  $("#menuNotebook").css("left", "532px");
 +
  $("#menuNotebook").animate({height:'136px'}, 500, function(){
 +
  $("#menuNotebook").removeClass("cur");
 +
  });
   });
   });
   $("#nav-notebook").mouseout(function(ev){
   $("#nav-notebook").mouseout(function(ev){
 +
  $("#menuNotebook").addClass("cur");
  var mousePos = mousePosition(ev);
  var mousePos = mousePosition(ev);
  if (mousePos.y < 136) {
  if (mousePos.y < 136) {
-
          $("#menuNotebook").css("left", "-500px");
+
  $("#menuNotebook").animate({height:'0px'}, 500, function(){
 +
  $("#menuNotebook").css("left", "-500px");
 +
          $("#menuNotebook").removeClass("cur");
 +
  });
  }
  }
 +
  else {
 +
      $("#menuNotebook").removeClass("cur");
 +
  };
   });
   });
-
   $("#menuNotebook").mouseleave(function(){
+
   $("#menuNotebook").mouseleave(function(ev){
-
      $("#menuNotebook").css("left", "-500px");
+
  $(this).addClass("cur");
 +
  var mousePos = mousePosition(ev);
 +
  if ((mousePos.y > 136) || (mousePos.x > 640) || (mousePos.x < 553)) {
 +
          $("#menuNotebook").animate({height:'0px'}, 500, function(){
 +
      $("#menuNotebook").css("left", "-500px");
 +
  $("#menuNotebook").removeClass("cur");
 +
      });
 +
  }
 +
  else {
 +
      $("#menuNotebook").removeClass("cur");
 +
  };
   });
   });
   $("div.menuNlist").mouseover(function(){
   $("div.menuNlist").mouseover(function(){
Line 228: Line 347:
   });
   });
   $("#nav-project").mouseover(function(){
   $("#nav-project").mouseover(function(){
 +
  if ($("#menuProject").hasClass("cur")) {
 +
  return;
 +
  };
 +
  $("#menuProject").addClass("cur");
  $("#menuProject").css("left", "340px");
  $("#menuProject").css("left", "340px");
 +
  $("#menuProject").animate({height:'256px'}, 500, function(){
 +
  $("#menuNotebook").removeClass("cur");
 +
  });
   });
   });
   $("#nav-project").mouseout(function(ev){
   $("#nav-project").mouseout(function(ev){
 +
  $("#menuProject").addClass("cur");
  var mousePos = mousePosition(ev);
  var mousePos = mousePosition(ev);
  if (mousePos.y < 136) {
  if (mousePos.y < 136) {
-
          $("#menuProject").css("left", "-500px");
+
      $("#menuProject").animate({height:'0px'}, 500, function(){
 +
  $("#menuProject").css("left", "-500px");
 +
          $("#menuProject").removeClass("cur");
 +
  });
  }
  }
 +
  else {
 +
      $("#menuProject").removeClass("cur");
 +
  };
   });
   });
-
   $("#menuProject").mouseleave(function(){
+
   $("#menuProject").mouseleave(function(ev){
-
      $("#menuProject").css("left", "-500px");
+
  $(this).addClass("cur");
 +
  var mousePos = mousePosition(ev);
 +
  if ((mousePos.y > 136) || (mousePos.x > 430) || (mousePos.x < 361)) {
 +
          $("#menuProject").animate({height:'0px'}, 500, function(){
 +
      $("#menuProject").css("left", "-500px");
 +
  $("#menuProject").removeClass("cur");
 +
      });
 +
  }
 +
  else {
 +
      $("#menuProject").removeClass("cur");
 +
  };
   });
   });
   $("div.menuPlist").mouseover(function(){
   $("div.menuPlist").mouseover(function(){
Line 270: Line 413:
</head>
</head>
-
<body>
+
<body topmargin="0">
 +
<div id="page">
<div id="apDiv1">A</div>
<div id="apDiv1">A</div>
<div id="apDiv2">gRNA Specific Recognition Sequence Transcription Vectors<br /><br />
<div id="apDiv2">gRNA Specific Recognition Sequence Transcription Vectors<br /><br />
Line 276: Line 420:
   The Guide-RNA sequence comes from Addgene plasmid 41824(gRNA_Cloning Vector).<br />
   The Guide-RNA sequence comes from Addgene plasmid 41824(gRNA_Cloning Vector).<br />
The Guide-RNA sequence is inserted in the DNA from into basic plasmid backbone pSB1C3（BBa_J04450）with BioBrick cloning site prefix（EcoR I，Xba I）and suffix（Spe I，Pst I）. When the plasmid is transfected into the mammalian cell nuclei, the plasmid will transcript into the form of Guide-RNA or gRNA.</div>
The Guide-RNA sequence is inserted in the DNA from into basic plasmid backbone pSB1C3（BBa_J04450）with BioBrick cloning site prefix（EcoR I，Xba I）and suffix（Spe I，Pst I）. When the plasmid is transfected into the mammalian cell nuclei, the plasmid will transcript into the form of Guide-RNA or gRNA.</div>
-
<div id="apDiv2" style="top:630px;">Three Sets Of gRNA</div>
+
<div id="apDiv2" style="top:550px;">Three Sets Of gRNA</div>
-
<div id="apDiv1" style="top:750px">a</div>
+
<div id="apDiv1" style="top:680px">a</div>
-
<div id="apDiv2" style="top:750px;">
+
<div id="apDiv2" style="top:680px;">
   gRNA-A (BBa_K1252001)
   gRNA-A (BBa_K1252001)
TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG<span class="yellow">TAGAATTGATCAGAGGAAC</span>GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT<span class="blue">TCTAGA</span>CCCAGCTTTCTTGTACAAAGTTGGCATTA<br />
TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG<span class="yellow">TAGAATTGATCAGAGGAAC</span>GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT<span class="blue">TCTAGA</span>CCCAGCTTTCTTGTACAAAGTTGGCATTA<br />
    
    
</div>
</div>
-
<div id="apDiv1" style="top:1150px">b</div>
+
<div id="apDiv1" style="top:1070px">b</div>
-
<div id="apDiv2" style="top:1150px;">gRNA-B (BBa_K1252002)
+
<div id="apDiv2" style="top:1070px;">gRNA-B (BBa_K1252002)
TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG<span class="yellow">AGGAACCGGATCTTATAAT</span>GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT<span class="blue">TCTAGA</span>CCCAGCTTTCTTGTACAAAGTTGGCATTA</div>
TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG<span class="yellow">AGGAACCGGATCTTATAAT</span>GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT<span class="blue">TCTAGA</span>CCCAGCTTTCTTGTACAAAGTTGGCATTA</div>
-
<div id="apDiv1" style="top:1500px">c</div>
+
<div id="apDiv1" style="top:1420px">c</div>
-
<div id="apDiv2" style="top:1500px;">gRNA-C (BBa_K1252003)
+
<div id="apDiv2" style="top:1420px;">gRNA-C (BBa_K1252003)
TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG<span class="yellow">TACGCACCACGTGTGATTA</span>GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT
TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG<span class="yellow">TACGCACCACGTGTGATTA</span>GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT
<span class="blue">TCTAGA</span>CCCAGCTTTCTTGTACAAAGTTGGCATTA</div>
<span class="blue">TCTAGA</span>CCCAGCTTTCTTGTACAAAGTTGGCATTA</div>
-
<div id="apDiv1" style="top:1900px;Height:auto">*</div>
+
<div id="apDiv1" style="top:1820px;Height:auto">*</div>
-
<div id="apDiv2" style="top:1900px;">*The unhighlighted parts of each gRNA is identical. <br />
+
<div id="apDiv2" style="top:1820px;">*The unhighlighted parts of each gRNA is identical. <br />
*The blue highlighted part is mutated from TCTAGA（EcoR I）to TCTAGT.<br />
*The blue highlighted part is mutated from TCTAGA（EcoR I）to TCTAGT.<br />
*The yellow highlighted part is commentary to the corresponding target gene with homologous arms.<br />
*The yellow highlighted part is commentary to the corresponding target gene with homologous arms.<br />
*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）.<br />
*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）.<br />
</div>
</div>
-
<div id="apDiv1" style="top:2250px">B</div>
+
<div id="apDiv1" style="top:2170px">B</div>
-
<div id="apDiv2" style="top:2250px;">thDNA Target Recombinant Sequences of Vectors<br /><br />
+
<div id="apDiv2" style="top:2170px;">thDNA Target Recombinant Sequences of Vectors<br /><br />
Upstream and Downstream Homologous Arm with Target Gene
Upstream and Downstream Homologous Arm with Target Gene
There are three sets of thDNA corresponding to the three sets of gRNA, with an upstream homologous and a downstream homologous in each set.<br />
There are three sets of thDNA corresponding to the three sets of gRNA, with an upstream homologous and a downstream homologous in each set.<br />
Line 305: Line 449:
The thDNA sequence is inserted in the DNA from into basic plasmid backbone pSB1C3（BBa_J04450）with BioBrick cloning site prefix（EcoR I，Xba I）and suffix（Spe I，Pst I）. When the plasmid is transfected into the mammalian cell nuclei, the plasmid will retain its form until there’s a CRISPR-Cas9 breakage available.<br />
The thDNA sequence is inserted in the DNA from into basic plasmid backbone pSB1C3（BBa_J04450）with BioBrick cloning site prefix（EcoR I，Xba I）and suffix（Spe I，Pst I）. When the plasmid is transfected into the mammalian cell nuclei, the plasmid will retain its form until there’s a CRISPR-Cas9 breakage available.<br />
</div>
</div>
-
<div id="apDiv1" style="top:2750px">a</div>
+
<div id="apDiv1" style="top:2670px">a</div>
-
<div id="apDiv2" style="top:2750px;">thAF (BBa_K1252004)
+
<div id="apDiv2" style="top:2670px;">thAF (BBa_K1252004)
TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAATCGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGAAATCAGT<span class="yellow">GTAGAATTGATCAGAGGAACCGG</span><br /><br />
TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAATCGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGAAATCAGT<span class="yellow">GTAGAATTGATCAGAGGAACCGG</span><br /><br />
*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）<br />
*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）<br />
</div>
</div>
-
<div id="apDiv1" style="top:3050px">b</div>
+
<div id="apDiv1" style="top:2970px">b</div>
-
<div id="apDiv2" style="top:3050px;">thBF (BBa_K1252005)
+
<div id="apDiv2" style="top:2970px;">thBF (BBa_K1252005)
TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAATCGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGAAATCAGT<span class="yellow">GAGGAACCGGATCTTATAATCGG</span><br /><br />
TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAATCGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGAAATCAGT<span class="yellow">GAGGAACCGGATCTTATAATCGG</span><br /><br />
*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）<br />
*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）<br />
</div>
</div>
-
<div id="apDiv1" style="top:3350px">c</div>
+
<div id="apDiv1" style="top:3270px">c</div>
-
<div id="apDiv2" style="top:3350px;">thCF (BBa_K1252006)
+
<div id="apDiv2" style="top:3270px;">thCF (BBa_K1252006)
TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAATCGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGAAATCAGT<span class=yellow>GTACGCACCACGTGTGATTACGG</span><br /><br />
TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAATCGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGAAATCAGT<span class=yellow>GTACGCACCACGTGTGATTACGG</span><br /><br />
*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）
*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）
</div>
</div>
-
<div id="apDiv1" style="top:3700px;height:auto">*</div>
+
<div id="apDiv1" style="top:3620px;height:auto">*</div>
-
<div id="apDiv2" style="top:3700px;">*The yellow highlighted part is commentary to the guide-RNA sequence with homologous arms.</div>
+
<div id="apDiv2" style="top:3620px;">*The yellow highlighted part is commentary to the guide-RNA sequence with homologous arms.</div>
-
<div id="apDiv1" style="top:3900px;">d</div>
+
<div id="apDiv1" style="top:3820px;">d</div>
-
<div id="apDiv2" style="top:3900px;"> thAR (BBa_K1252007)  
+
<div id="apDiv2" style="top:3820px;"> thAR (BBa_K1252007)  
<span class="yellow">GTAGAATTGATCAGAGGAACCGG</span>TTCAAACACAACAAGCTCGAACTGTCGTTCAAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCCCTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCACAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT</div>
<span class="yellow">GTAGAATTGATCAGAGGAACCGG</span>TTCAAACACAACAAGCTCGAACTGTCGTTCAAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCCCTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCACAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT</div>
-
<div id="apDiv1" style="top:4200px;">e</div>
+
<div id="apDiv1" style="top:4120px;">e</div>
-
<div id="apDiv2" style="top:4200px;"> thBR (BBa_K1252008)<span class="yellow">GAGGAACCGGATCTTATAATCGG</span>TTCAAACACAACAAGCTCGAACTGTCGTTCAAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCCCTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCACAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT</div>
+
<div id="apDiv2" style="top:4120px;"> thBR (BBa_K1252008)<span class="yellow">GAGGAACCGGATCTTATAATCGG</span>TTCAAACACAACAAGCTCGAACTGTCGTTCAAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCCCTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCACAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT</div>
-
<div id="apDiv1" style="top:4500px;">f</div>
+
<div id="apDiv1" style="top:4420px;">f</div>
-
<div id="apDiv2" style="top:4500px;">thCR (BBa_K1252008)  
+
<div id="apDiv2" style="top:4420px;">thCR (BBa_K1252008)  
<span class="yellow">GTACGCACCACGTGTGATTACGG</span>TTCAAACACAACAAGCTCGAACTGTCGTTCAAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCCCTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCACAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT</div>
<span class="yellow">GTACGCACCACGTGTGATTACGG</span>TTCAAACACAACAAGCTCGAACTGTCGTTCAAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCCCTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCACAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT</div>
-
<div id="apDiv1" style="top:4800px;Height:auto">*</div>
+
<div id="apDiv1" style="top:4720px;Height:auto">*</div>
-
<div id="apDiv2" style="top:4800px;height:auto;">*The yellow highlighted part is commentary to the guide-RNA sequence with homologous arms.</div>
+
<div id="apDiv2" style="top:4720px;height:auto;">*The yellow highlighted part is commentary to the guide-RNA sequence with homologous arms.</div>
-
<div id="apDiv1" style="top:5100px;">C</div>
+
<div id="apDiv1" style="top:5020px;">C</div>
-
<div id="apDiv2" style="top:5100px;">CRISPR-Cas9 Enzyme<br  /><br />
+
<div id="apDiv2" style="top:5020px;">CRISPR-Cas9 Enzyme<br  /><br />
Microbes rely on diverse defense mechanisms that allow them to withstand viral predation and exposure to invading nucleic acid. In many Bacteria and most Archaea, clustered regularly interspaced short palindromic repeats (CRISPR) form peculiar genetic loci, which provide acquired immunity against viruses and plasmids by targeting nucleic acid in a sequence-specific manner. These hypervariable loci take up genetic material from invasive elements and build up inheritable DNA-encoded immunity over time. Conversely, viruses have devised mutational escape strategies that allow them to circumvent the CRISPR/Cas system, albeit at a cost. CRISPR features may be exploited for typing purposes, epidemiological studies, host-virus ecological surveys, building specific immunity against undesirable genetic elements, and enhancing viral resistance in domesticated microbes. [1]
Microbes rely on diverse defense mechanisms that allow them to withstand viral predation and exposure to invading nucleic acid. In many Bacteria and most Archaea, clustered regularly interspaced short palindromic repeats (CRISPR) form peculiar genetic loci, which provide acquired immunity against viruses and plasmids by targeting nucleic acid in a sequence-specific manner. These hypervariable loci take up genetic material from invasive elements and build up inheritable DNA-encoded immunity over time. Conversely, viruses have devised mutational escape strategies that allow them to circumvent the CRISPR/Cas system, albeit at a cost. CRISPR features may be exploited for typing purposes, epidemiological studies, host-virus ecological surveys, building specific immunity against undesirable genetic elements, and enhancing viral resistance in domesticated microbes. [1]
[1] Horvath, P.; Barrangou, R. (2010). "CRISPR/Cas, the Immune System of Bacteria and Archaea". Science 327 (5962): 167–170.</div>
[1] Horvath, P.; Barrangou, R. (2010). "CRISPR/Cas, the Immune System of Bacteria and Archaea". Science 327 (5962): 167–170.</div>
-
 
-
<div id="page">
 
<div id="logo"><img src="https://static.igem.org/mediawiki/2014hs/7/73/NFLSLOGONEW.jpg" width="250" height="157" alt="iGEM_NFLS" /></div>
<div id="logo"><img src="https://static.igem.org/mediawiki/2014hs/7/73/NFLSLOGONEW.jpg" width="250" height="157" alt="iGEM_NFLS" /></div>
 +
  <div id="banner"><img src="https://static.igem.org/mediawiki/2014hs/3/31/NFLS_banner.jpg" width="1350" height="100" alt="banner" /></div>
<div id="primary-nav">
<div id="primary-nav">
   <ul>
   <ul>
-
   <li class="selected" id="nav-main" ><a href="https://2014hs.igem.org/Team:Nanjing_NFLS">MAIN</a></li>
+
   <li id="nav-main" ><a href="https://2014hs.igem.org/Team:Nanjing_NFLS">MAIN</a></li>
   <li id="nav-project"><a href="https://2014hs.igem.org/Team:Nanjing_NFLS/project.html">PROJECT</a></li>
   <li id="nav-project"><a href="https://2014hs.igem.org/Team:Nanjing_NFLS/project.html">PROJECT</a></li>
-
   <li id="nav-biobricks"><a href="https://2014hs.igem.org/Team:Nanjing_NFLS/biobricks.html">BIOBRICKS</a></li>
+
   <li class="selected" id="nav-biobricks"><a href="https://2014hs.igem.org/Team:Nanjing_NFLS/biobricks.html">BIOBRICKS</a></li>
   <li id="nav-notebook"><a href="https://2014hs.igem.org/Team:Nanjing_NFLS/notebook.html">NOTEBOOK</a></li>
   <li id="nav-notebook"><a href="https://2014hs.igem.org/Team:Nanjing_NFLS/notebook.html">NOTEBOOK</a></li>
   <li id="nav-safety"><a href="https://2014hs.igem.org/Team:Nanjing_NFLS/safety.html">SAFETY</a></li>
   <li id="nav-safety"><a href="https://2014hs.igem.org/Team:Nanjing_NFLS/safety.html">SAFETY</a></li>
Line 353: Line 496:
</div>
</div>
<div id="menuProject">
<div id="menuProject">
-
   <div id="menuPbar1" class="menuPlist" style="top:16px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/project.html';">ABSTRACT</div>
+
   <div id="menuPbar1" class="menuPlist" style="top:16px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/project.html#0';">ABSTRACT</div>
-
   <div id="menuPbar2" class="menuPlist" style="top:56px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/project.html';">TOOKIT</div>
+
   <div id="menuPbar2" class="menuPlist" style="top:56px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/project.html#1';">TOOKIT</div>
-
   <div id="menuPbar3" class="menuPlist" style="top:96px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/project.html';">FUNCTION</div>
+
   <div id="menuPbar3" class="menuPlist" style="top:96px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/biobricks.html';">FUNCTION</div>
-
   <div id="menuPbar4" class="menuPlist" style="top:136px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/project.html';">ADVANTAGE</div>
+
   <div id="menuPbar4" class="menuPlist" style="top:136px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/project.html#9';">ADVANTAGE</div>
-
   <div id="menuPbar5" class="menuPlist" style="top:176px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/project.html';;">DESIGN</div>
+
   <div id="menuPbar5" class="menuPlist" style="top:176px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/notebook.html#design';">DESIGN</div>
-
   <div id="menuPbar6" class="menuPlist" style="top:216px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/project.html';">BUILD UP</div>
+
   <div id="menuPbar6" class="menuPlist" style="top:216px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/notebook.html#buildup';">BUILD UP</div>
   <div id="menuP-hbar1" class="menuP-hbar" style="top:55px"></div>
   <div id="menuP-hbar1" class="menuP-hbar" style="top:55px"></div>
   <div id="menuP-hbar2" class="menuP-hbar" style="top:95px"></div>
   <div id="menuP-hbar2" class="menuP-hbar" style="top:95px"></div>
Line 366: Line 509:
</div>
</div>
<div id="menuNotebook">
<div id="menuNotebook">
-
   <div id="menuNbar1" class="menuNlist" style="top:16px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/notebook.html';">PROVE</div>
+
   <div id="menuNbar1" class="menuNlist" style="top:16px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/notebook.html#prove';">PROVE</div>
-
   <div id="menuNbar2" class="menuNlist" style="top:56px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/notebook.html';">BUILD UP</div>
+
   <div id="menuNbar2" class="menuNlist" style="top:56px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/notebook.html#buildup';">BUILD UP</div>
   <div id="menuNbar3" class="menuNlist" style="top:96px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/notebook.html';">EXAMINE</div>
   <div id="menuNbar3" class="menuNlist" style="top:96px" onclick="document.location.href='https://2014hs.igem.org/Team:Nanjing_NFLS/notebook.html';">EXAMINE</div>
   <div id="menuN-hbar1" class="menuN-hbar" style="top:55px"></div>
   <div id="menuN-hbar1" class="menuN-hbar" style="top:55px"></div>
   <div id="menuN-hbar2" class="menuN-hbar" style="top:95px"></div>
   <div id="menuN-hbar2" class="menuN-hbar" style="top:95px"></div>
</div>
</div>
 +
</div>
 +
 +
 +
 +
<div id="bottom" style="text-align:center;"><img src="https://static.igem.org/mediawiki/2014hs/a/a2/NFLS_bottom.png" width="1350" height="50" alt="bottomimage" /></div>
</body>
</body>
</html>
</html>

Latest revision as of 02:35, 21 June 2014

Biobricks | iGEM Nanjing_NFLS

A
gRNA Specific Recognition Sequence Transcription Vectors

There are three sets of gRNA.
The Guide-RNA sequence comes from Addgene plasmid 41824(gRNA_Cloning Vector).
The Guide-RNA sequence is inserted in the DNA from into basic plasmid backbone pSB1C3（BBa_J04450）with BioBrick cloning site prefix（EcoR I，Xba I）and suffix（Spe I，Pst I）. When the plasmid is transfected into the mammalian cell nuclei, the plasmid will transcript into the form of Guide-RNA or gRNA.
Three Sets Of gRNA
a
gRNA-A (BBa_K1252001) TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTAGAATTGATCAGAGGAACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGACCCAGCTTTCTTGTACAAAGTTGGCATTA
b
gRNA-B (BBa_K1252002) TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGAGGAACCGGATCTTATAATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGACCCAGCTTTCTTGTACAAAGTTGGCATTA
c
gRNA-C (BBa_K1252003) TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTACGCACCACGTGTGATTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT TCTAGACCCAGCTTTCTTGTACAAAGTTGGCATTA
*
*The unhighlighted parts of each gRNA is identical.
*The blue highlighted part is mutated from TCTAGA（EcoR I）to TCTAGT.
*The yellow highlighted part is commentary to the corresponding target gene with homologous arms.
*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）.
B
thDNA Target Recombinant Sequences of Vectors

Upstream and Downstream Homologous Arm with Target Gene There are three sets of thDNA corresponding to the three sets of gRNA, with an upstream homologous and a downstream homologous in each set.
thAF/thAR
thBF/thBR
thCF/thCR
The thDNA sequence is inserted in the DNA from into basic plasmid backbone pSB1C3（BBa_J04450）with BioBrick cloning site prefix（EcoR I，Xba I）and suffix（Spe I，Pst I）. When the plasmid is transfected into the mammalian cell nuclei, the plasmid will retain its form until there’s a CRISPR-Cas9 breakage available.
a
thAF (BBa_K1252004) TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAATCGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGAAATCAGTGTAGAATTGATCAGAGGAACCGG

*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）
b
thBF (BBa_K1252005) TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAATCGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGAAATCAGTGAGGAACCGGATCTTATAATCGG

*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）
c
thCF (BBa_K1252006) TGAGTTTTAAAAAGAATAATTTAATCGATGATGATTCGGAGGCTACTGTCGCCGAATCGGATTCGTTTTAAATATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGAAATCAGTGTACGCACCACGTGTGATTACGG

*Xba I is added to the upstream sequence, and Spe I is added to the downstream sequence to be compatible with the basic backbone pSB1C3（BBa_J04450）
*
*The yellow highlighted part is commentary to the guide-RNA sequence with homologous arms.
d
thAR (BBa_K1252007) GTAGAATTGATCAGAGGAACCGGTTCAAACACAACAAGCTCGAACTGTCGTTCAAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCCCTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCACAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT
e
thBR (BBa_K1252008)GAGGAACCGGATCTTATAATCGGTTCAAACACAACAAGCTCGAACTGTCGTTCAAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCCCTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCACAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT
f
thCR (BBa_K1252008) GTACGCACCACGTGTGATTACGGTTCAAACACAACAAGCTCGAACTGTCGTTCAAAGACAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTTAGGTTCCCTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCACAGCACTGTTAGGTGCATTCGACACTAGAAATAGAAT
*
*The yellow highlighted part is commentary to the guide-RNA sequence with homologous arms.
C
CRISPR-Cas9 Enzyme

Microbes rely on diverse defense mechanisms that allow them to withstand viral predation and exposure to invading nucleic acid. In many Bacteria and most Archaea, clustered regularly interspaced short palindromic repeats (CRISPR) form peculiar genetic loci, which provide acquired immunity against viruses and plasmids by targeting nucleic acid in a sequence-specific manner. These hypervariable loci take up genetic material from invasive elements and build up inheritable DNA-encoded immunity over time. Conversely, viruses have devised mutational escape strategies that allow them to circumvent the CRISPR/Cas system, albeit at a cost. CRISPR features may be exploited for typing purposes, epidemiological studies, host-virus ecological surveys, building specific immunity against undesirable genetic elements, and enhancing viral resistance in domesticated microbes. [1] [1] Horvath, P.; Barrangou, R. (2010). "CRISPR/Cas, the Immune System of Bacteria and Archaea". Science 327 (5962): 167–170.
bottomimage

Retrieved from "http://2014hs.igem.org/Team:Nanjing_NFLS/biobricks.html"